ID: 1131217139

View in Genome Browser
Species Human (GRCh38)
Location 15:90547637-90547659
Sequence AGCCCTCATGTCTCTAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131217134_1131217139 5 Left 1131217134 15:90547609-90547631 CCATCAGTAAAGGGGTAGCTAGG 0: 1
1: 0
2: 0
3: 25
4: 76
Right 1131217139 15:90547637-90547659 AGCCCTCATGTCTCTAGGCAGGG 0: 1
1: 0
2: 3
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131217139 Original CRISPR AGCCCTCATGTCTCTAGGCA GGG Intronic
901639774 1:10687348-10687370 AGCCCTCTTGGCTTTAGGAAGGG + Intronic
903183721 1:21618159-21618181 AGCCCTCCTTTCTCCAGGCAAGG - Intronic
904782121 1:32958037-32958059 AGAGCTCATGTCTCTAGACTAGG - Intronic
905082521 1:35336832-35336854 AGTCCTCATGTCTCTACAAAAGG + Intronic
906151185 1:43588604-43588626 ACCCCTCCTGTCTCTGAGCATGG + Intronic
907317078 1:53579358-53579380 AGGCCTCATGTCCCCTGGCACGG - Intronic
909193402 1:72584821-72584843 AGAGCTTATGTCTCTAGGAATGG - Intergenic
912252306 1:108024280-108024302 AGCCCACATGGATCCAGGCATGG + Intergenic
915903501 1:159862513-159862535 AACTCTCATGTCTCTAGGCTCGG + Exonic
915976103 1:160390492-160390514 AGACCTCACCTCTGTAGGCAGGG - Intergenic
917454779 1:175177033-175177055 AGCCTTGAGGTCTCCAGGCATGG - Intronic
917926077 1:179790154-179790176 ATCCCTCCAGTCTCTAGGCTTGG - Intronic
918240805 1:182618412-182618434 TGCCCACGGGTCTCTAGGCAGGG - Intergenic
921095032 1:211879037-211879059 AGCCCTCATGTTGCTAAGCCTGG + Intergenic
922182398 1:223245718-223245740 CGCCATCATCTCTCCAGGCATGG - Intronic
924594648 1:245434702-245434724 AGCTCTCTTGTCTCTAGGTGGGG + Intronic
1065114785 10:22474927-22474949 AATCCTCATGTCTCTTGGGAAGG - Intergenic
1066166567 10:32794885-32794907 AGCCCTGTTCTCTCTAGGTATGG + Intronic
1066732643 10:38449250-38449272 GGGGCTCATGTCTCTGGGCAGGG - Intergenic
1070700187 10:78596341-78596363 AGACATCATGTCTGCAGGCAAGG + Intergenic
1070818517 10:79340712-79340734 AGCCCTCAACTCTCTAGAGATGG + Intergenic
1070995068 10:80771240-80771262 AGCCCTCAGCTCTCTGTGCAGGG + Intergenic
1071223306 10:83495431-83495453 AGTCCCCATGTCTCTAGACATGG - Intergenic
1073257472 10:102162338-102162360 AACCCTCAGGTCTCTAGGTGAGG + Exonic
1074062358 10:109978567-109978589 CGCCCTCATGTGTCTCAGCATGG - Intergenic
1075959050 10:126551170-126551192 AAGCCTCAGTTCTCTAGGCAAGG + Intronic
1076106658 10:127828706-127828728 AGCCCTCATGTTGCTGTGCACGG - Intergenic
1076264549 10:129099426-129099448 AGCCCTGCTGCCTCAAGGCAGGG + Intergenic
1076728883 10:132428604-132428626 AGTCCCCATTTCTCAAGGCAGGG - Intergenic
1078108448 11:8373224-8373246 AACCCACATGTTTCTGGGCATGG + Intergenic
1079418273 11:20261130-20261152 AGCCCTCATTTCTCTCTACATGG + Intergenic
1082851474 11:57768857-57768879 AACCCGCAAGTTTCTAGGCAAGG - Intronic
1085879941 11:80454654-80454676 AGCCCTCATGTCTCATGACATGG - Intergenic
1086558691 11:88142024-88142046 TGGCCTCATCTCTCTAGGCAAGG - Intronic
1087718199 11:101632829-101632851 AGTCCCCAAGTCCCTAGGCAGGG - Intronic
1087820754 11:102709410-102709432 AGCTCTCATGTGTAGAGGCAGGG + Intergenic
1091294705 11:134465539-134465561 AGCTCTCCTGTTTCCAGGCATGG + Intergenic
1098640996 12:72838662-72838684 CCCTCTCATGTCTCTAGGAAAGG + Intergenic
1099914242 12:88872515-88872537 AGCCCTCTTGCCTCTAGGCAGGG - Intergenic
1100692267 12:97050799-97050821 GGCCCTCATGTATCCTGGCAAGG + Intergenic
1104931021 12:132339535-132339557 AGCCCTCACGTCGCAGGGCAGGG + Intergenic
1116361806 14:44008003-44008025 AGCTCTAATGTCTCTAAGAAAGG + Intergenic
1118794539 14:69129319-69129341 ACCCCTCATTCCTTTAGGCAAGG + Intronic
1122235277 14:100327693-100327715 GGCACTCATGGCTCCAGGCACGG + Intronic
1126812632 15:52423162-52423184 ATCCCTCATGTCTTCAGGGAAGG - Intronic
1127212504 15:56788305-56788327 GCCACTCATGTCTGTAGGCACGG + Intronic
1127723929 15:61728858-61728880 AACCCTCATGTATCCAGGAAAGG + Intergenic
1128258708 15:66216938-66216960 GGCCCTCTTGCCTCAAGGCAGGG + Intronic
1131217139 15:90547637-90547659 AGCCCTCATGTCTCTAGGCAGGG + Intronic
1131746112 15:95449466-95449488 AGCACTCCTGTCTCTTGGGATGG - Intergenic
1132659384 16:1054704-1054726 AGCCCTGGTGTCTCCAGGCTGGG + Intergenic
1134743985 16:16573173-16573195 AGCACACAGGTCTCTGGGCAAGG + Intergenic
1135001496 16:18780579-18780601 AGCACACAGGTCTCTGGGCAAGG - Intergenic
1135237025 16:20766715-20766737 ATCCATCCTGTCTTTAGGCAGGG + Intronic
1137709606 16:50557053-50557075 GGCCCTCATGTCTCTTGGAGTGG + Intronic
1138446371 16:57066695-57066717 ACCCCTAAGGTCTCTGGGCAGGG - Intronic
1140209859 16:72961342-72961364 AGACCTCATGTCCCTGGGGAGGG + Intronic
1144191450 17:12850478-12850500 AGCCCACATGTCCATGGGCAGGG + Intronic
1148436162 17:47687481-47687503 AGCCCACATGACTTTGGGCAAGG - Intergenic
1152901210 17:82942045-82942067 TGCCCCCATGTATCTAGACATGG - Intronic
1155303711 18:24457665-24457687 AGTCCTCATGTGTCGAGGGAGGG + Intergenic
1157469996 18:47981834-47981856 AGCTCTCATTTCCTTAGGCAGGG - Intergenic
1159733039 18:72055447-72055469 AGCCCATAGGTCTCAAGGCAGGG - Intergenic
1162715359 19:12627870-12627892 AGACCTCATGTGTCTAGTAAGGG - Exonic
1164454717 19:28397623-28397645 AGCGCTCTTGTCACAAGGCATGG - Intergenic
1166560834 19:43731446-43731468 ACACCTCATGTCTCTGGGCCGGG + Exonic
1167029371 19:46947254-46947276 AGCCCCCATGTGTCTGGGCGTGG + Intronic
1167431648 19:49458664-49458686 TGCCCTCAGGGCCCTAGGCAAGG - Intronic
1168051857 19:53835230-53835252 AGCCCTCATGTCTGCGTGCAGGG + Intergenic
1168241981 19:55093007-55093029 AGACCTCACCTCTCTGGGCAGGG + Exonic
926321717 2:11753073-11753095 CGCCCTCCTGTCCCTGGGCAAGG + Intronic
930637422 2:53821699-53821721 AGCCCTCCTGTCTCCAGGTGAGG + Intergenic
931216905 2:60253724-60253746 AGCCTTCTTGTCTCCAGGAAAGG - Intergenic
933117049 2:78487212-78487234 TGCCATCATGTTTTTAGGCAGGG + Intergenic
934900300 2:98154597-98154619 AGCCCTCTTGACACTGGGCAGGG + Intronic
942074933 2:172348982-172349004 AACCCTCATGTCAGTAAGCAGGG + Intergenic
942140223 2:172969766-172969788 AGCTCTCATGTCTCTTGAGAAGG - Intronic
942718136 2:178918117-178918139 AACCCTCATGAGGCTAGGCATGG + Intronic
1169858947 20:10132025-10132047 AGACCTCCTGTCTGCAGGCAAGG - Intergenic
1173891517 20:46515011-46515033 ATGTCTGATGTCTCTAGGCAAGG - Intergenic
1176213191 20:63935531-63935553 AGCTTTCATGTTTCAAGGCAGGG - Exonic
1180982371 22:19884896-19884918 GGCCCTGAGGTCTCTAGGCTGGG - Intronic
1181047193 22:20220714-20220736 AGCCAGCATGTGTCTAGCCAGGG - Intergenic
1181109239 22:20591669-20591691 AGCCCTCCCCTCTCCAGGCAGGG - Intergenic
950849033 3:16044257-16044279 AGCTCAAATGTCTCTGGGCATGG + Intergenic
954448560 3:50559538-50559560 AGCCCTCTTGTGTCTTGGCAGGG + Exonic
956368633 3:68533753-68533775 AGGCCACATGTCTCTCTGCATGG - Intronic
956373994 3:68594564-68594586 AGCCCTCAAGGCTCTGGCCAAGG + Intergenic
957522474 3:81337259-81337281 AACCCCCATGTCTCCAGGGAGGG + Intergenic
960954290 3:123020881-123020903 AGCCCTCTTCTCTCTGGACAGGG + Intronic
962305808 3:134284768-134284790 ACCCCTCATTTCTCTATGCTTGG + Intergenic
964769528 3:160209983-160210005 AGCCCTCATGTGCCTAGCCTGGG + Intergenic
965740641 3:171870580-171870602 ATCCCTCATGTCTATGGGAATGG - Intronic
969681413 4:8645414-8645436 AGCCCCCATGTCTTCAGCCATGG + Intergenic
971012847 4:22458203-22458225 AGGACTCATGTTCCTAGGCATGG + Intronic
974665911 4:64961314-64961336 AGTCCTCATATCACTAGGCTTGG - Intergenic
976106783 4:81627562-81627584 AGCTCACATTTCTGTAGGCAAGG - Intronic
985616173 5:923215-923237 AGCCCCCAGGTCCCCAGGCATGG + Intergenic
985835682 5:2270263-2270285 AGCCCGTATGTCTCCAGGCAGGG + Intergenic
985850999 5:2389126-2389148 AACCCTCATGTCTCTCTGGAGGG - Intergenic
985893497 5:2734717-2734739 TGCCTTCATGTCTCAAGCCAGGG - Intergenic
987059032 5:14224737-14224759 AACCCTAATGGATCTAGGCATGG + Intronic
988153367 5:27416299-27416321 AACAATCATGTCACTAGGCAAGG - Intergenic
989541483 5:42623697-42623719 AGCCCACATTTTTCTAGGCAGGG - Intronic
990910815 5:60850429-60850451 AGCCCTGATGGCTCTATGAAAGG + Intergenic
991003396 5:61805083-61805105 ACCCATCTTGTCCCTAGGCAGGG + Intergenic
991606031 5:68401906-68401928 AACCCCCATGTGTCCAGGCAGGG - Intergenic
994860517 5:105186762-105186784 TGCCTTCATTTCTTTAGGCATGG + Intergenic
996476033 5:123921776-123921798 ATCCCTCATTTCTTTAGGGATGG + Intergenic
998631310 5:143901593-143901615 AGCCACCATGTCTTTAGGCATGG + Intergenic
999430444 5:151521208-151521230 AGCCCGCCTGACTCTAAGCATGG - Intronic
1010562356 6:77366222-77366244 AGCCATCATGTCACATGGCAAGG - Intergenic
1013489999 6:110637002-110637024 AGCTCTGATATCACTAGGCAGGG + Intronic
1014436747 6:121428846-121428868 AGCCCTCATAGCTCTAAGAATGG - Intergenic
1016804868 6:148202474-148202496 AGCCCTCCTGTCTCCTAGCAGGG - Intergenic
1018278664 6:162161004-162161026 ATCCTTCCTGTCTATAGGCAAGG + Intronic
1022850529 7:34257054-34257076 GGCACTCATGCCTCAAGGCAGGG + Intergenic
1023560504 7:41468744-41468766 AGCCCTCATTCATATAGGCAAGG + Intergenic
1024019326 7:45351078-45351100 AGGCCTGCTGTCTCTAGCCAAGG - Intergenic
1025235887 7:57234688-57234710 TGCCCCCCTATCTCTAGGCAGGG - Intergenic
1029419935 7:100467217-100467239 AGCCCTCAAGGCACTGGGCAGGG - Intronic
1030878918 7:114851573-114851595 AGACCTAATGGCTCTAGGGATGG + Intergenic
1034190016 7:149206806-149206828 AACCCTCATGTCCCTGGGTAAGG + Exonic
1036084451 8:5598645-5598667 AGCCCTCCTGTCTCTTGCCTGGG - Intergenic
1041699561 8:60773256-60773278 AACCATCATTTCTCTGGGCAGGG - Intronic
1049412763 8:142480837-142480859 TGCCCCCATGTCTCTGGGCCAGG + Intronic
1052535932 9:29747478-29747500 AGCCCACATGAGTCTGGGCAGGG + Intergenic
1053533256 9:38902154-38902176 AGCCCCCATGGATCTATGCAGGG - Intergenic
1054205482 9:62126583-62126605 AGCCCCCATGGATCTATGCAGGG - Intergenic
1054632879 9:67461787-67461809 AGCCCCCATGGATCTATGCAGGG + Intergenic
1054896594 9:70320381-70320403 AGACCTCATCTCTTTAGGCAGGG + Intronic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1186374108 X:8980332-8980354 AGCCCTCATCTCTATAGGCAAGG - Intergenic
1186937843 X:14470643-14470665 ATCCCTCATGTTTCTAGGCAGGG - Intergenic
1190601647 X:52098919-52098941 AGCCCTCATGGCACAGGGCAGGG + Intergenic
1191012828 X:55778525-55778547 TGCCCTCATGTCTATAGCCTGGG + Intergenic
1191611145 X:63114807-63114829 AGCCTTCATCTCTCTATGCTTGG - Intergenic
1194186036 X:90775407-90775429 AGCCCTCATGTCTGCGTGCAGGG - Intergenic
1195537305 X:106023426-106023448 AGTCTTCATGTCTCTAGGAGAGG + Intergenic
1197084338 X:122454609-122454631 AGCCCTCATGCCACCAGTCAGGG + Intergenic
1197681117 X:129386470-129386492 AGGCTTAATGTCTTTAGGCAGGG - Intergenic
1201956505 Y:19629746-19629768 AGACTTCATGTCTAGAGGCAGGG - Intergenic