ID: 1131217235

View in Genome Browser
Species Human (GRCh38)
Location 15:90548331-90548353
Sequence GGGAACAATCTGATGGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131217235 Original CRISPR GGGAACAATCTGATGGTCAA GGG Intronic
905325019 1:37145846-37145868 GGAAACACTCGGATGGTCAATGG - Intergenic
906086173 1:43136588-43136610 TGAAAGAATCTGGTGGTCAAGGG - Intergenic
907087358 1:51688001-51688023 GGGTACATCCTGATTGTCAATGG + Intronic
909896992 1:81083728-81083750 GGGACCTATCTGAGGGTGAAGGG - Intergenic
914326506 1:146622406-146622428 GGCAAGAATGTGAAGGTCAATGG - Intergenic
915639124 1:157208373-157208395 GGGGACTATCTAATTGTCAATGG + Intergenic
917105864 1:171491275-171491297 GTGAACAATCTGAAGGTACAGGG + Intronic
919076680 1:192822296-192822318 TGGAACAATTTGATTGACAAGGG - Intergenic
922581952 1:226705189-226705211 GAGAACATTCTGATGGCCAGAGG + Intronic
924311135 1:242744273-242744295 GGGAAGAATCAGTGGGTCAATGG + Intergenic
1062869792 10:890247-890269 TGAAATAATCTGATGATCAAAGG + Intronic
1068734086 10:60392558-60392580 GTAAACATTCTCATGGTCAATGG - Intronic
1072538231 10:96379204-96379226 GGGAACAATCAGAGGGGGAAGGG - Intronic
1075314019 10:121437785-121437807 GGGAAGGATCTGATCCTCAAGGG + Intergenic
1075542894 10:123330292-123330314 AGGAAGAATTTGATGTTCAAAGG - Intergenic
1080766958 11:35305932-35305954 GGGAGCAATTTGAGGGTCACTGG - Intronic
1080916135 11:36662174-36662196 GGGAAAAATATTATGGTCCAAGG + Intergenic
1085294973 11:75426318-75426340 AGTAACAGCCTGATGGTCAAGGG - Intronic
1089710402 11:120310511-120310533 GGGAACAATTTGAAGTTCTAGGG + Intronic
1089804098 11:121067585-121067607 GCAAACAGTATGATGGTCAAAGG - Intronic
1094286547 12:28800772-28800794 TGGAAAAATGTGATGGACAAAGG + Intergenic
1095608720 12:44101899-44101921 GGGAAGATTGTGATGGTCAAAGG + Intronic
1099020640 12:77399967-77399989 GGGTACAATGTAATGGCCAATGG - Intergenic
1101198197 12:102407323-102407345 AGGAACAAACTGATAGACAAAGG + Intronic
1102608263 12:114087584-114087606 TGGATCAATCTGATGGTCTTTGG + Intergenic
1108776730 13:53774097-53774119 GAGAACAATGTGAGGGTCTAAGG + Intergenic
1111974845 13:94955060-94955082 GGAAACAAACTGATGATGAATGG + Intergenic
1111983243 13:95039028-95039050 AGGAACAATCTGATGCTACAAGG + Intronic
1113193597 13:107778906-107778928 GGGAAAAATCTGATAGTTTATGG - Intronic
1117900830 14:60531016-60531038 GGGAAAAATCTGTAGTTCAAAGG + Intergenic
1118444609 14:65839966-65839988 GGAAATCCTCTGATGGTCAAGGG - Intergenic
1120157362 14:81108528-81108550 GGGGAGAATCTTATGTTCAAGGG + Intronic
1120729317 14:87984201-87984223 GGGAACACTGGGATGGGCAAAGG + Intronic
1124406096 15:29393320-29393342 GGAAACACTGTGATGCTCAAGGG + Intronic
1125469662 15:39990603-39990625 GGGAACAATATTGTGGTCAAAGG + Intronic
1126247712 15:46528449-46528471 GTGCACAGTCTCATGGTCAATGG - Intergenic
1128109265 15:65066673-65066695 GATAACAATCTGATTTTCAAAGG + Intronic
1130202914 15:81850118-81850140 GGGGACAATCTGAGGGACAAGGG + Intergenic
1131217235 15:90548331-90548353 GGGAACAATCTGATGGTCAAGGG + Intronic
1131650974 15:94399427-94399449 GGGAATAAACTGAGGGTCAGAGG - Intronic
1139173936 16:64663932-64663954 GGGAAGAATCTGATGGCTTAGGG - Intergenic
1140007059 16:71088539-71088561 GGCAAGAATGTGAAGGTCAATGG + Intronic
1141314478 16:82948525-82948547 GGGAACAATCAAAAGATCAAAGG + Intronic
1142916119 17:3139944-3139966 AGGAACAATCTGGTGGTCCTGGG + Intergenic
1143931025 17:10425182-10425204 GGGAACAATCAGATGTCCATCGG + Intergenic
1153944508 18:10007305-10007327 GGGCACAGTATGATGGTCAGGGG + Intergenic
1155766323 18:29638072-29638094 AGGAAGAATCTGATGGCCAGGGG - Intergenic
1156072428 18:33228948-33228970 GGGAGAGCTCTGATGGTCAAAGG + Intronic
1159865984 18:73705738-73705760 TGGAATAATCTCAAGGTCAAAGG + Intergenic
1160603559 18:80032901-80032923 GGGAACAATCAGATGGGCTAGGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
925923369 2:8653082-8653104 GGGATGAATCTGATAGTTAATGG + Intergenic
939318755 2:140587584-140587606 GGGAATAAGATGTTGGTCAAAGG + Intronic
939820121 2:146947213-146947235 GGAAACATTCTCATTGTCAAAGG - Intergenic
941651765 2:168099972-168099994 TGGAACAATTTGAAAGTCAAAGG + Intronic
944263662 2:197701053-197701075 TGGAACAATCTGAAACTCAAGGG + Intronic
1169970834 20:11267932-11267954 GGCAACATTCTGGTGGCCAAAGG - Intergenic
1173109860 20:40176490-40176512 GGGAAGAATCAGATGGTCTAAGG + Intergenic
1173474488 20:43349380-43349402 TTGAACAATCAGATGGTCAGAGG + Intergenic
1173620508 20:44432178-44432200 GGGAACAATCTGTTGGAGCAGGG + Exonic
1176943334 21:14950439-14950461 GGCAATAATCTGGTGGGCAAAGG + Intergenic
1177021152 21:15859865-15859887 TGTAACAATTTGATAGTCAAAGG - Intronic
1179623784 21:42635917-42635939 GGGAACAAATAGATGGACAATGG - Intergenic
951788080 3:26445823-26445845 GGGAAAAATGTCAAGGTCAAAGG - Intergenic
953628372 3:44589706-44589728 GGATATAAACTGATGGTCAAAGG - Intronic
954045266 3:47924555-47924577 GGGCACATTTTGAAGGTCAAGGG - Intronic
956941670 3:74169137-74169159 TGGAACCATATGATGGACAAAGG - Intergenic
957455744 3:80442044-80442066 GGCAAGAATGTGAAGGTCAATGG - Intergenic
959184403 3:103027560-103027582 AGGAACAATCAGAAGGTCAGGGG + Intergenic
960291822 3:115895152-115895174 AAGAACAATCTGATAGTTAAAGG - Intronic
961248371 3:125477180-125477202 GGAAACAATCTGAGGGAAAAAGG - Intronic
961493061 3:127268819-127268841 GTGAACAATGTGATGTCCAAAGG + Intergenic
961696730 3:128710357-128710379 GGTAAGAATCTGTTGGGCAAAGG - Intergenic
962031090 3:131601041-131601063 GAGAACACTTTGATGGTGAAAGG + Intronic
963173546 3:142275617-142275639 GGGAACACACAGATGGTGAATGG - Intergenic
964796506 3:160503350-160503372 GGCACCAATATGATGCTCAAAGG + Intronic
965261110 3:166487298-166487320 GGTAATAATCAGATTGTCAAAGG + Intergenic
965683045 3:171271893-171271915 GGCAAGAATCTAATGCTCAAAGG - Intronic
974136505 4:57825190-57825212 GGGAACCCTCTCTTGGTCAAGGG - Intergenic
974735793 4:65930028-65930050 GGGAACAATCTGAAGATCAATGG - Intergenic
976887761 4:90007256-90007278 GAAAACAATCTGAGGGTCACAGG + Intergenic
977128782 4:93206178-93206200 GGGAACAATGTGATGTATAATGG + Intronic
979525373 4:121710504-121710526 GATAAAAATCTGAAGGTCAAAGG - Intergenic
980275818 4:130649067-130649089 CTGAACAATCTGTGGGTCAAAGG + Intergenic
986510647 5:8503044-8503066 GGGTAGAATCTGAAGGTGAAGGG - Intergenic
988048128 5:25986482-25986504 TGGAACAATCTCATGTTCATGGG - Intergenic
989707482 5:44354094-44354116 GGGAACATTTTGATATTCAAAGG - Intronic
994022018 5:95038092-95038114 TCGAACAATCTCATGGTCACAGG + Intronic
994087999 5:95781202-95781224 GGGAGCCATCTGGTGGCCAAAGG - Intronic
995140098 5:108726659-108726681 GAGAACCATCTGATGGTAACAGG - Intergenic
997582170 5:135024952-135024974 GGGAAGAAACTGAAGCTCAAAGG - Intergenic
1000521310 5:162298202-162298224 GGGCATTATCTGATGGACAAGGG - Intergenic
1000851215 5:166342078-166342100 GGGAACACTTTAATGGCCAAAGG - Intergenic
1005589203 6:27307610-27307632 GGGAATGAGCTGTTGGTCAAAGG - Intronic
1005678919 6:28185136-28185158 GGGAAAAATCAGCTGTTCAATGG - Intergenic
1006220134 6:32482736-32482758 TGGAACAATCAGAAGGTCAAGGG - Intergenic
1006224634 6:32526839-32526861 TGGAGCAATCAGAAGGTCAATGG - Intronic
1006229434 6:32570489-32570511 TGGAACAATCAGAAGGCCAAGGG - Intronic
1008039420 6:46780687-46780709 AGGAACAAACTGATAGTCAAAGG - Intergenic
1009486580 6:64231409-64231431 GGGATGAATCAGATTGTCAAGGG - Intronic
1010006477 6:71000399-71000421 GGGTACAATATAATGGTAAAGGG + Intergenic
1011994599 6:93569246-93569268 GGGAAGAAGCTGAAGGGCAATGG + Intergenic
1018752071 6:166815570-166815592 GGAAATAATCTGATGTGCAAAGG + Intronic
1018847868 6:167567571-167567593 GGGAACACTCTGGTGGCCAAGGG + Intergenic
1021111333 7:16697905-16697927 GGGCACAATATGATGATAAAAGG + Intronic
1021896849 7:25244600-25244622 GGGAGAACTCTGATGGTCAAGGG - Intergenic
1022277976 7:28875151-28875173 GGGTACAAACTTTTGGTCAAAGG - Intergenic
1023454059 7:40319494-40319516 TGGAAGACTCTGATGGTCACAGG + Intronic
1027715682 7:81666659-81666681 GGGAACTACCTGTAGGTCAATGG + Intergenic
1028854507 7:95575654-95575676 TGGAACATTCTGATTGTCTAAGG - Intergenic
1029874256 7:103732264-103732286 GGGAACAATCAGATTGCCCATGG + Intronic
1030696836 7:112594624-112594646 GGGAACAATGAGATGCTGAATGG - Intergenic
1031786089 7:126034757-126034779 GGAAACAATGTGTTTGTCAAAGG + Intergenic
1032955581 7:136968207-136968229 GGGAACAGAGAGATGGTCAAGGG - Intronic
1034296149 7:149973956-149973978 GGGAAGAGGTTGATGGTCAAAGG + Intergenic
1034809882 7:154122853-154122875 GGGAAGAGGGTGATGGTCAAAGG - Intronic
1037949689 8:23010776-23010798 GGGGACAAGCTGATGTCCAAGGG + Intronic
1046376480 8:113388440-113388462 GTGACAAATCAGATGGTCAAAGG - Intronic
1050584652 9:7097916-7097938 GGGAACATTCATATGGTTAATGG + Intergenic
1051535893 9:18157392-18157414 GGGAACAAACTTATGTTTAAAGG - Intergenic
1057351516 9:94302439-94302461 GGGAAGAATGTGATTCTCAAAGG - Intergenic
1060031361 9:120217667-120217689 AGGAACAAACTGAAGGTCAAGGG + Intergenic
1186121844 X:6371730-6371752 GAGAAAAATCTGCTGGTCATTGG - Intergenic
1189451539 X:41136656-41136678 GGGATCAAACTGATTATCAAAGG - Intronic
1189572468 X:42313034-42313056 GGGAACATGGTGATGGTTAATGG - Intergenic
1190095381 X:47475846-47475868 GGGATAATTCTGTTGGTCAAAGG - Intronic
1193286124 X:79717286-79717308 GGTAAAAATCTGATGGAAAAGGG - Intergenic
1194811957 X:98398324-98398346 GGGTACTAACTGATGGTAAAGGG - Intergenic
1196110969 X:111946757-111946779 GGCAAAAATCTCATGTTCAATGG - Intronic
1198004203 X:132475372-132475394 GGGAACCATCTAATGGCCCATGG - Intronic
1198243464 X:134807196-134807218 GGGACCCAACTGATTGTCAAAGG + Exonic
1201902237 Y:19055409-19055431 GGCAACAATCTGGTGTTCAGAGG + Intergenic