ID: 1131218889

View in Genome Browser
Species Human (GRCh38)
Location 15:90564344-90564366
Sequence GTTAACCCTATGACATCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131218888_1131218889 -7 Left 1131218888 15:90564328-90564350 CCTGATTTCTTTATTTGTTAACC 0: 1
1: 0
2: 4
3: 28
4: 454
Right 1131218889 15:90564344-90564366 GTTAACCCTATGACATCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 71
1131218886_1131218889 27 Left 1131218886 15:90564294-90564316 CCAGAGTATTTCTTGAAGAAAAA 0: 1
1: 0
2: 2
3: 60
4: 564
Right 1131218889 15:90564344-90564366 GTTAACCCTATGACATCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 71
1131218887_1131218889 -1 Left 1131218887 15:90564322-90564344 CCATTTCCTGATTTCTTTATTTG 0: 1
1: 0
2: 8
3: 131
4: 1481
Right 1131218889 15:90564344-90564366 GTTAACCCTATGACATCATTAGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131218889 Original CRISPR GTTAACCCTATGACATCATT AGG Intronic
908758174 1:67488104-67488126 ACAAAGCCTATGACATCATTTGG + Intergenic
909119797 1:71587691-71587713 GATATCCCTATAGCATCATTAGG + Intronic
915608708 1:156972831-156972853 GTTAACCCTCTGACTGCTTTGGG + Intronic
917264137 1:173201956-173201978 GTTAATCCTTTTGCATCATTTGG - Intronic
918775380 1:188623014-188623036 GTTTAAACTATGACACCATTTGG - Intergenic
921684520 1:218074827-218074849 GTGAACCATATTACCTCATTAGG - Intergenic
1064873854 10:19970634-19970656 GTTTACACAATGACATCAATAGG - Intronic
1064892901 10:20198589-20198611 TTTAACCCTAAGATATCCTTTGG + Intronic
1068619328 10:59162501-59162523 GTTTACCCTTTCAAATCATTTGG + Intergenic
1068628601 10:59276063-59276085 GCTAAACCTATGACATAACTTGG - Intronic
1075438825 10:122463451-122463473 GTTACCTCTGTGACCTCATTTGG + Intronic
1075951769 10:126484379-126484401 ATTAACTCTTTTACATCATTAGG - Intronic
1083974692 11:66108362-66108384 TTTAACCATATTACATCCTTAGG + Intronic
1092996773 12:13958439-13958461 TTTAAATCTATGACCTCATTTGG - Intronic
1096933660 12:55243465-55243487 TTTAACCCTATGCAGTCATTCGG - Intergenic
1102079044 12:110083256-110083278 GCTAACCCTCTGACATCACTAGG - Intergenic
1103463800 12:121125793-121125815 GCGAACCCTCTGACATCACTAGG + Intergenic
1106193337 13:27473128-27473150 GTTAACGCTATCTTATCATTGGG - Intergenic
1107630505 13:42337929-42337951 GTTAAGCAAATGACATCATATGG - Intergenic
1109333917 13:60968645-60968667 GTTAGCTTTATAACATCATTTGG + Intergenic
1109873461 13:68366794-68366816 CCTATCCCAATGACATCATTGGG - Intergenic
1110573406 13:77029935-77029957 TTTAATCCTATGAAATAATTGGG + Intergenic
1110714973 13:78691444-78691466 GTTAGCCTAATCACATCATTTGG - Intergenic
1113197160 13:107821742-107821764 ATTAATGGTATGACATCATTTGG - Intronic
1116349773 14:43846298-43846320 TTATACCCTATGACATCACTAGG - Intergenic
1131218889 15:90564344-90564366 GTTAACCCTATGACATCATTAGG + Intronic
1153714906 18:7838403-7838425 GGTACCTCTATGATATCATTTGG - Intronic
1158160987 18:54483289-54483311 GATACCCATATGACATCATTGGG - Intergenic
1159470818 18:68853749-68853771 GTTAACCCCAAGACTCCATTAGG + Intronic
928808322 2:35189691-35189713 TTTAACACTATCACATTATTAGG - Intergenic
935368364 2:102318630-102318652 GTTAACTGGATGACATCATGTGG + Intronic
936226309 2:110656625-110656647 GTTAACCCAATCACTTGATTAGG + Intronic
938441097 2:131333574-131333596 GTTAGCCACATGACCTCATTTGG - Intronic
942542794 2:177032076-177032098 GTTCTCCCTATGTCATCATGTGG + Intergenic
942617632 2:177810593-177810615 CTTCAGACTATGACATCATTGGG + Intronic
944352039 2:198740168-198740190 TCTAACTCTATGAAATCATTTGG - Intergenic
946502903 2:220268543-220268565 GCTCACCCTAAAACATCATTGGG + Intergenic
947892495 2:233637093-233637115 GAGAACCCTAAGAGATCATTGGG - Exonic
1170744850 20:19090320-19090342 GTTAACCCTATTAACTCACTTGG + Intergenic
951544147 3:23808434-23808456 GGTATCCCTATCCCATCATTTGG - Intronic
957236845 3:77604019-77604041 GTTAAACTTTTTACATCATTAGG + Intronic
965703904 3:171486671-171486693 TTTAAGCCAATGAAATCATTAGG + Intergenic
970838150 4:20435746-20435768 CTTACACCTATGACTTCATTTGG - Intronic
972115623 4:35629631-35629653 ATTAAACCTATGAATTCATTTGG - Intergenic
975470379 4:74759223-74759245 GTTAATCCTATGACAAAATAGGG + Intronic
977932401 4:102762580-102762602 GTTTCCCCTATAGCATCATTGGG - Intergenic
980412176 4:132435429-132435451 AATAACCCTATGATATGATTTGG - Intergenic
981946037 4:150345268-150345290 TTTAACCTTATTACATGATTCGG + Intronic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
992667253 5:79022539-79022561 CTTTACCCTATAAAATCATTAGG + Intronic
993952327 5:94192213-94192235 ATTAACCCTATGAAGTTATTAGG + Intronic
994438618 5:99771000-99771022 GTCAACACTATGTGATCATTAGG - Intergenic
994960583 5:106596487-106596509 GTTAACCCTAAGTTGTCATTAGG + Intergenic
1003440597 6:6137978-6138000 TTTAATCCTATCTCATCATTTGG + Intergenic
1007035533 6:38669542-38669564 CATAAACCTATGACATAATTTGG - Intergenic
1007523657 6:42472097-42472119 ATTAACTCTGTGACATCAGTTGG + Intergenic
1010011013 6:71048296-71048318 GTTAATACTATGAAGTCATTTGG + Intergenic
1018646814 6:165956787-165956809 TTCAACTCTATGACATGATTCGG - Intronic
1024142120 7:46472141-46472163 GTTCAGGCTATGACATCTTTTGG - Intergenic
1025641326 7:63373603-63373625 GTTAACCCAATGGCAATATTTGG - Intergenic
1026402613 7:70030471-70030493 GTTTCCCATATGACATCCTTGGG + Intronic
1027148080 7:75712391-75712413 GTTAACTTTTTCACATCATTTGG - Intronic
1032996553 7:137453295-137453317 GCCAGGCCTATGACATCATTTGG + Intronic
1044212668 8:89568179-89568201 TTCAACCCTATGATATCATGGGG - Intergenic
1045866969 8:106878424-106878446 TTTTACCCTTTGCCATCATTTGG + Intergenic
1048122937 8:131601825-131601847 AGAAACCCTATGACATCTTTAGG - Intergenic
1048512354 8:135074355-135074377 GTTCACCCTATGGCCTCCTTAGG - Intergenic
1051486210 9:17611267-17611289 GTTTACCCTATGAAATAACTTGG - Intronic
1056486986 9:87068844-87068866 GTTAACCGTTTGATTTCATTGGG + Intergenic
1057560530 9:96124853-96124875 GTTTACCCTATGGCTTCTTTGGG + Intergenic
1187766770 X:22651090-22651112 GTTAACCCTATGGAACTATTAGG - Intergenic
1187794551 X:22988140-22988162 TTTATCCCTATGAAAACATTTGG + Intergenic
1189467828 X:41290909-41290931 GTTTACCCATGGACATCATTTGG + Intergenic
1198513145 X:137374380-137374402 ATTAACCCTATGACGTGATATGG - Intergenic