ID: 1131220988

View in Genome Browser
Species Human (GRCh38)
Location 15:90583971-90583993
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131220984_1131220988 0 Left 1131220984 15:90583948-90583970 CCCCAAGGCAGTGTGAATTAATA 0: 1
1: 0
2: 3
3: 7
4: 144
Right 1131220988 15:90583971-90583993 GCAGCCCCTTTGTTGTGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 94
1131220986_1131220988 -2 Left 1131220986 15:90583950-90583972 CCAAGGCAGTGTGAATTAATAGC 0: 1
1: 0
2: 1
3: 22
4: 245
Right 1131220988 15:90583971-90583993 GCAGCCCCTTTGTTGTGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 94
1131220985_1131220988 -1 Left 1131220985 15:90583949-90583971 CCCAAGGCAGTGTGAATTAATAG 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1131220988 15:90583971-90583993 GCAGCCCCTTTGTTGTGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 94
1131220983_1131220988 8 Left 1131220983 15:90583940-90583962 CCATTTAACCCCAAGGCAGTGTG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1131220988 15:90583971-90583993 GCAGCCCCTTTGTTGTGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type