ID: 1131225133

View in Genome Browser
Species Human (GRCh38)
Location 15:90618331-90618353
Sequence CAGTAATTCTGGACAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131225133_1131225138 8 Left 1131225133 15:90618331-90618353 CCAGCTTCTGTCCAGAATTACTG 0: 1
1: 0
2: 3
3: 8
4: 174
Right 1131225138 15:90618362-90618384 GATAGCTCTTTTTAACTCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 137
1131225133_1131225137 7 Left 1131225133 15:90618331-90618353 CCAGCTTCTGTCCAGAATTACTG 0: 1
1: 0
2: 3
3: 8
4: 174
Right 1131225137 15:90618361-90618383 AGATAGCTCTTTTTAACTCAAGG 0: 1
1: 0
2: 0
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131225133 Original CRISPR CAGTAATTCTGGACAGAAGC TGG (reversed) Intronic
901549984 1:9989003-9989025 GAGAAATTCTGGGCAGAAGAGGG + Intergenic
902338193 1:15765822-15765844 CAGGAATTCAAGAGAGAAGCAGG - Intronic
904407566 1:30303070-30303092 CAGTAATTATGGAGAAGAGCTGG + Intergenic
904904680 1:33886294-33886316 GAGAAATTCTGGAGACAAGCAGG + Intronic
907499097 1:54865519-54865541 CAGGAGTGCTGAACAGAAGCCGG - Intronic
909236649 1:73161251-73161273 GAGTAATTCTGGACAGAATATGG - Intergenic
910015823 1:82521986-82522008 CAGTAATTCTGCTCTGAGGCTGG + Intergenic
910388648 1:86713369-86713391 CAGTACTTATGGCCAGGAGCAGG - Intronic
913454473 1:119016893-119016915 CAGTAATTTTGGAAAGAAGATGG + Intergenic
914917811 1:151829135-151829157 GAGAAATGCTGGACAGAGGCAGG - Intronic
916700649 1:167290751-167290773 AAGTAATTTTGGCCAGGAGCAGG + Intronic
918546042 1:185685128-185685150 CAGGACTACTGGCCAGAAGCAGG - Intergenic
918622418 1:186620769-186620791 CAGTAATTAATAACAGAAGCAGG - Intergenic
918903308 1:190454687-190454709 CAGATTTTGTGGACAGAAGCCGG - Exonic
920158200 1:203973356-203973378 CAGTTATTCTGGAAAACAGCTGG + Intergenic
920235625 1:204501922-204501944 CAGTAATTCTGATGAGAAGGAGG + Intergenic
923857153 1:237857601-237857623 CAGCATTTCTGGACAGAAAACGG + Intergenic
1064254209 10:13730248-13730270 AAGTAAGTCTGGACAAAATCTGG - Intronic
1066299987 10:34088073-34088095 CAGAAATTCTAGAAAGAGGCAGG - Intergenic
1067234290 10:44435379-44435401 AAGCAGATCTGGACAGAAGCTGG - Intergenic
1067808897 10:49411931-49411953 CAGGACTTCTGGACCTAAGCTGG + Intergenic
1068067288 10:52147855-52147877 CAGCAAGTCTGGATGGAAGCTGG + Intronic
1080520177 11:33061655-33061677 GCGTAATTCTGGACAGCAACAGG - Exonic
1084762365 11:71282170-71282192 AAGGAACACTGGACAGAAGCTGG + Intergenic
1086610967 11:88755015-88755037 CAGTAATTCTGTAGAGAAAGTGG - Intronic
1087087060 11:94230578-94230600 TATCATTTCTGGACAGAAGCAGG + Intergenic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1093401773 12:18754487-18754509 AAGAAATTCTGGGCAGAAGAGGG - Intergenic
1094530051 12:31265877-31265899 CAGCAACTCTGGACAAGAGCTGG + Intergenic
1099543801 12:83950720-83950742 GGGAAATTCTGGACAGAAGAGGG + Intergenic
1104512518 12:129393427-129393449 CTGTGATTCTGGAAAGAAACAGG - Intronic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1106593160 13:31115131-31115153 CAGTAACTTTGGTAAGAAGCTGG + Intergenic
1106600050 13:31179972-31179994 CAGCAATTATGGACAGAAAACGG - Intergenic
1109843177 13:67948247-67948269 CAGTAATTCAGGGAAGATGCAGG - Intergenic
1110774003 13:79384989-79385011 CAGTAATCTTGAAAAGAAGCTGG + Intronic
1112858361 13:103798738-103798760 AAGCAATTCTGTACAGAAGTTGG + Intergenic
1113097884 13:106685429-106685451 GAGGATTTCTGGACAGAATCAGG - Intergenic
1113694344 13:112333211-112333233 CACTCATTCTGGACAAATGCGGG - Intergenic
1116613906 14:47109362-47109384 CAGTTGGTCTGGACAAAAGCTGG - Intronic
1118039754 14:61903980-61904002 CAGTAATTCCTGAGAGAAGTTGG + Intergenic
1120978660 14:90272270-90272292 CAGGCAATCTGTACAGAAGCTGG + Exonic
1122831117 14:104396381-104396403 CAGCAATTCTGAAAAGCAGCGGG - Intergenic
1202878530 14_KI270722v1_random:34197-34219 GACTAATCCTGGACACAAGCTGG + Intergenic
1123479497 15:20617900-20617922 CAGTAATTCAGGGCAGAAATGGG - Intergenic
1123638510 15:22382464-22382486 CAGTAATTCAGGGCAGAAATGGG + Intergenic
1124024031 15:25948352-25948374 CAGTAATTATTGACAGAAATAGG - Intergenic
1126471375 15:49014588-49014610 CAGTCATTCAAGACAGAATCTGG + Intronic
1126533506 15:49735144-49735166 CAGTAAATTTAGACAGAAGGAGG - Intergenic
1126846032 15:52761236-52761258 AAGTAAGACTGGACAGAAGGAGG - Intronic
1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG + Intergenic
1129789965 15:78334482-78334504 CAGGAGTTCTGGGCAGAAGAGGG - Intergenic
1131178857 15:90226863-90226885 CAGTAATTCTGGATACACTCAGG - Intronic
1131225133 15:90618331-90618353 CAGTAATTCTGGACAGAAGCTGG - Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1136984809 16:35090900-35090922 TAGTAATTCTGGTCAGACACTGG - Intergenic
1137243609 16:46683195-46683217 TAGTAATTCTGGTCAGACACTGG + Intronic
1138301186 16:55931095-55931117 CAGTAATTAGTGACAGAATCAGG + Intronic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1143906767 17:10215496-10215518 CAGTAATTCTGGAGAGCAGCTGG - Intergenic
1144805640 17:17965102-17965124 CCCCAATTCTGCACAGAAGCGGG + Intronic
1144830204 17:18126918-18126940 CAGCAGTTCTGGCCAGATGCAGG - Intronic
1149615420 17:57993550-57993572 TAGTATTTGTGGACAGCAGCAGG - Intronic
1150816592 17:68396806-68396828 CAGATATTCTGGGGAGAAGCAGG - Intronic
1153403378 18:4706255-4706277 CAGTAAATCAGGCCAGAGGCTGG - Intergenic
1154100019 18:11464376-11464398 CAGTATTGCTGGACAGAAGCGGG + Intergenic
1154139639 18:11811430-11811452 CAGTATTCCTGGGCAGAGGCTGG - Intronic
1157737891 18:50066771-50066793 CAGTAATTCATCTCAGAAGCAGG - Intronic
1157810556 18:50692430-50692452 AAATAATGCTGGACAGTAGCAGG + Intronic
1158946724 18:62453485-62453507 CAGTATTTCGGGACAGACACAGG - Intergenic
1159813265 18:73042536-73042558 GAGAAAGTCTGGCCAGAAGCTGG + Intergenic
1162232908 19:9282465-9282487 CACCAATTCTGGACACAAGGTGG - Intergenic
1164582834 19:29445425-29445447 CAGGAACTCTGCACAGAACCTGG - Intergenic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1168171186 19:54590736-54590758 CTGTATTTGTGGACAGAATCTGG - Intronic
928328330 2:30337540-30337562 CAGTAATTCTGGAGGGCTGCCGG - Intergenic
929960803 2:46494852-46494874 CAGTCATTTTGGCCAGAAGATGG - Intronic
931010147 2:57902304-57902326 CCATAATTCTGGAAAGAAGAGGG - Intergenic
935704056 2:105840647-105840669 CAGTAATTCTGGCTATAAACTGG + Intronic
937342755 2:121101700-121101722 CAGTGATACTGAACAGATGCAGG - Intergenic
938959956 2:136331857-136331879 CAGTGAATCTGCACAGAAGGAGG - Intergenic
939728215 2:145750232-145750254 CAGTATGACTGGAAAGAAGCTGG - Intergenic
944252871 2:197594816-197594838 CATTAATTTTGGAAAGAGGCTGG - Intronic
945039871 2:205734650-205734672 CAGGAATGCAGGACAGAGGCTGG - Intronic
946600544 2:221355597-221355619 CTGTTATTCAGGAAAGAAGCTGG - Intergenic
947366810 2:229404591-229404613 CAGTCATTCTGGCCAGAAACTGG - Intronic
948032914 2:234834221-234834243 CAGTAATTTAGGAGAGAAGTGGG + Intergenic
1170224337 20:13974912-13974934 CATTAACTCTGGAAACAAGCAGG - Intronic
1170796108 20:19548170-19548192 CAGCAACTCAGGACAGATGCTGG - Intronic
1171969869 20:31557566-31557588 CAGTTATTCTGGAATCAAGCTGG - Intronic
1175404287 20:58716764-58716786 CAGCAATTGTGGGCAGCAGCCGG + Intronic
1177129245 21:17236461-17236483 CAGGATTTCTTGGCAGAAGCTGG - Intergenic
1177555064 21:22678698-22678720 CAGAAATTCTAGACAGAAAAGGG + Intergenic
1177785632 21:25668339-25668361 CAGAAAGGCAGGACAGAAGCAGG + Intronic
1178398300 21:32261810-32261832 CAGTACCTCTGGGCAGAAGAGGG + Intergenic
1179425233 21:41272815-41272837 CACTAATTATGCAAAGAAGCAGG - Intronic
1181905594 22:26192945-26192967 CAATAATTCTGGGCAGATGCGGG + Intronic
1184473546 22:44709022-44709044 CAGTGATTTGGGACGGAAGCTGG + Intronic
1185289780 22:50017500-50017522 CAGTAAGTCGGGGCAGAGGCTGG + Intronic
950231559 3:11280348-11280370 CACTAATTCTGCACAGTAGGTGG + Intronic
950332799 3:12169843-12169865 CAGGAGTCCTGGACAGCAGCTGG - Exonic
950978856 3:17280309-17280331 GGGAAATTCTGGACAGAAGAGGG + Intronic
953085585 3:39663463-39663485 CACCAATTCTGGATAGAAGTGGG - Intergenic
953735785 3:45493035-45493057 CAGTAATTCTGCAGCCAAGCAGG - Intronic
953828969 3:46278846-46278868 CAGTCATTCTTGGCTGAAGCTGG + Intergenic
953845671 3:46424268-46424290 CACCACTTCTGGCCAGAAGCTGG + Intergenic
959195544 3:103175935-103175957 CAGTATTTCTATACAGAACCTGG + Intergenic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
961650597 3:128414994-128415016 CAGCAACTCTGGGCAGAGGCTGG - Intergenic
964536048 3:157723128-157723150 AAGAAATTGTGGACTGAAGCTGG - Intergenic
965003402 3:162986789-162986811 CAGTAAATCTGGAAAGAAATTGG - Intergenic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967631370 3:191746077-191746099 CAGTAATTCTGTAGAGAAACTGG - Intergenic
968807588 4:2785802-2785824 CAGTATTTATGGACAGAAAAAGG - Intergenic
972023512 4:34345651-34345673 GAGTAATTCTCAACAGAAGAGGG - Intergenic
975391006 4:73817303-73817325 CACTATTTCTGGATAGAATCAGG + Intergenic
977297231 4:95224422-95224444 CAGGAATTCTGGTGGGAAGCAGG - Intronic
979707618 4:123739352-123739374 CAGTAATTCAGGATGGCAGCGGG + Intergenic
981643744 4:146974663-146974685 CAGTTAGACTGGACAGGAGCTGG - Intergenic
982798534 4:159673793-159673815 GAGAAATTCTGGGCAGAAGAGGG + Intergenic
983207935 4:164930742-164930764 CAGCAAGTCTGTACAGAAGTCGG - Intergenic
983895225 4:173074234-173074256 CAGGAATTATGAGCAGAAGCAGG + Intergenic
985224731 4:187747869-187747891 CAGTCATCCTGGACAAAAGTTGG + Intergenic
987046709 5:14115748-14115770 CAAGAATTCTGGACAGAAATAGG - Intergenic
987316565 5:16730008-16730030 CATTAATCCTGGAAAGAATCAGG - Intronic
987978795 5:25053028-25053050 CAGTATTTATGGACAGAAAAAGG - Intergenic
988008779 5:25455189-25455211 CAGTGCTTCTGGATAGAAGATGG - Intergenic
988821381 5:34889601-34889623 CAGGAATTATTGACAGAGGCTGG - Intronic
993586313 5:89734091-89734113 CAGTATTTCTGGAGAGTTGCTGG - Intergenic
995071291 5:107924661-107924683 CAGCAATTCTGGACTTAACCAGG + Intronic
995968626 5:117940333-117940355 CAGAAATTCTGAACTAAAGCAGG - Intergenic
996234835 5:121113596-121113618 CAATAAATCTGGAGAGAAGAAGG - Intergenic
996727601 5:126686463-126686485 CATTGATTCTGGAAAGAAACTGG + Intergenic
996767248 5:127046813-127046835 CAGTAATGATGGGCATAAGCAGG + Exonic
999652795 5:153784033-153784055 GAGTAATTCTGGACAAATTCAGG - Intronic
1003722435 6:8718678-8718700 CAGTATTTCTGGAGAAAAGAAGG - Intergenic
1004049980 6:12067683-12067705 CAGGAATTGGGGACACAAGCAGG - Intronic
1004307802 6:14516553-14516575 CAAGTATTCTGGACAAAAGCAGG - Intergenic
1004337846 6:14780945-14780967 CAGCCATTCTGGAAAGAATCTGG + Intergenic
1004407152 6:15343691-15343713 CAGTTATCTTTGACAGAAGCAGG + Intronic
1004418261 6:15445010-15445032 CAGAAATCCTGGACAGAAATAGG + Intronic
1005621258 6:27622672-27622694 CAGAAATTGTGGACATAGGCCGG + Intergenic
1007855234 6:44848729-44848751 CTGTAATTCTGGAAAGCAGGGGG + Intronic
1009023514 6:57970681-57970703 CAGAAATTCTATACAGAAGGAGG + Intergenic
1009199086 6:60722246-60722268 CAGAAATTCTATACAGAAGGAGG + Intergenic
1011003329 6:82615981-82616003 CAGTCAATCAGAACAGAAGCTGG + Intergenic
1012688286 6:102280446-102280468 CAATCATTATGGAAAGAAGCTGG - Intergenic
1016495936 6:144661730-144661752 CAGTAATTGTGGGCAATAGCTGG + Intronic
1016938174 6:149463896-149463918 CAGGAATTCTGGAAAGGAACAGG + Intronic
1019084024 6:169457330-169457352 CAGTACTTCTGCACAGAATTTGG - Exonic
1021658111 7:22891903-22891925 CATTAATTTTGGACAGAGGTGGG + Intergenic
1023071891 7:36443109-36443131 CAGTAGTGCTGGATAGAAACAGG - Intronic
1023836055 7:44067785-44067807 CACCAATCCTGGACAGATGCAGG + Intronic
1024496463 7:50052919-50052941 CAGTAATTCTGGATGGAGGTAGG + Intronic
1030386258 7:108871219-108871241 GGGAAATTCTGGACAGAAGAAGG - Intergenic
1030938031 7:115610699-115610721 CAGTAATAGTAGACATAAGCTGG + Intergenic
1031462612 7:122070060-122070082 GAGTAATTCTGGAGAGAGGGAGG + Intergenic
1033881365 7:145887484-145887506 CAGAAATTCTGGGTAGAAGAGGG - Intergenic
1034444354 7:151105336-151105358 CAGTAATTCTAACCAGAGGCAGG + Intronic
1034456074 7:151171157-151171179 CACCAATTCTGAACAGAGGCAGG + Intronic
1035454893 7:159001740-159001762 CAGTTGTTCAGGACAGCAGCAGG - Intergenic
1037017143 8:13922945-13922967 CAAAAAGTCTGGAAAGAAGCTGG - Intergenic
1038318545 8:26508330-26508352 CAGTAATTCTGGTGAGATGCAGG + Exonic
1039821396 8:41138472-41138494 CAGTGATACAGGAGAGAAGCTGG - Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1042796524 8:72669181-72669203 CAGTAATTCTGGAAAGGAGCTGG - Intronic
1043706304 8:83355729-83355751 CAGTAATTCAGTTCAGAAACAGG - Intergenic
1044361056 8:91284287-91284309 CAGCAACTCTGGTTAGAAGCAGG + Intronic
1047720244 8:127632288-127632310 CAGACATTCTAGAGAGAAGCAGG - Intergenic
1050330372 9:4539928-4539950 GAGAAATTCTGGGCAGAAGAGGG + Intronic
1054451409 9:65405303-65405325 CAGTAACTCTGCCCAGAAACTGG - Intergenic
1057006890 9:91568588-91568610 GGGAAATTCTGGACAGAAGATGG - Intronic
1057043398 9:91864281-91864303 CAGTGATTCTGGCCAGAACAAGG + Intronic
1060109081 9:120893963-120893985 CAGTAGTTCTGGAGTGAGGCTGG - Intronic
1060883003 9:127131743-127131765 CAATAGTTCTGGACATAAACAGG - Intronic
1061222837 9:129262245-129262267 CATTGATTCTGGACAGGACCAGG - Intergenic
1186033270 X:5392617-5392639 GAGAAATTCTGGGCAGAAGAGGG - Intergenic
1188553204 X:31383499-31383521 GGGAAATTCTGGACAGAAGAGGG + Intronic
1188871524 X:35379277-35379299 AAGAAATTCTGGACATAAGCTGG - Intergenic
1189539393 X:41970700-41970722 CAGTAATGAAGGACAGGAGCTGG + Intergenic
1195522582 X:105848818-105848840 CAATATTTTTGGACAGAATCTGG + Intronic
1196284280 X:113862000-113862022 CAGGACTTTGGGACAGAAGCAGG - Intergenic
1198000611 X:132431570-132431592 GGCTAATTCTGGACAGAAGCAGG - Intronic
1198305041 X:135373015-135373037 CAGTATTTATGGACAGAAAATGG + Intergenic
1199336995 X:146630161-146630183 GAGAAATTCTGGGCAGAAGAGGG + Intergenic