ID: 1131225322

View in Genome Browser
Species Human (GRCh38)
Location 15:90620117-90620139
Sequence CCCCGAGCTGTGGCAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7023
Summary {0: 1, 1: 0, 2: 6, 3: 302, 4: 6714}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131225322 Original CRISPR CCCCGAGCTGTGGCAGGCTG TGG Intronic
Too many off-targets to display for this crispr