ID: 1131227216

View in Genome Browser
Species Human (GRCh38)
Location 15:90634791-90634813
Sequence GCTAAAACTGTAACCAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 7, 2: 8, 3: 13, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131227212_1131227216 13 Left 1131227212 15:90634755-90634777 CCACTCTCTGACTGAGTATTGGT 0: 1
1: 0
2: 4
3: 7
4: 134
Right 1131227216 15:90634791-90634813 GCTAAAACTGTAACCAAAGGAGG 0: 1
1: 7
2: 8
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131227216 Original CRISPR GCTAAAACTGTAACCAAAGG AGG Intronic
901677625 1:10895825-10895847 GCCGAAACTGTAACCAAACGAGG + Intergenic
905606442 1:39304514-39304536 GCTGAAACTGTAACCAAAGGAGG - Intronic
908084149 1:60612331-60612353 GATAAAACTGAAACCAGTGGAGG + Intergenic
909639232 1:77853418-77853440 GCAGAAACTACAACCAAAGGAGG + Intronic
910917568 1:92306926-92306948 GCTAAAACTGAAAGGAAATGAGG + Intronic
912305132 1:108559833-108559855 GCAAAAACTGAAAAGAAAGGCGG + Intergenic
915453693 1:156024759-156024781 GCTAAACCTGTCACCACAGCTGG + Intergenic
916505733 1:165426662-165426684 TCTAAAACTGTATTCAAAGGAGG + Intronic
916691392 1:167193331-167193353 CCTAAAACAGTAACAAAAAGAGG + Intergenic
917208694 1:172607598-172607620 GCTAAAACTGAAAGAAAAGTGGG - Intronic
917475294 1:175364217-175364239 TTCAAAACTGAAACCAAAGGTGG - Intronic
917883603 1:179363051-179363073 ACTAAGACTGGAAACAAAGGAGG - Intergenic
918446841 1:184625161-184625183 GCTAAAAATGGAAGCAAAGAAGG - Exonic
920150611 1:203903931-203903953 GCTGAAACTGTAACCAAAGGAGG - Intergenic
923307218 1:232699192-232699214 GTTAAAATTATGACCAAAGGAGG + Intergenic
1063369303 10:5510790-5510812 GTTAACACTGTAACAAAAGTGGG - Intergenic
1069939492 10:71944750-71944772 TCAAAAACTGTGACCACAGGGGG - Intergenic
1070250507 10:74768944-74768966 GCTCAAACTGTGATCAAATGAGG - Intergenic
1074566306 10:114581445-114581467 CCTAAAACTCTACCCAATGGTGG + Intronic
1078058572 11:8029102-8029124 ACTATATCTGTGACCAAAGGTGG + Intronic
1080403406 11:31957503-31957525 GTTAAAACTCTATCCTAAGGCGG + Intronic
1081472816 11:43392558-43392580 GAAAAAACTGTATACAAAGGTGG - Intronic
1088468175 11:110164451-110164473 GCCAAAACTGCAAACGAAGGAGG + Exonic
1088633834 11:111800032-111800054 GCTAGAACTTTAAAGAAAGGAGG - Intronic
1089407338 11:118209153-118209175 GCTGAGACTGTAACCAAAGGAGG - Intronic
1099100180 12:78429590-78429612 TCTAAAACTGGAACCAAATCTGG - Intergenic
1099194548 12:79600069-79600091 GCTAAAACCAAAACCAAAGTGGG - Intronic
1101149717 12:101873535-101873557 GCTGAAACTGTAACCAAAGGAGG - Intergenic
1103291583 12:119850582-119850604 GCAAAAATTGTGACCAAAGTAGG - Intronic
1104141853 12:125994971-125994993 GCTATCACTGAAACCAAATGGGG + Intergenic
1104233833 12:126912083-126912105 ACCAAAACTGTAACCGAAGGAGG + Intergenic
1104637073 12:130444588-130444610 GCTAAAAAGGCAACAAAAGGTGG + Intronic
1106430635 13:29677117-29677139 GGTAAAACTGCAAGCAAAGCAGG - Intergenic
1107537855 13:41353185-41353207 GCTAAAACTGCAACCAGAGGTGG - Intronic
1107768166 13:43759915-43759937 GCTACAACTGTAAGCAAGAGTGG + Intronic
1111294726 13:86263884-86263906 GCTAAAATCATAACCAGAGGGGG - Intergenic
1112865463 13:103891175-103891197 GCTGAAAATTTAACCAAACGAGG - Intergenic
1114865540 14:26590273-26590295 GCTAAAGCAGTATCCAAAGATGG + Intronic
1115108926 14:29797562-29797584 CCTAAAACTTTTATCAAAGGGGG + Intronic
1117954977 14:61115804-61115826 TTTAAAACTGTGACCATAGGGGG + Intergenic
1118193377 14:63601572-63601594 GTTGAAACTGTAACCAAAGGAGG + Intronic
1122488567 14:102097656-102097678 GTTAAAACTGAAACTAGAGGAGG + Intronic
1131227216 15:90634791-90634813 GCTAAAACTGTAACCAAAGGAGG + Intronic
1131447029 15:92508011-92508033 CCTATAACTGCAATCAAAGGTGG + Intergenic
1135101591 16:19610972-19610994 GGAAAAAATGTAACCAATGGAGG + Intronic
1135124021 16:19791855-19791877 GCTAAAATCATAACCAGAGGGGG + Intronic
1135861795 16:26063018-26063040 GTTGAAACTGTAACCAAAGAAGG - Intronic
1139697649 16:68686445-68686467 GCTGAAACTGTAACCAAAGGAGG + Intronic
1140394134 16:74612813-74612835 GCTGAAACTGTAACCAGAGGAGG - Intergenic
1149094390 17:52823521-52823543 GCTAAAACTTTTAATAAAGGTGG + Intergenic
1153284960 18:3449046-3449068 GCGAAAACTAGAACCAGAGGAGG + Intronic
1154196836 18:12273101-12273123 GCTACAACTGGAACCACAGGTGG + Intronic
1157129651 18:44994842-44994864 GATAAAACTGCAAAGAAAGGAGG + Intronic
929584369 2:43104647-43104669 GCTGAATCTATCACCAAAGGTGG + Intergenic
930319082 2:49831748-49831770 GCTTTAACTGTAAACAAATGTGG + Intergenic
932543022 2:72676760-72676782 GCAATAACTCTAACCAAAGAGGG + Intronic
933054993 2:77650730-77650752 ACTAAAACTTTAACCTATGGTGG - Intergenic
935947712 2:108301289-108301311 GCTAAAGCTCTCCCCAAAGGAGG + Intronic
936693228 2:114917468-114917490 TCTAAAACTGAAACCAAAAAAGG + Intronic
940248915 2:151652017-151652039 TATAAAACTGAAAACAAAGGAGG + Intronic
940373972 2:152935857-152935879 GCTAAAACTATAATTACAGGAGG - Intergenic
941875585 2:170429485-170429507 CCTAAAACTGTCCCCACAGGTGG + Intronic
944242746 2:197501137-197501159 GCTGAAACTGTAACCAAAGGAGG + Exonic
946043313 2:216800958-216800980 GCTAAAAATATAACGAAAGAAGG - Intergenic
947524101 2:230868142-230868164 GCAAAAACTGCAACACAAGGAGG + Intronic
947986867 2:234455695-234455717 ACCACAACTGTAACCAAAGGAGG - Intergenic
1169531962 20:6494932-6494954 GCTCAAACTGTATCCAAATAAGG + Intergenic
1170326128 20:15156422-15156444 GCTAAAAAGAAAACCAAAGGGGG - Intronic
1173087110 20:39933141-39933163 GTCAAAACTGTAACCAAAGGAGG - Intergenic
1176100546 20:63362424-63362446 GCTCAACCTGGAACCAGAGGTGG - Intronic
1181492850 22:23271446-23271468 GCTGAAATTGTTGCCAAAGGGGG + Intronic
1181828241 22:25537464-25537486 ATTAAAACTATACCCAAAGGAGG + Intergenic
1182599602 22:31450621-31450643 TCTAACACTGTGACCAAAAGGGG + Intronic
956521791 3:70112389-70112411 GCTAAAATAGTCACTAAAGGAGG + Intergenic
958197584 3:90261617-90261639 GCCAAAACCGTAACCAAAGAAGG - Intergenic
958421032 3:93931721-93931743 GCCAAAACCGTAACCAAAGAAGG - Intronic
958582719 3:96046841-96046863 GCTAAAATTATAAACAAAGATGG - Intergenic
961514200 3:127422774-127422796 GCTGAAACTGAGACCCAAGGGGG + Intergenic
974261782 4:59534454-59534476 GCTAAACGAGCAACCAAAGGAGG - Intergenic
975484368 4:74917887-74917909 GCTGAAACTGTAGCCAAAGGAGG + Intergenic
977303599 4:95296748-95296770 TTTCAAACTGTAATCAAAGGAGG - Intronic
977441463 4:97073230-97073252 GTTAGAACTGTAAGCAAAAGTGG + Intergenic
978080653 4:104586953-104586975 GCTAAAACTGTAAACTCAAGAGG - Intergenic
979397940 4:120211284-120211306 GCTAAAATCTTAACGAAAGGAGG + Intergenic
980212685 4:129810277-129810299 GCTGGAACTGAAACCCAAGGAGG + Intergenic
981862207 4:149370189-149370211 GCTAAAAATGTTACAACAGGTGG - Intergenic
984502070 4:180568979-180569001 CCTAAAACCCTAACAAAAGGCGG + Intergenic
986997438 5:13623314-13623336 GCAAAAACTATCACTAAAGGTGG + Intergenic
987301791 5:16603969-16603991 CCTAAAACGGAAAACAAAGGTGG + Intronic
987425184 5:17765196-17765218 GCTAAAACTGTAGGGAAAGTGGG - Intergenic
992334857 5:75756177-75756199 GCTAAATCAGTCAGCAAAGGTGG + Intergenic
994404939 5:99333678-99333700 GCTGAGAGTGTAACCAAATGAGG + Intergenic
995520611 5:113000878-113000900 TCTAATACTGTATCCACAGGTGG - Intronic
995753155 5:115474631-115474653 GCTACTGCTGTAACCAGAGGTGG + Intergenic
996733487 5:126737945-126737967 GCCGAAACTGTAACCAAAGGAGG - Intergenic
998124874 5:139610972-139610994 GCCAAAACTATAACCAAAGGAGG + Intronic
1002556152 5:180042628-180042650 TCTAATACTGTATCCAAACGGGG + Intronic
1006573331 6:35023586-35023608 GCTGAAACTGTAACCAAAGGAGG + Intronic
1007197872 6:40078465-40078487 GACAAAAATGTAATCAAAGGAGG + Intergenic
1007411261 6:41663222-41663244 CCTAAAACTCTAGCCAAAGGGGG + Intergenic
1007624448 6:43235952-43235974 ACTAAAAATGTAACCAAGGCTGG + Intergenic
1012809370 6:103938196-103938218 ACTAAAACAGTAGCCAAAGGTGG + Intergenic
1013105764 6:107025605-107025627 GCTTTAACTGTAACATAAGGTGG + Intergenic
1014577865 6:123095557-123095579 GCTGAAACTGTAATCAAATCAGG + Intergenic
1015462652 6:133510605-133510627 GTCCAAACTGTAACCAAAGGAGG - Intronic
1021493244 7:21244004-21244026 GGTGAAACTGTAACTTAAGGAGG + Intergenic
1025938308 7:66054703-66054725 GCCAGTACTGTAACCATAGGAGG + Intergenic
1027722902 7:81767968-81767990 TCTAAAATTGTCATCAAAGGAGG - Intronic
1030791170 7:113730808-113730830 GCTAAAACTGTAACCCAGGCTGG - Intergenic
1033876764 7:145829764-145829786 GATAAAACTTTCAACAAAGGAGG + Intergenic
1034107860 7:148506254-148506276 GCAAAAACTGTATCCAAATAAGG + Intergenic
1035816339 8:2545166-2545188 GTTATCACTGGAACCAAAGGTGG + Intergenic
1041769619 8:61458687-61458709 ACTAAAACTGAAAACAAATGGGG + Intronic
1042280363 8:67049691-67049713 GCTGAAACTGTAACCAAAGGAGG - Intronic
1044154069 8:88821290-88821312 ACTAAGACAGTAAACAAAGGAGG + Intergenic
1045250282 8:100477256-100477278 GTTAAAACTGTAAAGAAAGCAGG + Intergenic
1045463932 8:102451829-102451851 ACCGAAGCTGTAACCAAAGGGGG + Intergenic
1045842421 8:106595596-106595618 GCTAGAACTGTAACTCATGGGGG + Intronic
1046702053 8:117412425-117412447 GCTGAAACTGAAACAAAATGGGG + Intergenic
1047484915 8:125320471-125320493 GGGAAAACAGCAACCAAAGGGGG + Intronic
1051440995 9:17082637-17082659 GCTAACACTGTTCCCCAAGGTGG - Intergenic
1053535386 9:38920398-38920420 GCTAAATCTTTAACTTAAGGGGG + Intergenic
1054207607 9:62144802-62144824 GCTAAATCTTTAACTTAAGGGGG + Intergenic
1054630744 9:67443552-67443574 GCTAAATCTTTAACTTAAGGGGG - Intergenic
1054970984 9:71086519-71086541 GCTGAAAATCTAACCAAAAGAGG + Intronic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1058070920 9:100599714-100599736 GCTGAACCCGCAACCAAAGGAGG - Intergenic
1058921773 9:109623178-109623200 GCTAAAACTGTAACTCTGGGGGG + Intergenic
1059052787 9:110945340-110945362 GGGAAAAATGTAATCAAAGGAGG + Intronic
1060560272 9:124536955-124536977 GCTAAAACTGGAATAAAAGCCGG + Intronic
1188154535 X:26724366-26724388 GCTAAAACTGACAGCAAAGGAGG - Intergenic
1188523872 X:31069557-31069579 CCTAAAACTGAACCAAAAGGAGG + Intergenic
1193531267 X:82657539-82657561 GCCAAAACTGTGATCAATGGAGG - Intergenic
1194366640 X:93021319-93021341 GCTACACATGGAACCAAAGGGGG + Intergenic
1195549486 X:106150821-106150843 TTTAAAACTGAAACCAAAGCAGG - Intergenic
1200248365 X:154538570-154538592 GCTAAAACTCTTAGCAGAGGGGG + Intronic
1200674865 Y:6137579-6137601 GCTACACATGGAACCAAAGGGGG + Intergenic