ID: 1131228204

View in Genome Browser
Species Human (GRCh38)
Location 15:90642478-90642500
Sequence CACACTACACAATGCTACGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228204_1131228211 19 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228211 15:90642520-90642542 GTCCGCACCGAAGGCGGGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 49
1131228204_1131228213 24 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1131228204_1131228216 28 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228216 15:90642529-90642551 GAAGGCGGGCCCGGAGTGGGAGG 0: 1
1: 1
2: 2
3: 39
4: 325
1131228204_1131228207 10 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228207 15:90642511-90642533 CTGATCTCCGTCCGCACCGAAGG 0: 1
1: 0
2: 0
3: 0
4: 21
1131228204_1131228214 25 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228214 15:90642526-90642548 ACCGAAGGCGGGCCCGGAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1131228204_1131228209 14 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228209 15:90642515-90642537 TCTCCGTCCGCACCGAAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1131228204_1131228208 13 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228208 15:90642514-90642536 ATCTCCGTCCGCACCGAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228204 Original CRISPR CACACTACACAATGCTACGG AGG (reversed) Exonic
1066319391 10:34286381-34286403 CAGACTGCACAGTGCTAAGGGGG + Intronic
1071782267 10:88859757-88859779 CACATTACACAATGATGCTGAGG - Intergenic
1072617635 10:97060089-97060111 CACCCTACAGAAAGCTACGGAGG - Exonic
1089757642 11:120698057-120698079 CACACCACACAAAGCCAGGGGGG - Intronic
1096334048 12:50739654-50739676 CACACTCCACAATCCAACGCAGG - Intronic
1099903713 12:88745882-88745904 CATTCTACACAATGCAACCGAGG - Intergenic
1101368351 12:104099227-104099249 CTCACTATACAATACTAAGGGGG + Intronic
1102662927 12:114545396-114545418 CACACTACCCCATGGTATGGTGG + Intergenic
1102665124 12:114565260-114565282 CACACTACCCCATGTTACAGTGG - Intergenic
1109210738 13:59532866-59532888 CAGCCTTCACAATGTTACGGTGG - Intergenic
1129694676 15:77733979-77734001 CACACGACACAGTGCTCAGGAGG + Intronic
1131228204 15:90642478-90642500 CACACTACACAATGCTACGGAGG - Exonic
1132749180 16:1449477-1449499 CACAGTACACCCTGCTGCGGAGG + Intronic
1150473915 17:65460073-65460095 CTTATTACACAATGCTAGGGTGG - Intergenic
1152606150 17:81291575-81291597 CACGATACCCAATGCTACCGGGG + Intronic
1152716160 17:81901867-81901889 CACACTGCACAGTGCCCCGGGGG - Intronic
1153324377 18:3803194-3803216 GCCACTCCACAATGCTAGGGGGG - Intronic
1158024031 18:52874795-52874817 CACACTACACAGGGCCACAGGGG + Intronic
933303916 2:80573886-80573908 CACACTACACCACACTACTGTGG + Intronic
936507534 2:113119426-113119448 ACCACTACACTATGCTATGGGGG + Intronic
937385586 2:121429018-121429040 CACACTACACAATACAACCTAGG + Intronic
1170260864 20:14406574-14406596 CTAACCACACAATGCTAAGGGGG - Intronic
1174707236 20:52669394-52669416 CACCCTACACAATTCTTCTGGGG - Intergenic
1180948288 22:19708691-19708713 CACAGCACACATTGCTGCGGGGG - Intergenic
1182567000 22:31207606-31207628 CACACTACACCCTGCTACTAAGG - Intergenic
962429754 3:135308187-135308209 CATACCACACAATGGCACGGTGG + Intergenic
967030254 3:185599501-185599523 CACTATACAAAATGCTATGGTGG + Intronic
969934832 4:10669842-10669864 CACTCTACACACTGCCACAGTGG - Intronic
982904258 4:161048444-161048466 TACACTACACAATGCCCCAGTGG + Intergenic
985033650 4:185817537-185817559 CACAGGACACAATGCTAAGTGGG - Intronic
986746991 5:10753649-10753671 CAAACTAGAAAATGCTACTGCGG + Intronic
990281057 5:54251224-54251246 CACACTGCAAAATTCTAAGGTGG + Intronic
994073941 5:95630347-95630369 CACACTATACAATACCAAGGGGG + Intergenic
999141761 5:149367184-149367206 CAAAGTGCACAATGCTATGGGGG - Intronic
999166126 5:149551038-149551060 TACACTAGGCAAGGCTACGGAGG + Intronic
1004673579 6:17820326-17820348 CTCACCACACACAGCTACGGTGG + Intronic
1013146560 6:107400079-107400101 CACAATACACATTCCTACTGGGG + Intronic
1013262406 6:108458593-108458615 CACACACCACCATGCTGCGGGGG + Intronic
1029282526 7:99445296-99445318 CAGACTACACAAAACTACTGAGG + Intronic
1035824942 8:2634547-2634569 CACACTACACTATGCAAGTGTGG + Intergenic
1041584998 8:59506199-59506221 CACACTACACAATGTGGTGGAGG + Intergenic
1041631485 8:60093623-60093645 CACACTACATAATGCGACTGAGG + Intergenic
1042450665 8:68941648-68941670 CAGCCTACACAATGCTTCTGAGG - Intergenic
1043810994 8:84740721-84740743 CACACTACACAATTCAACTGTGG - Intronic
1056623044 9:88230743-88230765 CAGACTACAAAATGTTACTGAGG - Intergenic
1057092690 9:92273845-92273867 CATGCTACACCATGCTACAGAGG + Intronic
1189910503 X:45806096-45806118 TACACTACAGAATGCTGGGGAGG - Intergenic
1195399791 X:104448948-104448970 CACAGTCCACTATGCTGCGGTGG + Intergenic
1201628495 Y:16041965-16041987 CACACTAAAGAATGATATGGGGG - Intergenic