ID: 1131228205

View in Genome Browser
Species Human (GRCh38)
Location 15:90642481-90642503
Sequence GAGCACACTACACAATGCTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228205_1131228211 16 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228211 15:90642520-90642542 GTCCGCACCGAAGGCGGGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 49
1131228205_1131228209 11 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228209 15:90642515-90642537 TCTCCGTCCGCACCGAAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1131228205_1131228207 7 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228207 15:90642511-90642533 CTGATCTCCGTCCGCACCGAAGG 0: 1
1: 0
2: 0
3: 0
4: 21
1131228205_1131228214 22 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228214 15:90642526-90642548 ACCGAAGGCGGGCCCGGAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1131228205_1131228213 21 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1131228205_1131228216 25 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228216 15:90642529-90642551 GAAGGCGGGCCCGGAGTGGGAGG 0: 1
1: 1
2: 2
3: 39
4: 325
1131228205_1131228217 30 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228217 15:90642534-90642556 CGGGCCCGGAGTGGGAGGCTCGG 0: 1
1: 0
2: 1
3: 25
4: 288
1131228205_1131228208 10 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228208 15:90642514-90642536 ATCTCCGTCCGCACCGAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228205 Original CRISPR GAGCACACTACACAATGCTA CGG (reversed) Exonic
903191801 1:21660751-21660773 GAGCACAAGGCACCATGCTAAGG - Intronic
905164415 1:36069571-36069593 GTGAACACTACACCATGATAAGG - Exonic
909473750 1:76058775-76058797 GAGCACAGTATACACTGCTTGGG + Intergenic
910113672 1:83709236-83709258 GAGCACACTAGCCAATGTTAGGG - Intergenic
911011259 1:93283244-93283266 GAGGAAACTACACAAGGCAAGGG + Intergenic
914349683 1:146830260-146830282 AGTCACACTGCACAATGCTAGGG + Intergenic
919694374 1:200558996-200559018 GAGAAGACTAAACAAAGCTAAGG + Intronic
1065429644 10:25640360-25640382 GAGAACACTACAAAGAGCTAAGG + Intergenic
1069072060 10:63999023-63999045 GATCTCACTACAAAATGCTTTGG + Intergenic
1079435797 11:20447930-20447952 GAAAACACTAAAAAATGCTATGG + Intronic
1081083377 11:38770038-38770060 GAGCAGAATACACCAAGCTAAGG + Intergenic
1085680142 11:78565657-78565679 GAGGAAACTATCCAATGCTAGGG + Intronic
1087223718 11:95574634-95574656 GAGGGCCCTACACAGTGCTAAGG + Intergenic
1087929932 11:103965612-103965634 GAGCACAGTACTCAAGGCAAGGG + Intronic
1090171450 11:124609731-124609753 GTGCACCGTACACAATACTAAGG + Intergenic
1090603726 11:128399568-128399590 GAGCACACTCCACATGGCTAGGG - Intergenic
1091850391 12:3692585-3692607 CACCACACTACAAAATGCTTTGG - Intronic
1098888369 12:75983132-75983154 GGGCACACTACAAAAGGCTGTGG + Intergenic
1101368348 12:104099224-104099246 GAACTCACTATACAATACTAAGG + Intronic
1102831866 12:116009869-116009891 GAGCCCACTACATGATGCCAAGG + Intronic
1105545351 13:21347093-21347115 GGGCACACCACAAAATGCTGGGG - Intergenic
1105889408 13:24671545-24671567 GAGCACATTCTACAATGCTCGGG - Intergenic
1105979099 13:25500472-25500494 GAGCACTCCACACAATATTATGG - Intronic
1110122856 13:71904557-71904579 GAGCAAACTTCACAATGGTCTGG + Intergenic
1112866459 13:103907020-103907042 AAGCACAATACAAAATGTTAAGG + Intergenic
1115319365 14:32062698-32062720 GAGAAGCCTACAAAATGCTATGG + Intergenic
1118877796 14:69799034-69799056 TTGGGCACTACACAATGCTAGGG + Intergenic
1119834940 14:77740718-77740740 GATCACAGTAAACAGTGCTATGG - Intronic
1124630340 15:31332989-31333011 GAACACACTTCACAGTGCCATGG - Intronic
1125179790 15:36869709-36869731 GAGAAAATTACACAATGATATGG + Intergenic
1125355633 15:38814792-38814814 GAGCACATTTCACATTGCTGTGG + Intergenic
1131228205 15:90642481-90642503 GAGCACACTACACAATGCTACGG - Exonic
1134216335 16:12319703-12319725 GAGCACACTACAGAGAGCTATGG - Intronic
1134275742 16:12774593-12774615 AAGCTCACCACACATTGCTATGG + Intronic
1139984352 16:70885286-70885308 AGTCACACTGCACAATGCTAGGG - Intronic
1142721837 17:1781396-1781418 GAGCACAATACAGAAAGCTGAGG - Exonic
1143740365 17:8948433-8948455 GAGGTCACTACACAATGTGAAGG + Intronic
1153856096 18:9148854-9148876 GAACAGACTACACAATGACAAGG + Intronic
1153900311 18:9613005-9613027 AACCACATTAGACAATGCTAAGG + Intronic
1155256213 18:24000199-24000221 GGGCACACTCCAAAGTGCTAGGG - Intronic
1156998205 18:43494544-43494566 GATCACACTCAAAAATGCTAAGG + Intergenic
1157459659 18:47878162-47878184 GAGCTCACCACACAATGGTGTGG + Intronic
1158299447 18:56035174-56035196 GAGCATATTACACAATGCCCTGG + Intergenic
1158816696 18:61106670-61106692 AAGGACACTTCAAAATGCTAAGG + Intergenic
1164549897 19:29201183-29201205 GAGCATTCTATAGAATGCTATGG + Intergenic
925402661 2:3586689-3586711 GACCACAGAACTCAATGCTAAGG - Intergenic
929495948 2:42443996-42444018 GATAACACTGCACAAAGCTATGG + Exonic
929920411 2:46167558-46167580 GAGCACAGTTCAGAATGCTGAGG + Intronic
931086480 2:58836742-58836764 GAGGAAACTACACAAGGGTATGG - Intergenic
932961689 2:76419788-76419810 CAGCAATCCACACAATGCTATGG + Intergenic
933561439 2:83890913-83890935 GAGGACATTACACAAAGATATGG + Intergenic
934987130 2:98895620-98895642 CAGAACATTACACCATGCTAAGG + Intronic
942516234 2:176756398-176756420 GAGCATGCAACACAATGCCAAGG + Intergenic
943445625 2:187983781-187983803 AAGAAAACTACAAAATGCTATGG - Intergenic
945339354 2:208633167-208633189 GGGCACACTACATGATGCTCAGG + Intronic
945866493 2:215182252-215182274 GAGCACAGTATGCAAGGCTAAGG - Intergenic
1170260867 20:14406577-14406599 TAGCTAACCACACAATGCTAAGG - Intronic
1175405555 20:58723648-58723670 GAGGACACTACCCCAAGCTAGGG + Intergenic
1177208272 21:18036314-18036336 GAGGAAACTACACAAAGCCAAGG - Intronic
1181552020 22:23645269-23645291 GAGTACATTGCAAAATGCTAAGG + Intergenic
949402857 3:3683883-3683905 GAGTACCCTACACAATACTTGGG + Intergenic
951547358 3:23840693-23840715 GAGGACACTACGCAATGCCAGGG - Intronic
952097388 3:29969548-29969570 GCTTACACTACACCATGCTAGGG + Intronic
952323157 3:32296700-32296722 GGGCACATTACACAACCCTAAGG - Intronic
952557299 3:34547366-34547388 GAGCAAGCCACACAAGGCTATGG + Intergenic
954773212 3:52992717-52992739 TAGCACACTCCACAATGTAAAGG + Intronic
960297558 3:115962427-115962449 GAGCACTCTTCACTATGCCACGG - Intronic
965957028 3:174383028-174383050 AAGCACAGTAAACAATGGTAAGG + Intergenic
967669030 3:192210346-192210368 GAGGAAACTACCCAAGGCTATGG + Intronic
970534257 4:17012976-17012998 GAGGCCACTTCACAATGCAAAGG + Intergenic
979932456 4:126647969-126647991 GAGGAAACTACTCAAGGCTATGG - Intergenic
981166757 4:141567979-141568001 GAGCACACCGCACCATGTTAGGG - Intergenic
981629138 4:146798039-146798061 CAGCAGATTACACAATGCAAAGG - Intronic
986653412 5:9987663-9987685 GAGGATAGTAAACAATGCTATGG - Intergenic
990594948 5:57303294-57303316 GTGCACACTGCAGGATGCTACGG + Intergenic
991178320 5:63717412-63717434 AAGCACACTGCAAAATGATATGG - Intergenic
998338661 5:141396789-141396811 TAGAACACTACACAATCCTTAGG - Intronic
999948330 5:156621542-156621564 GAGCAAAGTATAAAATGCTATGG + Intronic
1003406272 6:5829394-5829416 GGGCACACCACAAAATGCTGGGG + Intergenic
1004383019 6:15148784-15148806 GAGCGCACGACACAAGGCTGAGG - Intergenic
1006591092 6:35158264-35158286 GAGAAAACTACCCAAGGCTAGGG - Intergenic
1009655092 6:66533711-66533733 AAGTAAACTAAACAATGCTAGGG + Intergenic
1022342834 7:29485341-29485363 CAGCACATTAAACCATGCTAAGG + Intronic
1032125622 7:129190339-129190361 GAGTATACTCCACACTGCTAAGG - Intronic
1035015358 7:155761086-155761108 GAACACACTACACAAAGGAAAGG - Intronic
1038103514 8:24407640-24407662 GAGTACACTGCACACTGCTCAGG - Intergenic
1041318288 8:56586972-56586994 GAGCACAAGACTCAATGCTAAGG + Intergenic
1044164530 8:88965988-88966010 GAGAACAATACAATATGCTATGG + Intergenic
1047014318 8:120707043-120707065 TGGCAGACTAGACAATGCTATGG + Intronic
1047427653 8:124761120-124761142 GAGCTCATCACACAAGGCTAAGG - Intergenic
1047696737 8:127411087-127411109 GGGCACACTACCCAATTCCAAGG + Intergenic
1048242410 8:132756091-132756113 AGGCACATTTCACAATGCTAGGG + Intronic
1059688874 9:116664379-116664401 GAGCACTCTAAACAGTGCTCTGG - Intronic
1186381153 X:9060788-9060810 GAGCACAATTCACAATGTTAAGG - Intronic
1187691549 X:21873581-21873603 GAGCACGAGACAGAATGCTAAGG + Intronic
1188913087 X:35874609-35874631 AAGCACACTCCTCAATTCTATGG - Intergenic
1189154143 X:38738849-38738871 AAGCACAGTACAAAATTCTATGG + Intergenic
1193859398 X:86645613-86645635 CAGCACTGTTCACAATGCTAGGG + Intronic
1193960185 X:87915105-87915127 CACCACACTACAAAATGCTTTGG + Intergenic
1194283773 X:91984901-91984923 GAGCACAAGGCACAAGGCTAAGG - Intronic
1196051939 X:111314858-111314880 GAACACACTTCAAAATGTTAAGG + Intronic
1197001465 X:121444388-121444410 AAACATACTAGACAATGCTAGGG - Intergenic
1202070361 Y:20985724-20985746 GCCCACACTACAAAATCCTAGGG - Intergenic