ID: 1131228206

View in Genome Browser
Species Human (GRCh38)
Location 15:90642508-90642530
Sequence TCGGTGCGGACGGAGATCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228206_1131228213 -6 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1131228206_1131228220 8 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228220 15:90642539-90642561 CCGGAGTGGGAGGCTCGGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 203
1131228206_1131228224 16 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228224 15:90642547-90642569 GGAGGCTCGGCCTGGGGCGGCGG 0: 1
1: 0
2: 8
3: 101
4: 1160
1131228206_1131228221 9 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228221 15:90642540-90642562 CGGAGTGGGAGGCTCGGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1131228206_1131228216 -2 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228216 15:90642529-90642551 GAAGGCGGGCCCGGAGTGGGAGG 0: 1
1: 1
2: 2
3: 39
4: 325
1131228206_1131228223 13 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228223 15:90642544-90642566 GTGGGAGGCTCGGCCTGGGGCGG 0: 1
1: 1
2: 4
3: 56
4: 533
1131228206_1131228228 28 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228228 15:90642559-90642581 TGGGGCGGCGGCACCGGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 323
1131228206_1131228214 -5 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228214 15:90642526-90642548 ACCGAAGGCGGGCCCGGAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1131228206_1131228227 27 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228227 15:90642558-90642580 CTGGGGCGGCGGCACCGGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 291
1131228206_1131228222 10 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228222 15:90642541-90642563 GGAGTGGGAGGCTCGGCCTGGGG 0: 1
1: 0
2: 6
3: 37
4: 383
1131228206_1131228217 3 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228217 15:90642534-90642556 CGGGCCCGGAGTGGGAGGCTCGG 0: 1
1: 0
2: 1
3: 25
4: 288
1131228206_1131228225 22 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228225 15:90642553-90642575 TCGGCCTGGGGCGGCGGCACCGG 0: 1
1: 0
2: 2
3: 21
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228206 Original CRISPR TCGGTGCGGACGGAGATCAG TGG (reversed) Exonic
903142020 1:21344782-21344804 TCGGTGCTGTCAGAGACCAGGGG - Intronic
915307390 1:154988462-154988484 ACGTTTCGGACGGAGACCAGAGG - Exonic
1063130431 10:3172948-3172970 GCGGTGCGGACGGAGATGGGCGG + Intergenic
1072166087 10:92814472-92814494 TGGGAGTGGAAGGAGATCAGAGG - Intergenic
1088821037 11:113457690-113457712 GCTGTGCGGACAGAGCTCAGGGG - Intronic
1098268331 12:68746133-68746155 TGGCTGCGGGCGGAGATGAGCGG + Exonic
1125957575 15:43800806-43800828 TCGGGGCGGGCTGAGAGCAGAGG + Intronic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1139534614 16:67563363-67563385 TCGGCGGAGACGGAGACCAGCGG - Intronic
1141167398 16:81669599-81669621 TTGGTGCGGAAGGAGGTGAGAGG - Intronic
1148105725 17:45117931-45117953 TGAGTGCGGACGGAGGTCATTGG + Intronic
1157258157 18:46156677-46156699 TCAGTGAGGATGGAGAACAGAGG + Intergenic
1175737008 20:61394196-61394218 TCGGTGGGGACTGAGGTCAAAGG - Intronic
1181548562 22:23620982-23621004 TCTGTGAGGATGGAGTTCAGCGG - Intronic
963091079 3:141484678-141484700 TCAGTGTGGCTGGAGATCAGAGG + Intergenic
968647807 4:1749011-1749033 GCGGTGGGGAGGGAGAGCAGTGG - Intergenic
986369859 5:7069091-7069113 TCGGTGAGGCAGGAGAACAGTGG - Intergenic
999595104 5:153194485-153194507 TTGGTATGGAGGGAGATCAGAGG - Intergenic
1002284729 5:178154545-178154567 GCGGTGCAGACGCAGGTCAGTGG - Intergenic
1007373963 6:41443815-41443837 TGGGAGCAGACAGAGATCAGGGG + Intergenic
1011023204 6:82836913-82836935 TCAGAGCTGACGGAGATGAGTGG - Intergenic
1012475795 6:99613803-99613825 TCCGGGGGGACGGAGAGCAGAGG - Exonic
1023747419 7:43334113-43334135 TTGGTGAGGACAGAGATCTGTGG + Intronic
1024613277 7:51085198-51085220 TCAGTGCGGTTGGGGATCAGGGG + Exonic
1049528318 8:143140865-143140887 CCGGTGTGGACGGAGAACAAAGG + Intergenic
1049651524 8:143771951-143771973 GCGGTGCTGAAGGAGGTCAGCGG + Intergenic
1059642800 9:116234231-116234253 TCGCTGCAGGCTGAGATCAGTGG + Intronic
1185891847 X:3828812-3828834 TCAGTGTGGAAGAAGATCAGAGG - Intronic
1185896954 X:3867226-3867248 TCAGTGTGGAAGAAGATCAGAGG - Intergenic
1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG + Intergenic
1197628141 X:128826569-128826591 ACAGTGCGGATGGAGAACAGGGG - Intergenic