ID: 1131228213

View in Genome Browser
Species Human (GRCh38)
Location 15:90642525-90642547
Sequence CACCGAAGGCGGGCCCGGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228204_1131228213 24 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1131228206_1131228213 -6 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1131228205_1131228213 21 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228213 Original CRISPR CACCGAAGGCGGGCCCGGAG TGG Exonic
900088658 1:909941-909963 GACCGAGGGTGGGCCCGGCGCGG + Intergenic
900278218 1:1847131-1847153 CACTGAAGGCAGGCAGGGAGAGG + Intronic
903907459 1:26696670-26696692 CAGCGGCGGCGGGCCCGGCGCGG + Exonic
905789664 1:40783528-40783550 CCCCGAAGGCCAGCCCGGGGTGG - Intergenic
920399498 1:205668316-205668338 CAGGGAAGGCGGCCCTGGAGCGG - Intronic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1074903415 10:117839303-117839325 CACCGATGGGGAGCCAGGAGGGG - Intergenic
1076434825 10:130433141-130433163 CAGAGCAGGCGGGCCAGGAGAGG + Intergenic
1077524771 11:3057448-3057470 CCCGGAAGACGGGCCCGGCGTGG - Intronic
1078566367 11:12417985-12418007 CACCTAAGGCTGGCTTGGAGTGG + Intronic
1084674852 11:70628369-70628391 CACCAAAGTCGGGGGCGGAGAGG + Intronic
1091820543 12:3472415-3472437 CACTGAAGGCAGGACAGGAGTGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1104788119 12:131464214-131464236 CACTGAAGGCAGGCAGGGAGAGG + Intergenic
1104842235 12:131830631-131830653 CGCCGGAGGCGCTCCCGGAGTGG + Intronic
1117315431 14:54567204-54567226 CACCCCAGGCGGGCCGTGAGGGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1141665395 16:85462964-85462986 GGCAGAAGACGGGCCCGGAGGGG - Intergenic
1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG + Intronic
1144092775 17:11872628-11872650 CAGCGAAGGTGGGCCGGGCGCGG + Intronic
1144519632 17:15945196-15945218 TACCGAAGGCGCGCCGGGCGAGG - Exonic
1148542628 17:48492618-48492640 GGACGAAGGCGCGCCCGGAGAGG + Intergenic
1151274878 17:73026820-73026842 AACTGAAGGCGGGCCAGGTGTGG + Intronic
1151572844 17:74935885-74935907 CACCGACTGCGGGCGCTGAGCGG - Exonic
1152027689 17:77822431-77822453 CACCAAATGCGGGCCTCGAGAGG + Intergenic
1152081631 17:78191073-78191095 CACCCAATGCGGCCACGGAGAGG - Intronic
1158648808 18:59269114-59269136 CCCCGAAGCCGGGCCCGCACGGG + Exonic
1158652293 18:59299009-59299031 CTCCGGAGGCTGGCGCGGAGTGG - Intronic
1160288025 18:77564685-77564707 CACAGAGGGCTGGCCTGGAGAGG - Intergenic
1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1167926075 19:52821753-52821775 CGCAGAGGGCGGGGCCGGAGCGG + Intronic
1167930259 19:52857739-52857761 CGCAGAGGGCGGGGCCGGAGCGG + Intergenic
1168536423 19:57174101-57174123 CACCTGAGGTGGGCCCGGCGTGG - Intergenic
941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG + Intronic
942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG + Intergenic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
1168757601 20:327248-327270 CAGAGAAGGCGGGCCGGGCGAGG - Exonic
1173161335 20:40654690-40654712 CATTGAAGGCAGGCCCGTAGTGG - Intergenic
1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG + Intergenic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1177546245 21:22562151-22562173 CACCAAAGGCGAGCCAGGTGCGG - Intergenic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG + Exonic
1185039498 22:48497176-48497198 CACCGCAGGCGGGGGCGGAACGG - Intronic
1185325830 22:50225441-50225463 CACAGCTGGCGGGCCCGGGGAGG + Intronic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG + Exonic
978503528 4:109433797-109433819 AAGGGAAGGCGGGGCCGGAGAGG - Exonic
992381693 5:76243789-76243811 CACCCAAGGAGGGCCCGGCCAGG - Intronic
1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG + Intronic
1017810676 6:157981660-157981682 CCCCGCAGGCGGGCGTGGAGCGG - Intergenic
1019305948 7:335833-335855 CACAGAAGTGGGGCCAGGAGGGG - Intergenic
1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG + Intergenic
1030347864 7:108454979-108455001 CACCGAGGGAGGGCGCCGAGCGG - Intronic
1037455287 8:19057441-19057463 CACAGAAGGCGTGACCAGAGTGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG + Exonic
1040335592 8:46414383-46414405 CACCGAAGGCTGTCCCGGGCGGG + Intergenic
1049212256 8:141392172-141392194 CCCCGAAGCCGTGCCCGGAGCGG - Intronic
1049746949 8:144267042-144267064 GGAAGAAGGCGGGCCCGGAGTGG - Exonic
1057322816 9:94030443-94030465 CACAGGAAGCGCGCCCGGAGAGG + Intergenic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG + Intergenic
1190337195 X:49269821-49269843 CACCGGCGGCGGGACCGGCGGGG - Intronic
1194383607 X:93225036-93225058 CACCGCAGGCGGAGGCGGAGGGG + Intergenic