ID: 1131228214

View in Genome Browser
Species Human (GRCh38)
Location 15:90642526-90642548
Sequence ACCGAAGGCGGGCCCGGAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228205_1131228214 22 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228214 15:90642526-90642548 ACCGAAGGCGGGCCCGGAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1131228204_1131228214 25 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228214 15:90642526-90642548 ACCGAAGGCGGGCCCGGAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1131228206_1131228214 -5 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228214 15:90642526-90642548 ACCGAAGGCGGGCCCGGAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228214 Original CRISPR ACCGAAGGCGGGCCCGGAGT GGG Exonic
900088659 1:909942-909964 ACCGAGGGTGGGCCCGGCGCGGG + Intergenic
904753177 1:32753906-32753928 GCCGGGGGCGGGCCCGGAGGAGG - Intronic
905789662 1:40783527-40783549 CCCGAAGGCCAGCCCGGGGTGGG - Intergenic
906624514 1:47314105-47314127 CCCAGAGGCGGGGCCGGAGTCGG - Exonic
1072656760 10:97335004-97335026 CCAGGAGGCGGGCCCGGAGTGGG - Intergenic
1076184689 10:128437203-128437225 ACCCAAGGGAGGCCGGGAGTTGG + Intergenic
1076881248 10:133240217-133240239 AGCGAAGGCCGGCCTGGGGTAGG - Exonic
1077524769 11:3057447-3057469 CCGGAAGACGGGCCCGGCGTGGG - Intronic
1078566368 11:12417986-12418008 ACCTAAGGCTGGCTTGGAGTGGG + Intronic
1083370053 11:62171296-62171318 ACCAAAGGCTGGCCTGTAGTAGG + Intergenic
1091820544 12:3472416-3472438 ACTGAAGGCAGGACAGGAGTGGG + Intronic
1104602098 12:130161437-130161459 CCCGCAGGAGGACCCGGAGTAGG - Intergenic
1111997457 13:95178815-95178837 ACAGTAGCCGGGACCGGAGTGGG + Intronic
1113897046 13:113771205-113771227 TCCGCAGGCAGGCCCAGAGTAGG - Intronic
1117196100 14:53341536-53341558 ACTGAAGGCAGGCACCGAGTAGG + Intergenic
1124624257 15:31299115-31299137 ACTGGAGGAGGGCCCGGAATAGG + Intergenic
1131228214 15:90642526-90642548 ACCGAAGGCGGGCCCGGAGTGGG + Exonic
1141665394 16:85462963-85462985 GCAGAAGACGGGCCCGGAGGGGG - Intergenic
1144519631 17:15945195-15945217 ACCGAAGGCGCGCCGGGCGAGGG - Exonic
1146942717 17:36855041-36855063 ACCCATGGCGGGCCTGGAGGTGG + Intergenic
1147256261 17:39184203-39184225 ACAGAAGGCGGGCCTGGAACTGG - Intronic
1157086687 18:44587385-44587407 TCCAAAGGCTGGCCTGGAGTAGG + Intergenic
1158652292 18:59299008-59299030 TCCGGAGGCTGGCGCGGAGTGGG - Intronic
1159106048 18:64002790-64002812 ACCGAGGGCGGACCCGCGGTCGG - Intronic
1163248282 19:16110808-16110830 GCCGAGGGCGGGCCCTGAGGAGG + Intergenic
1163433466 19:17281994-17282016 GCCGGGGGCGGGCCAGGAGTGGG + Intronic
1164906897 19:31975136-31975158 ACCAAGGGAAGGCCCGGAGTGGG - Intergenic
1165243076 19:34482362-34482384 ACCGAAGGCGGCCCGGGACCGGG - Exonic
1165866867 19:38945049-38945071 CCAGAAGGCGGACCCGGAGCTGG + Exonic
1165958300 19:39515528-39515550 GCCGGAGTCGGGACCGGAGTTGG - Exonic
1167348586 19:48961870-48961892 GCAGACGGCGGGCCCGGCGTGGG - Intergenic
1167987803 19:53333606-53333628 GCAGAAGGCGGGGCCGGGGTGGG - Intergenic
927714175 2:25341779-25341801 CCGGAAGGCCGGCCCGGAGGCGG - Intronic
947748225 2:232520239-232520261 ACAGAAGGGGGGCTCGGAGCTGG + Intergenic
948824812 2:240568963-240568985 ACAGCAGGCGGGCTCGGAGCCGG - Exonic
1174352632 20:49979417-49979439 AGCGAGGGCGGGCCTGGAGGGGG + Intergenic
1175562664 20:59944445-59944467 ACGGAAGCCGTGCCCCGAGTGGG + Exonic
1178865078 21:36320357-36320379 AGCGAAGGGGGGCCGGCAGTGGG + Intronic
1180233554 21:46442724-46442746 AGGGAAGGCGCGCCCGGCGTAGG + Intronic
1180960594 22:19760712-19760734 ACCGCAGGCCGGCCCCGAGGAGG - Intronic
1182792416 22:32964017-32964039 ACAGAAGGCAGGCCCTGAGGTGG + Intronic
952908845 3:38165450-38165472 GCCGGAGGCGGGCCCGAGGTGGG + Intronic
960635586 3:119781523-119781545 ACAGAAGGCTGACCAGGAGTGGG - Intronic
965319408 3:167233243-167233265 GCCTAAGGAGGGCCCAGAGTTGG - Intergenic
968484735 4:853699-853721 ACCGAATGCTGGCGCGGAGGAGG - Intronic
980969752 4:139557015-139557037 CCCGAAGGAGGGCGGGGAGTGGG - Intronic
985541290 5:488843-488865 ACCCAGGACGGGCCCGGAGCCGG + Intronic
989043048 5:37249057-37249079 AGCGAGGACGGGCCCGGACTGGG + Intronic
998188365 5:140000542-140000564 ACCGAAGGCGGGCAGGCAGGCGG + Intronic
999269784 5:150290006-150290028 ACCCAAGGAGGGCCTGGAGGAGG + Intronic
1001944930 5:175770904-175770926 ACCAAAGGGGGGCCCGGAAGAGG - Intergenic
1002926763 6:1609675-1609697 ACCGACGGCGGGCCGGGCGCCGG + Intergenic
1023993839 7:45146646-45146668 AACGAAGGCAGGCCGGGAGCAGG + Intergenic
1024993716 7:55255171-55255193 GCCGAAGGTGGGCCTGGAGGCGG - Intronic
1034525091 7:151654274-151654296 ACAGAAGGCGGGCCAGGGGATGG - Intronic
1048227609 8:132603850-132603872 GCCAAAGGCGGGGGCGGAGTGGG + Intronic
1049212254 8:141392171-141392193 CCCGAAGCCGTGCCCGGAGCGGG - Intronic
1057881548 9:98796344-98796366 GCCGGAGGCGGGCGCGGAGCCGG - Exonic
1185787679 X:2904540-2904562 ACCGAAGGAGGTCAGGGAGTTGG - Exonic
1190233110 X:48597596-48597618 ACCGGAGGCAGCCCCGGAGGTGG + Exonic
1195655031 X:107324969-107324991 ACCATAGGCGGGCCCGGAGAAGG - Intergenic