ID: 1131228216

View in Genome Browser
Species Human (GRCh38)
Location 15:90642529-90642551
Sequence GAAGGCGGGCCCGGAGTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 325}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228206_1131228216 -2 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228216 15:90642529-90642551 GAAGGCGGGCCCGGAGTGGGAGG 0: 1
1: 1
2: 2
3: 39
4: 325
1131228205_1131228216 25 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228216 15:90642529-90642551 GAAGGCGGGCCCGGAGTGGGAGG 0: 1
1: 1
2: 2
3: 39
4: 325
1131228204_1131228216 28 Left 1131228204 15:90642478-90642500 CCTCCGTAGCATTGTGTAGTGTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1131228216 15:90642529-90642551 GAAGGCGGGCCCGGAGTGGGAGG 0: 1
1: 1
2: 2
3: 39
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228216 Original CRISPR GAAGGCGGGCCCGGAGTGGG AGG Exonic
900088661 1:909945-909967 GAGGGTGGGCCCGGCGCGGGTGG + Intergenic
900595618 1:3478920-3478942 GGAGGTGGGGCCGGAGTGTGGGG + Intronic
900597563 1:3489464-3489486 GAAGAAGGGCCCAGAGTGGAAGG - Intergenic
900645251 1:3706110-3706132 GGAGGCGGGCCGGGGGCGGGGGG - Intronic
901530988 1:9852359-9852381 GAAGGCGAGCTGGCAGTGGGAGG - Intronic
901836190 1:11925719-11925741 GGAGGCGGGCCCGGGGCCGGCGG + Exonic
902261317 1:15226884-15226906 GCAGGCTGGCCAGGAGAGGGAGG + Intergenic
902973834 1:20074598-20074620 GGAGGTGGGCACTGAGTGGGTGG - Intronic
903164194 1:21509436-21509458 GATAGCGGGCGCGGAGTGGCGGG - Exonic
903189484 1:21648869-21648891 GAAGCCAGGCCTGGGGTGGGAGG - Intronic
903651758 1:24926924-24926946 GAAGGCGGGACGGGGGTGGGGGG - Intronic
903704980 1:25279029-25279051 GAAGGAGGGGCAAGAGTGGGAGG + Intronic
904528799 1:31155004-31155026 GAGGGCGGGGCCGGAGTCGAGGG + Intergenic
904751122 1:32741931-32741953 GCAGGCGGGGGCGGAGCGGGCGG - Exonic
905189664 1:36224088-36224110 GCAAGCTGGCCCGGAGTGGGTGG + Intergenic
905647289 1:39633313-39633335 GAGGGAAGGCCCGGAGTGGGAGG - Intronic
905749661 1:40451027-40451049 AAAGGCGGCCACGGAGCGGGTGG + Exonic
905789728 1:40783740-40783762 GAAGGCGGCCGCGGGGCGGGCGG + Intergenic
906415817 1:45620947-45620969 GAGGAAGGGCCCGAAGTGGGAGG + Exonic
906624512 1:47314102-47314124 AGAGGCGGGGCCGGAGTCGGCGG - Exonic
906719926 1:47997249-47997271 GAAGGCGCGGCAGGGGTGGGGGG + Intergenic
907364272 1:53946292-53946314 GAAGGCGGGGCCGGACCTGGAGG - Exonic
913334684 1:117698362-117698384 GAGGGAGGGCCTGGAGTGGCAGG + Intergenic
914242174 1:145859277-145859299 GGAGGCGGGCCCGAAGTGCCTGG + Intronic
914834905 1:151198857-151198879 GAGGGAGGCCCCGGAGGGGGCGG + Exonic
915310215 1:155002688-155002710 TGAGGCGGGCCCTGAGGGGGGGG + Exonic
915344996 1:155192945-155192967 GCGGGCGGGCGGGGAGTGGGGGG - Intergenic
915490593 1:156248063-156248085 GCAGGCGGGCCAGGCCTGGGCGG + Intronic
917163954 1:172090670-172090692 GAAGGTGGGCAGGGGGTGGGTGG - Intronic
917821387 1:178767699-178767721 GAGGCCAGGCCAGGAGTGGGTGG + Intronic
918487597 1:185045732-185045754 GACGGGGGCCCCGGAGTGTGGGG + Intronic
918526172 1:185467271-185467293 GAAGGCGAGGATGGAGTGGGAGG + Intergenic
919486933 1:198157342-198157364 GGAGTCGGGCCGGGAGAGGGAGG + Intronic
919930424 1:202217669-202217691 GGAGGGGTGCCTGGAGTGGGGGG - Intronic
920302477 1:204997430-204997452 GGAGGCGGGCCAGGAGGGGATGG - Intronic
921055332 1:211538612-211538634 GAAGGCGGGCCAGAGCTGGGAGG + Intergenic
921185911 1:212669377-212669399 CAAGGCGGGCAGGGAGTGGCCGG + Intergenic
922461529 1:225817400-225817422 GCAGGCAGGCCAGGAATGGGAGG + Intronic
923852548 1:237813139-237813161 GAAGGCAGGAGGGGAGTGGGAGG + Intronic
1062843677 10:689381-689403 GGGGCCGGGCCCGGAGGGGGAGG - Intronic
1063147982 10:3313855-3313877 GAAGGCGTACCAGGAGTGTGGGG - Intergenic
1063376493 10:5557615-5557637 GAAGGAGGCCCCGGTGTGGAGGG + Intergenic
1065135090 10:22659805-22659827 GAGGAGGGGCGCGGAGTGGGAGG - Intronic
1067681562 10:48445102-48445124 GAAGGCAGGCCCGCAGGGTGAGG - Intergenic
1070103899 10:73414065-73414087 GGGGGCGGGCCCAGGGTGGGCGG + Exonic
1073287063 10:102395648-102395670 GGAGGCGGGGCCGGAGGGGGCGG - Intronic
1076135980 10:128045956-128045978 GAAGGTGGGCACTTAGTGGGTGG + Intronic
1076630743 10:131850484-131850506 GAAGGCGGCCCTGGGGTGGGAGG - Intergenic
1076881245 10:133240214-133240236 GAAGGCCGGCCTGGGGTAGGGGG - Exonic
1076981872 11:208960-208982 GGGGGCGGGCACGGAGGGGGTGG + Intronic
1077008398 11:369601-369623 GGCCGCGGGCCCGGGGTGGGCGG - Intergenic
1077253734 11:1571752-1571774 GGAGGCGGCCCCGGAATGAGCGG - Intronic
1077329596 11:1978188-1978210 GACGGCGGGCCTAGAGAGGGCGG + Intronic
1077479593 11:2807449-2807471 GGCCCCGGGCCCGGAGTGGGGGG - Intronic
1078088434 11:8248708-8248730 GAACACTGGCCCAGAGTGGGAGG + Intronic
1078101230 11:8331613-8331635 GGAGGCAGGACCTGAGTGGGTGG + Intergenic
1078426237 11:11253479-11253501 GAAGGGGGGCGGGGAGTGGAGGG + Intergenic
1083237689 11:61362138-61362160 GAGGGCCGGCTCGTAGTGGGAGG - Exonic
1083618028 11:64035987-64036009 GGTGGCGGGCCCGGAGCGGGGGG - Intronic
1083642713 11:64154003-64154025 GAAGGAGGGACCAGACTGGGTGG - Intronic
1083941777 11:65899978-65900000 GAAAGCGGGCACGGAGACGGAGG + Intronic
1083998763 11:66284802-66284824 GAAGCCTGGCCAGGAGGGGGAGG + Intronic
1084146141 11:67266398-67266420 GCAGGCGGGGCCGGAGGCGGCGG + Exonic
1084151242 11:67289000-67289022 GAAGGCGGGGCCGGAGGGGGCGG - Intronic
1084192274 11:67504593-67504615 GAAGGCGGGCCCGGAAGGAGGGG - Intronic
1084222743 11:67694372-67694394 GCAGGGGGGCCTGGAGTGGCAGG + Intergenic
1084304397 11:68272072-68272094 GGAGGCGAGCCGGAAGTGGGGGG + Intergenic
1084729573 11:71064693-71064715 GTAGACGGGCCCAGAGAGGGTGG + Intronic
1085037182 11:73307726-73307748 GAGGGCGGGCGGGGAGGGGGAGG + Intergenic
1085076456 11:73597116-73597138 GAAGTCAGGCCCGAAATGGGAGG - Intronic
1085402187 11:76241753-76241775 GAAGGAAGGCCTGGAGTGGCAGG - Intergenic
1085544178 11:77301698-77301720 GGAGGCGGGGCGGGAGGGGGCGG + Intergenic
1087012296 11:93525557-93525579 GCAGGAGAGCCAGGAGTGGGTGG - Intronic
1089270653 11:117299596-117299618 GAAACCAGGCCAGGAGTGGGGGG - Intronic
1090238150 11:125164593-125164615 GCGGCCGGGCCGGGAGTGGGTGG + Intergenic
1202812575 11_KI270721v1_random:33367-33389 GACGGCGGGCCTAGAGAGGGCGG + Intergenic
1091656092 12:2347932-2347954 GAAGAGGGGCCAGGAGCGGGAGG + Intronic
1096396393 12:51269857-51269879 GAAAGCAGGCCCGGAGGGGGCGG - Intronic
1096782501 12:53999395-53999417 GAAGGTGGTCCCTGGGTGGGAGG - Intronic
1102278170 12:111598740-111598762 GACGCCGGGCCCGGAGCGGAGGG + Intronic
1102429936 12:112875337-112875359 GAAGCTGGGCAGGGAGTGGGAGG + Intronic
1102953338 12:117044502-117044524 GAAGGAGGGCGGGGAGTTGGGGG + Intronic
1104857472 12:131908834-131908856 GCAGGCGGGCCCGGCGGGGAGGG + Intronic
1105409249 13:20157582-20157604 GAAGTTGGGCCAGGAGTTGGAGG - Intronic
1105767905 13:23579291-23579313 GAGGGCGGGGCCCGGGTGGGCGG + Intronic
1105945729 13:25187866-25187888 GAAGGCAGGACCGGAGAGTGTGG + Intergenic
1106736014 13:32587681-32587703 GAAGACGCGCGTGGAGTGGGTGG - Intronic
1107881582 13:44836838-44836860 GGAGGCTGGTCCGGAGTGGCTGG - Intergenic
1108868941 13:54958663-54958685 GAAGGCGGGAACGGAGTGGAAGG - Intergenic
1113099549 13:106702440-106702462 TAATGCTGGCCAGGAGTGGGTGG - Intergenic
1113388669 13:109874616-109874638 GAAGGCAGGCCTGTGGTGGGTGG - Intergenic
1113693931 13:112330825-112330847 GAACACGGGCCCGGGGTCGGAGG - Intergenic
1113741540 13:112715390-112715412 GGAGGTGGGCCAGGTGTGGGGGG - Intronic
1114467502 14:22933857-22933879 GAAGGTGGGCCTGGGGAGGGAGG - Intergenic
1114633243 14:24172799-24172821 GAAGGAGGGCCTGGTGCGGGGGG + Intronic
1117249525 14:53922612-53922634 TAAGGAGGGCCCGGGATGGGAGG + Intergenic
1118992351 14:70808736-70808758 GAAGGCGGGGCCGGGCGGGGAGG - Intronic
1119771032 14:77220870-77220892 GGAGGCGGGGCGTGAGTGGGAGG - Intronic
1119771038 14:77220888-77220910 GGAGGCGGGGCGTGAGTGGGAGG - Intronic
1119771151 14:77221244-77221266 GGAGGCGGGGCGTGAGTGGGAGG - Intronic
1120143556 14:80955335-80955357 GGAGGGGCGCCCGGGGTGGGGGG + Intronic
1121751781 14:96363486-96363508 GAAGGCGGGGAGGGAGGGGGCGG + Exonic
1122446873 14:101776027-101776049 GAAGGCGGGGGTGGAGTGGGGGG - Intronic
1122486866 14:102087463-102087485 GAACGCGGGGCCGGGGTGGGAGG + Intronic
1122531012 14:102426983-102427005 GAAAACTGGCCCGGGGTGGGGGG + Intronic
1122616247 14:103019998-103020020 GAAGGAGTGCCCAGGGTGGGAGG + Intronic
1122860970 14:104582219-104582241 GAGGACGGGGCAGGAGTGGGAGG + Intronic
1122892817 14:104740923-104740945 GAAGTCGGGGCCGCAGTGTGGGG + Intronic
1122982194 14:105196872-105196894 GACCGCAGGCCGGGAGTGGGAGG + Intergenic
1122982326 14:105197230-105197252 GCAGGCGGGGTCGGGGTGGGGGG + Intergenic
1124037662 15:26070967-26070989 GAAGCCAGGCCTGGAGTGGATGG - Intergenic
1127969464 15:63947066-63947088 GAAAGCGGGCAGGGAGTAGGAGG - Intronic
1128276343 15:66356802-66356824 GAAGGCGGGACCGGCGTGCTGGG - Intronic
1128335042 15:66780363-66780385 GGAGGCGGGCTGGGGGTGGGAGG - Intronic
1128609722 15:69063957-69063979 TAGGGCGGGCCAAGAGTGGGAGG + Intergenic
1129090357 15:73143365-73143387 GAAGGTGACCCGGGAGTGGGAGG - Intronic
1129326507 15:74802720-74802742 GAAGGAGGCCACGGAGCGGGAGG + Exonic
1131019736 15:89088168-89088190 TAAGGCCAGCCCGGAGTGGGCGG - Exonic
1131228216 15:90642529-90642551 GAAGGCGGGCCCGGAGTGGGAGG + Exonic
1131270857 15:90946919-90946941 GACGGTGGGCCTGGGGTGGGTGG + Intronic
1132669080 16:1095342-1095364 CAAGGCTGGCCTGGGGTGGGGGG + Intronic
1132717894 16:1301255-1301277 GGAGGCGGCCCGGGAGGGGGCGG - Intergenic
1132957980 16:2606433-2606455 GAAGGGGTGTCAGGAGTGGGAGG + Intergenic
1132970456 16:2685681-2685703 GAAGGGGTGTCAGGAGTGGGAGG + Intronic
1133220370 16:4316903-4316925 GAGGGCGGGTCTGGAGCGGGTGG + Intronic
1134531824 16:14989642-14989664 GGAGGCGGGCCCGGGGCCGGCGG + Intronic
1134771147 16:16810856-16810878 GAAGGAGGGCCCAGAGTGATGGG + Intergenic
1136247718 16:28985077-28985099 GAGGGCGGGCACGGAGAGGCGGG + Intronic
1136511217 16:30739226-30739248 GAAGGCGGGCCAGGCGGGTGAGG - Exonic
1137531606 16:49281885-49281907 GGAGGCGGGCCGGGAGGCGGCGG - Intergenic
1137669581 16:50271591-50271613 GAAGTCAGGCCCGGTCTGGGAGG - Intronic
1138104845 16:54282492-54282514 CCAGGCGGGCCTGGGGTGGGCGG - Intergenic
1138167436 16:54816281-54816303 AAAGGCTGGTCCTGAGTGGGTGG - Intergenic
1139633636 16:68245291-68245313 GGAGGCGGGCCCTGATTGGCCGG + Intronic
1141169937 16:81684873-81684895 CAAGGCTGGCCTGGGGTGGGAGG - Intronic
1141665393 16:85462960-85462982 GAAGACGGGCCCGGAGGGGGCGG - Intergenic
1141706052 16:85665315-85665337 GAAGGCGGGCTCAGAGTTGAGGG + Intronic
1141817802 16:86424946-86424968 GAATGTGGGCCTGGAGAGGGCGG - Intergenic
1142031461 16:87840595-87840617 GAAAGCGGACCTGGAGTGGGAGG + Intronic
1142230818 16:88899502-88899524 CAAGGCGGGCTGGGAGTGGAGGG + Intronic
1142985067 17:3690556-3690578 GAAGGAGGACTCGGAGTGGGAGG - Intronic
1143485411 17:7251385-7251407 GAACGGGGGCCCCGAGTGGCAGG + Exonic
1144062871 17:11598985-11599007 GGAGGCGGGGCCAGAGGGGGCGG + Intronic
1144429993 17:15182330-15182352 GAAGGAGGGTCTGGAGTGGATGG - Intergenic
1144794042 17:17878977-17878999 GAATGGGGTCCAGGAGTGGGCGG - Intronic
1146056579 17:29584448-29584470 GAAGCAGGGCCAGGACTGGGTGG + Intronic
1146407932 17:32555781-32555803 GAAAGCTGGCCAGGAGTTGGAGG - Intronic
1146520354 17:33521351-33521373 CAAGGCTGGCCCCGAGTGGCAGG - Intronic
1146638217 17:34521554-34521576 GCAGGCGGGGCTGGGGTGGGGGG - Intergenic
1147420785 17:40321315-40321337 GAGGGCGGGACTGGAGCGGGAGG - Intronic
1148000385 17:44384219-44384241 GGAGGCGGGGCGGGGGTGGGGGG + Intronic
1148152644 17:45405480-45405502 AAGGGCGGGGCTGGAGTGGGCGG - Intronic
1148157475 17:45432185-45432207 AGAGGTGGGCCCGGAGCGGGCGG - Intronic
1149665282 17:58360855-58360877 GCAGGCAGGCCCGGGGTGAGTGG - Exonic
1150675810 17:67245271-67245293 GGAGGCGCGGCCGGAGGGGGCGG - Intronic
1150790282 17:68197034-68197056 GGAGGCGGGCCCGGAGCTGGCGG + Intergenic
1150869454 17:68889717-68889739 GAAGGCAGGCTCGGGGTGTGGGG - Intronic
1151301821 17:73232391-73232413 AGAGGCGGGCTCGGAGCGGGAGG + Intronic
1151537972 17:74749308-74749330 GCAGGCTGGCATGGAGTGGGAGG + Intronic
1152532256 17:80925477-80925499 GAAGGTGCGCCCGGGGTGTGGGG + Exonic
1152606785 17:81295377-81295399 AGAGGCGGGCCCGGAGGGGCGGG + Intronic
1152710988 17:81870601-81870623 GATGGTGGGCCCGGAGTGCCCGG + Intronic
1152924147 17:83079870-83079892 GGGGGCGGGCCCGGGGCGGGGGG - Exonic
1152932498 17:83116986-83117008 GAACGCGGGCCTGGACTTGGAGG + Intergenic
1153900551 18:9614346-9614368 GAAGGCGCCCCCGGGGCGGGGGG - Intronic
1153997410 18:10454450-10454472 GGAGGGGCGCCCGGAGTGGGAGG + Intergenic
1154305374 18:13226915-13226937 GAATGAGGGCCAGGAGGGGGTGG + Intronic
1154316943 18:13311662-13311684 GAAGGCGGGCCTGGATGTGGAGG + Intronic
1160430952 18:78812260-78812282 GAAGGGGGGCCGGGAGGGAGCGG - Intergenic
1160511626 18:79456382-79456404 GAAGGTGAGCCCGGAGGGAGTGG - Intronic
1160567807 18:79798063-79798085 GGAGCCGGGGCCGCAGTGGGCGG + Intergenic
1160753804 19:747590-747612 GAAGGAGGGCCCAGTGGGGGCGG - Exonic
1160778341 19:866846-866868 GGGTGCGGGCCCGCAGTGGGCGG - Intergenic
1160778356 19:866897-866919 GGGTGCGGGCCCGCAGTGGGTGG - Intergenic
1160778371 19:866948-866970 GGGTGCGGGCCCGCAGTGGGTGG - Intergenic
1161515014 19:4691590-4691612 GAAGGGGGGCGGGGAGTGTGGGG + Intronic
1161590829 19:5128416-5128438 GAAGCCGGCCCAGCAGTGGGGGG + Intronic
1162152986 19:8658519-8658541 GAAGTGGGGCCGAGAGTGGGAGG + Intergenic
1162398672 19:10432085-10432107 AAAGGCGGGGCCGGAGGCGGTGG + Intronic
1162936960 19:13986209-13986231 CAAGGTGGGCAGGGAGTGGGGGG + Intronic
1163007733 19:14406986-14407008 GGAGGCGGGGCCGGGGTGAGGGG + Intronic
1163218373 19:15897200-15897222 CAATGCAGGCCTGGAGTGGGAGG + Intronic
1163398280 19:17076492-17076514 GAGGGAGGGCCCGGAGAGGAGGG + Intronic
1163779729 19:19239992-19240014 GAAGGAGGGGGAGGAGTGGGAGG - Intronic
1164906895 19:31975133-31975155 AAGGGAAGGCCCGGAGTGGGAGG - Intergenic
1165393955 19:35553881-35553903 GAAGGGGGACCCGAAGTGGAGGG - Intronic
1165793494 19:38505949-38505971 GAAGGCGGGGCCTGGGTGGAGGG + Intronic
1166074046 19:40403683-40403705 GTGGGCGGGCCCGGGGTGTGGGG - Intronic
1166373107 19:42313353-42313375 GGAGCCGGGGCCGGAGCGGGCGG + Exonic
1166678501 19:44753817-44753839 GAAGGCGGGGGCGGGGGGGGGGG + Intronic
1166854743 19:45777920-45777942 GAAGGAGGGCCCAGAGCTGGTGG - Intronic
1166965916 19:46529253-46529275 GAAGGCGTGCAGGGCGTGGGAGG - Intronic
1167118858 19:47504534-47504556 GAAGGAGGGCCAGGTGTGGGAGG + Intronic
1167494299 19:49808859-49808881 GAAGGCGGGGCCGGCGGGGGAGG + Intronic
1168264143 19:55212359-55212381 GAAGGAGGGACTGGAGTTGGAGG - Intergenic
1168334186 19:55587491-55587513 TAAGCCGGTCTCGGAGTGGGCGG + Intergenic
1168714588 19:58519468-58519490 GAAGGCGTGGCGGGAGTGTGCGG - Intronic
927642693 2:24855451-24855473 GAAGGCTGGACCGGAGGAGGGGG + Intronic
927714174 2:25341776-25341798 GAAGGCCGGCCCGGAGGCGGCGG - Intronic
933966363 2:87432576-87432598 GAGGGCAGGCACTGAGTGGGTGG + Intergenic
934720116 2:96568279-96568301 AAAAGCGGGGGCGGAGTGGGAGG - Intergenic
935301554 2:101697733-101697755 GAGGACGGGCCCGGAGCGTGGGG - Intronic
935620567 2:105126097-105126119 GAAGGCGGGCCAGGATGTGGAGG - Intergenic
936327432 2:111517909-111517931 GAGGGCAGGCACTGAGTGGGTGG - Intergenic
936518729 2:113198790-113198812 GAAGGGCGGCGCGGAGTGCGTGG - Exonic
937991180 2:127663412-127663434 GAAGGAGGGCACCGAGTGGAGGG - Intronic
938302947 2:130229144-130229166 GAAGCCGGGCGCCGAGCGGGAGG + Intergenic
938765614 2:134459152-134459174 GAAGCCAGGCCTGGCGTGGGAGG - Intronic
939628317 2:144505603-144505625 GGAGGTGGGCTGGGAGTGGGGGG + Intronic
945119369 2:206442907-206442929 GCAGGCTGGCGCGGAGTGGCAGG - Intergenic
946412012 2:219520158-219520180 GAAGGAGGGTCGGGAGGGGGAGG - Intronic
946422232 2:219571367-219571389 GGAGGCGAGCCGGGAGCGGGAGG - Intronic
946692421 2:222319509-222319531 GGTGGCGGGGCCGGGGTGGGCGG + Intergenic
946882474 2:224190526-224190548 GAAGGCAGACCCTGAGTGGAAGG + Intergenic
947188153 2:227472725-227472747 GCTGGCGGGCGCGGCGTGGGAGG + Intronic
948756592 2:240163033-240163055 GAGGGCGTGCCCCCAGTGGGTGG + Intergenic
948922206 2:241071089-241071111 GAAGGAGGGCCCAGCCTGGGAGG + Intronic
948983930 2:241508655-241508677 GCTTCCGGGCCCGGAGTGGGCGG - Exonic
1168757599 20:327244-327266 GAAGGCGGGCCGGGCGAGGGAGG - Exonic
1168797634 20:622158-622180 GAATTCGGGCCAGGAGTGGTGGG - Intergenic
1170893008 20:20391803-20391825 AAAGGCGGGCCCTGTGCGGGAGG - Intronic
1171935951 20:31274798-31274820 GGAGGACAGCCCGGAGTGGGAGG - Intergenic
1172039957 20:32036828-32036850 GACGGCGGGCAGGGAGTGGGGGG - Intergenic
1173161334 20:40654686-40654708 GAAGGCAGGCCCGTAGTGGATGG - Intergenic
1173564958 20:44032065-44032087 GAATGCTGGCCCGGTGTGAGGGG + Intronic
1173880309 20:46406640-46406662 GAAGCCGGGCCCGGCCTGTGCGG - Intronic
1174352633 20:49979420-49979442 GAGGGCGGGCCTGGAGGGGGTGG + Intergenic
1174463099 20:50697040-50697062 GAAGGTGGGACCTGAGTTGGTGG + Intergenic
1174806698 20:53609803-53609825 GAAGCGTGGCCCGGAGGGGGAGG - Intronic
1175377816 20:58541591-58541613 GAGGCCGGGGCTGGAGTGGGTGG - Intergenic
1175403630 20:58713985-58714007 GAAGGCGGGCAGGAAGTGTGGGG + Exonic
1175562665 20:59944448-59944470 GAAGCCGTGCCCCGAGTGGGAGG + Exonic
1176221055 20:63969578-63969600 GATCGCGGGCGCGGGGTGGGGGG + Intronic
1176232173 20:64038256-64038278 GAAGGCGGGGTGGGGGTGGGGGG - Intronic
1178865079 21:36320360-36320382 GAAGGGGGGCCGGCAGTGGGCGG + Intronic
1179185522 21:39082853-39082875 GAAGGCGGGGCCGGAGGGACGGG - Intergenic
1180179743 21:46112633-46112655 AAAGTGAGGCCCGGAGTGGGTGG - Intronic
1180785199 22:18543310-18543332 GATGGCGGGCCCAGTGTGGGAGG - Intergenic
1180913434 22:19469330-19469352 GAAGGCTGGCCAGGGATGGGGGG + Intronic
1181051231 22:20239150-20239172 GACGAGGGGCCCGGAGTGGGCGG - Intergenic
1181242102 22:21482663-21482685 GATGGCGGGCCCAGTGTGGGAGG - Intergenic
1181471264 22:23141712-23141734 GAAGTGGGGGCCGGACTGGGAGG + Intronic
1181514127 22:23401800-23401822 CAAGGCGGGGGAGGAGTGGGGGG + Intergenic
1182355618 22:29721113-29721135 GAAGGCGGCCCGGGAGGCGGTGG + Intronic
1183107794 22:35627383-35627405 GAGGACGGGCCGGGGGTGGGTGG + Intronic
1183739604 22:39662502-39662524 GGAGGCGGGGCCCGAGCGGGCGG + Intronic
1184131624 22:42519868-42519890 GGAGGCGGGCTTGGAGTGAGGGG - Intergenic
1184243728 22:43225191-43225213 GATGGAGGGGCAGGAGTGGGGGG - Intronic
1184837077 22:47030052-47030074 GGAGGTGGGCTCAGAGTGGGGGG + Intronic
1185213874 22:49587506-49587528 GAGGGCGGGCCTGGAGGGGTGGG - Intronic
1185352752 22:50346511-50346533 GAAGGAGGGCACTGACTGGGGGG - Intronic
949105803 3:198156-198178 GAAGGCGGGCGGGGAAGGGGTGG + Intronic
951518619 3:23589650-23589672 GAAAGCTGGCAAGGAGTGGGAGG - Intronic
952334312 3:32391827-32391849 GAGGGCGGGCCGGGGGCGGGCGG - Exonic
953905419 3:46866090-46866112 GAAGGTGGGCAGGGAGTTGGGGG + Intronic
954452564 3:50579684-50579706 GAAGGAGGGCCCCAAATGGGTGG - Intronic
954687354 3:52378137-52378159 GTAGGCAGCCCCGAAGTGGGTGG + Intronic
957054894 3:75435582-75435604 GGAGGCGGGGCCGGGGCGGGGGG + Intergenic
960523468 3:118682221-118682243 GAAGGCTGGCCTGGGGTGTGAGG - Intergenic
963990636 3:151649457-151649479 GAAGGGGAGCCAGGAGAGGGTGG - Intergenic
966919778 3:184604072-184604094 TCAGGCCGGCTCGGAGTGGGAGG - Intronic
968230726 3:197003263-197003285 AAGGCCGGGCCCGGCGTGGGCGG - Exonic
968233334 3:197016909-197016931 GAGGGCTGGCCAGGAGAGGGGGG - Intronic
968522061 4:1038501-1038523 GCAGGCGGCCCCGGGGAGGGCGG - Intergenic
968616734 4:1580782-1580804 GGAGGCGGGGCCTGGGTGGGAGG - Intergenic
968725777 4:2247226-2247248 GACGGCGGGCCCGGTGTGGTTGG + Intergenic
969344744 4:6563682-6563704 GAGCGCGGGCCCGGGGCGGGGGG + Intergenic
969516018 4:7648637-7648659 GAGGGCGGGCGGGGAGTGAGGGG + Intronic
970216731 4:13766818-13766840 GAAGGCGGCGGCGGGGTGGGTGG + Intergenic
971348878 4:25838652-25838674 GAAGGAGGGGCCAGGGTGGGTGG - Intronic
977810074 4:101347550-101347572 GGAGGCGGGCGCGGTGTTGGCGG - Intronic
985846601 5:2354182-2354204 GAAGGCCAGCCAGGTGTGGGAGG - Intergenic
986466937 5:8035036-8035058 GAGGGCGGGGCCAGAGAGGGCGG + Intergenic
996720793 5:126628293-126628315 GTAGGCGAGCTCGGAGAGGGAGG + Intergenic
998822210 5:146067251-146067273 GAAGGCAGGCCTGGTGTGGACGG - Intronic
999461184 5:151758674-151758696 GCGGCCGGGCCCGGAGTGGGAGG - Exonic
999655706 5:153808381-153808403 GACGGGGGGCGGGGAGTGGGGGG + Intronic
1002405029 5:179023920-179023942 GAGGGCGGGCCCGGGGCGTGCGG + Intronic
1002662806 5:180802936-180802958 GGAGGCGGGCCAGGAGGAGGGGG - Intronic
1002789501 6:426950-426972 CAAGGCAGGCCTGGGGTGGGGGG + Intergenic
1003688027 6:8323723-8323745 GAAGGCAGGCCCAGTGTGGCAGG - Intergenic
1004658387 6:17686898-17686920 GGAGGGGGGCGGGGAGTGGGGGG + Intronic
1005206435 6:23410629-23410651 GGAGTCGGGGCAGGAGTGGGAGG - Intergenic
1006314193 6:33280448-33280470 GAAGCAGCGCCAGGAGTGGGAGG - Exonic
1009975783 6:70668594-70668616 GAATCCGAGCCCGGAGTGGGAGG - Intronic
1013298450 6:108781059-108781081 GAGGGCAGGCATGGAGTGGGTGG - Intergenic
1017662455 6:156687531-156687553 GGAGCCGGGCGCGGAGCGGGCGG + Intergenic
1017757188 6:157539519-157539541 GAAGGAAGTCCCTGAGTGGGAGG + Intronic
1019520711 7:1459515-1459537 GGAGGCGGGGCCGGCGGGGGCGG - Intergenic
1019641259 7:2105030-2105052 GAAGCCGGGCTCTGACTGGGTGG - Intronic
1019722920 7:2583993-2584015 GAGGGCGGGCACCGAGTGGGAGG + Intronic
1019735211 7:2647046-2647068 GAGGGCGGGGCCAGAGGGGGCGG + Intronic
1019738000 7:2659917-2659939 CTAGGAGGGCCCGGGGTGGGTGG - Intronic
1019978898 7:4606517-4606539 GAGGGATGGCCTGGAGTGGGTGG - Intergenic
1022776620 7:33533517-33533539 GAAAGCGGGCCAGGAGAAGGAGG - Intronic
1024096466 7:45986657-45986679 GAAGGCAGGCCCAGGATGGGTGG + Intergenic
1024953264 7:54888234-54888256 GAAGGAGGGCCTGGAGAGGCGGG - Intergenic
1029470908 7:100753419-100753441 GATGGCAGGGCTGGAGTGGGTGG + Intronic
1030695549 7:112581017-112581039 GAAGGCTGCGGCGGAGTGGGGGG + Intergenic
1031599744 7:123692516-123692538 GAAGGCAGGCCAGGCGGGGGCGG + Exonic
1032026701 7:128448365-128448387 GGAGGCGGGAGTGGAGTGGGAGG - Intergenic
1032097587 7:128947307-128947329 GTAGGCGGCCGCAGAGTGGGCGG - Exonic
1032344441 7:131106180-131106202 GAACGCCGGCCCTGCGTGGGAGG + Intergenic
1034399479 7:150852623-150852645 GAAGGAGGGCACAGAGTGAGGGG + Intronic
1034558723 7:151866188-151866210 GACGGTGGGCCCAGAGAGGGCGG - Intronic
1034640880 7:152601494-152601516 ACAGGCGGCCCCGGCGTGGGGGG - Intergenic
1035073424 7:156160987-156161009 GAAGGCGGGCGGGGAGGGCGTGG - Intergenic
1035464142 7:159064122-159064144 GAAGCCGCGCCCGGCGTGGGTGG + Intronic
1035730079 8:1848002-1848024 GAAGGTGGCCCGGGAATGGGTGG + Intronic
1036007526 8:4683639-4683661 GAAGGCGGCCCTGGAGTGTGGGG + Intronic
1036900484 8:12665852-12665874 GAAGGGACGCCCGGAGAGGGTGG + Intergenic
1037455285 8:19057437-19057459 GAAGGCGTGACCAGAGTGGTGGG - Intronic
1037458329 8:19084718-19084740 GAAGGCAGGCCCTGAGACGGAGG - Intronic
1038251803 8:25911891-25911913 GACGCCGTGCCCAGAGTGGGCGG + Intronic
1038644473 8:29350840-29350862 GAGGAGGGGCCCGGAGGGGGCGG - Intergenic
1038747627 8:30268317-30268339 GTCTGCGGGCCCGGAGTTGGAGG - Intergenic
1039251497 8:35670086-35670108 GAAGGAGTGGCCAGAGTGGGAGG + Intronic
1043591881 8:81842306-81842328 GAAGGAGGGGCCGAACTGGGCGG + Intronic
1045277470 8:100721293-100721315 GCCGGCGGGCCCGGGGAGGGGGG - Intronic
1047435556 8:124832919-124832941 GAAGCCGGGTCAGGAGTGGTTGG + Intergenic
1049109714 8:140635408-140635430 GTTGGCGGGCCCGGCGCGGGCGG - Intronic
1049212252 8:141392168-141392190 GAAGCCGTGCCCGGAGCGGGCGG - Intronic
1049218120 8:141417012-141417034 CAGGGCGGGCACAGAGTGGGTGG + Intronic
1049619181 8:143590153-143590175 GAGGGCGGGCACGGGGAGGGTGG - Intronic
1049746948 8:144267038-144267060 GAAGGCGGGCCCGGAGTGGCAGG - Exonic
1049777861 8:144414750-144414772 GACGGGGGGCCTGGACTGGGAGG + Exonic
1049843384 8:144788079-144788101 GGAGGCGGGGCTGGAGTGGGAGG + Intergenic
1053477282 9:38391646-38391668 GAAGGCGGGCACGCATTGGAGGG - Intergenic
1054952744 9:70871148-70871170 GAAGGTGGGAGCTGAGTGGGTGG + Intronic
1055637930 9:78296546-78296568 GAAGAAGGGCCGGGGGTGGGTGG - Intergenic
1056778865 9:89534427-89534449 GAAGGGGGGCCCAGAGTATGTGG + Intergenic
1056852262 9:90094585-90094607 GGCGGCGGGACCGGGGTGGGCGG + Intergenic
1056917537 9:90758257-90758279 GCAGGAGGGCCCGGAGAAGGAGG - Intergenic
1057490071 9:95513712-95513734 GAAGTCGGGGACGGGGTGGGGGG + Intronic
1057572290 9:96213909-96213931 AAAGGCGGGGCAGGGGTGGGGGG - Intergenic
1057638592 9:96795622-96795644 GAAGTGGGGCCTGGAGGGGGAGG - Intergenic
1057881546 9:98796341-98796363 GGAGGCGGGCGCGGAGCCGGCGG - Exonic
1058110705 9:101028711-101028733 AAAGGCTGGCGCGGAGGGGGCGG - Exonic
1059234511 9:112750710-112750732 GGGGGCGGGGCCGGAGCGGGTGG + Intergenic
1059269015 9:113060802-113060824 GAAGGGGAGCGGGGAGTGGGGGG - Intergenic
1059270151 9:113066251-113066273 GAAGGGGAGCGGGGAGTGGGGGG - Intergenic
1059271287 9:113071701-113071723 GAAGGGGAGCGGGGAGTGGGGGG - Intergenic
1059272418 9:113077145-113077167 GAAGGGGAGCGGGGAGTGGGGGG - Intergenic
1059273553 9:113082587-113082609 GAAGGGGAGCGGGGAGTGGGGGG - Intergenic
1059274689 9:113088033-113088055 GAAGGGGAGCGGGGAGTGGGGGG - Intergenic
1059391852 9:114004310-114004332 AAAGGCGGGGCTGGAGGGGGAGG - Intronic
1060232681 9:121837496-121837518 GCAGGTGGGCCTGGAGCGGGTGG + Intronic
1060839949 9:126785288-126785310 GGAGGAGTGCCCGGAGAGGGGGG + Intergenic
1061002686 9:127911190-127911212 GCAGGCAGGCCAGGAGTGGTGGG + Intronic
1061433681 9:130547259-130547281 GAAGGGGAGCCAGGAATGGGAGG - Intergenic
1062314763 9:135961218-135961240 GAAGGCGGGCGGGGAGGGGGCGG + Exonic
1062349653 9:136132707-136132729 TCAGCCGGACCCGGAGTGGGGGG - Intergenic
1062393240 9:136342378-136342400 AAAAGGGGGGCCGGAGTGGGAGG + Intronic
1062565255 9:137161460-137161482 GCAGGCGCGGTCGGAGTGGGTGG + Intronic
1062592481 9:137280565-137280587 GCTGGCGGGCCCGGGGTTGGGGG - Exonic
1188452204 X:30319532-30319554 GAAGGCGGGCGGGGCGGGGGGGG - Intergenic
1189008726 X:37023015-37023037 GAAGGAGCGCCCAGAGTAGGAGG + Intergenic
1189197639 X:39165691-39165713 GGGGGCGGGCGCGGAGTGGGAGG - Intergenic
1190296497 X:49030540-49030562 GAAAGCAGCCCTGGAGTGGGAGG + Exonic
1192033871 X:67543958-67543980 GGAGGCCGGCCCGGTGGGGGCGG + Intergenic
1195322153 X:103728784-103728806 GAAAGCTGGTCGGGAGTGGGAGG - Intergenic
1196243463 X:113370334-113370356 GATGGGGGGCCAGAAGTGGGGGG + Intergenic
1197055851 X:122117416-122117438 GAAGACGGGCGGGGGGTGGGGGG - Intergenic
1197782484 X:130171862-130171884 GGAGGGGGGCCCGGAGTGAGAGG + Exonic
1200014269 X:153147034-153147056 GAAGGCGTGCCCAGTGGGGGGGG + Intergenic
1200025331 X:153252918-153252940 GAAGGCGTGCCCAGTGGGGGGGG - Intergenic
1200063797 X:153495407-153495429 GAAGACGGACCCCGAGCGGGAGG - Intronic
1200216909 X:154371998-154372020 GAAGGCGGGCCCGTGGCAGGGGG - Intronic