ID: 1131228217

View in Genome Browser
Species Human (GRCh38)
Location 15:90642534-90642556
Sequence CGGGCCCGGAGTGGGAGGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228206_1131228217 3 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228217 15:90642534-90642556 CGGGCCCGGAGTGGGAGGCTCGG 0: 1
1: 0
2: 1
3: 25
4: 288
1131228210_1131228217 -7 Left 1131228210 15:90642518-90642540 CCGTCCGCACCGAAGGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1131228217 15:90642534-90642556 CGGGCCCGGAGTGGGAGGCTCGG 0: 1
1: 0
2: 1
3: 25
4: 288
1131228205_1131228217 30 Left 1131228205 15:90642481-90642503 CCGTAGCATTGTGTAGTGTGCTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1131228217 15:90642534-90642556 CGGGCCCGGAGTGGGAGGCTCGG 0: 1
1: 0
2: 1
3: 25
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228217 Original CRISPR CGGGCCCGGAGTGGGAGGCT CGG Exonic
900109282 1:998810-998832 CGGGCCCGGGGGGGCGGGCTGGG - Intergenic
900155879 1:1203112-1203134 GGAGCCTGGAGTGGGAGGCTGGG + Intergenic
900207890 1:1439381-1439403 CGGGCCCGGAGTCGGGGGCTGGG + Exonic
900739810 1:4323782-4323804 CTGGCCTGGAGTGGCTGGCTTGG + Intergenic
901443460 1:9293114-9293136 CGGCCCGGGAGGGGGAGGCGCGG + Intronic
901490625 1:9594673-9594695 AGGGGCCTGAGGGGGAGGCTGGG - Intronic
902518000 1:17000199-17000221 GGGGGCAGGAGTGGGAGGGTGGG - Intronic
903224509 1:21887134-21887156 CGGGGCAGGAGTGGAAGGCGGGG + Intronic
903282785 1:22259522-22259544 CGGGCCTGGCGTGGAAGCCTGGG - Intergenic
903774917 1:25786865-25786887 CGGGCCTGGCGGGGGAGCCTGGG - Intergenic
905384911 1:37595837-37595859 CGGGACCGGAGTGCGAGGTCCGG + Exonic
905391641 1:37639524-37639546 CTGGGACGGAGTGAGAGGCTGGG - Intergenic
905647288 1:39633308-39633330 AAGGCCCGGAGTGGGAGGAGAGG - Intronic
906078402 1:43068387-43068409 CGGGCCGGGAGGGGGCGGCGGGG + Intergenic
906536237 1:46552355-46552377 GGTGCCGGGAGTGGGAGGCTGGG + Intergenic
911114883 1:94237185-94237207 CGCGCCCGGCGAGGGAGGCGCGG - Intronic
912508408 1:110172236-110172258 CAGGCACTGAGTGGGAGGCAGGG + Intronic
913128572 1:115816194-115816216 AGGGCCAGGGGTGAGAGGCTGGG + Intergenic
913446211 1:118953426-118953448 AAGGCCCAGAGTGGGAGGTTGGG - Intronic
914747127 1:150509086-150509108 AGGGCCTGGAGTAGGAGGGTGGG + Intronic
914919737 1:151838888-151838910 CGGGCCCGGGGCGCGACGCTTGG + Exonic
915250817 1:154587146-154587168 AGGGCCAGGAGTGGGAGAGTTGG - Intronic
915325696 1:155080349-155080371 CGCGCCCGGAGTGTCAGACTGGG + Intronic
916888943 1:169097832-169097854 CTGGCCAGGGGTGGGGGGCTAGG + Intergenic
918384026 1:183986893-183986915 GGAGCCTGGAGTGGGAGGGTGGG - Intronic
919486935 1:198157347-198157369 CGGGCCGGGAGAGGGAGGTCGGG + Intronic
919977015 1:202619352-202619374 GCTGCCCGGAGAGGGAGGCTGGG + Intronic
920171231 1:204073565-204073587 CGGGCCGGGTTGGGGAGGCTGGG - Intronic
920416246 1:205800834-205800856 CAGGCCTGGAGTGTGGGGCTGGG - Intronic
921179129 1:212617694-212617716 GAGGCCGGGAGTGGGTGGCTAGG + Intronic
921355572 1:214281465-214281487 GGGGCGCCGAGCGGGAGGCTTGG + Intronic
922619384 1:226980805-226980827 CGGGCCCGGAAGAGGAGCCTCGG - Intronic
922926082 1:229347676-229347698 TGGGGACAGAGTGGGAGGCTGGG - Intergenic
923055913 1:230425969-230425991 AGGGCCCGGCGTGTGCGGCTGGG - Intergenic
1063368771 10:5507649-5507671 GAGGCCCAGAGAGGGAGGCTGGG - Intergenic
1063785577 10:9379502-9379524 CTGGCGCGGAGTGGGGGGCGGGG - Intergenic
1065135088 10:22659800-22659822 GGGGCGCGGAGTGGGAGGGTTGG - Intronic
1065240131 10:23695747-23695769 GGGGTTCGGAGTGGGAGGTTTGG + Intronic
1069870029 10:71527442-71527464 AGGGCCCAGAGGAGGAGGCTGGG - Intronic
1073063452 10:100745393-100745415 CGGCACCGGAGTGACAGGCTCGG + Intronic
1073065634 10:100757615-100757637 TGGTCCCGCAGTGGGAGGCATGG + Intronic
1073299314 10:102461343-102461365 CGGGGGCGGAGGGAGAGGCTGGG + Intergenic
1074383700 10:113000693-113000715 CGGGCCCGGAGGGGAGGGCAAGG + Intronic
1074772236 10:116741965-116741987 CGAGGCAGGAGTGGGAGCCTGGG - Intronic
1075002646 10:118809596-118809618 GTGGCCCGGTGAGGGAGGCTGGG + Intergenic
1075522015 10:123148712-123148734 GGGGCCCGGCGCGGGAGTCTTGG - Intronic
1076630740 10:131850479-131850501 CGGCCCTGGGGTGGGAGGGTGGG - Intergenic
1076864360 10:133159949-133159971 GGGGCCCGGGGTGGGGGGCGGGG - Intergenic
1076864373 10:133159968-133159990 GGGGCCCGGGGTGGGGGGCGGGG - Intergenic
1076893003 10:133293957-133293979 CGGGGCCGGCCTGGGAGGCGTGG + Intronic
1076905397 10:133358400-133358422 GGAGCTCGGGGTGGGAGGCTCGG - Intergenic
1077008394 11:369596-369618 CGGGCCCGGGGTGGGCGGCGGGG - Intergenic
1077064884 11:636744-636766 CGGGCGCGGAGTCGGGGGCAGGG + Intergenic
1077492806 11:2869950-2869972 GCGGCCGGGAGGGGGAGGCTCGG + Intergenic
1077637712 11:3855154-3855176 CTGGCCGGGAGTTGGGGGCTGGG + Intronic
1078023472 11:7673568-7673590 GGGGGCCGGAGCGGGAGGCGTGG - Intronic
1078679550 11:13463042-13463064 CGGGGGCGGCGCGGGAGGCTGGG - Intronic
1079565573 11:21878243-21878265 AGAGCCTGGAATGGGAGGCTTGG - Intergenic
1079642940 11:22829695-22829717 CAGGTCCGGCGTGGGAGGCGCGG + Exonic
1081040433 11:38203363-38203385 GGGGGCGGGGGTGGGAGGCTGGG + Intergenic
1083828137 11:65214452-65214474 CTGGCCCGCACTGGGTGGCTGGG - Intergenic
1083849178 11:65355242-65355264 CGGGTCCTGAGAGGGAGGCTAGG - Intronic
1084024821 11:66441215-66441237 CGGGGCCAGAGTGGGAGCCCAGG + Intronic
1084265640 11:68003918-68003940 GGGACCCGGAGTGCGAGGCGCGG - Intronic
1084444534 11:69196080-69196102 CGGGGCCGGGGTTGGGGGCTGGG - Intergenic
1084904374 11:72334661-72334683 GGGGCCCTGGGTGGGAGGCAAGG - Intronic
1085054262 11:73394784-73394806 GGGGCCGGGAGGGGGAGGCAGGG + Intronic
1086332696 11:85769847-85769869 CAGGCCCGTGGTGGTAGGCTGGG + Intronic
1087684966 11:101251950-101251972 CAGGCCCAGGGTGCGAGGCTAGG - Intergenic
1088550776 11:111010325-111010347 AGGGCCACGAGAGGGAGGCTGGG + Intergenic
1089270650 11:117299591-117299613 CAGGCCAGGAGTGGGGGGCTGGG - Intronic
1091147436 11:133291864-133291886 AGGCCCTGGGGTGGGAGGCTTGG - Intronic
1091220353 11:133926890-133926912 AGGGCCCGGGGTGGGATGTTGGG - Intronic
1091286949 11:134412845-134412867 CCGGCCCGGAAGGGGAGGCTGGG - Intergenic
1091616425 12:2053818-2053840 GGGGCCCGGAGGGGGAGGGGCGG - Intronic
1091640218 12:2230376-2230398 CGGTCCCGGAAGGGGAGGCGGGG + Intronic
1091759543 12:3077659-3077681 CGGGCCGGGAAGGGGAGGGTGGG + Intronic
1091857515 12:3751635-3751657 CGGGCCTTGAATAGGAGGCTGGG - Intronic
1092155832 12:6280973-6280995 TGCCCCAGGAGTGGGAGGCTGGG - Intergenic
1093899896 12:24619972-24619994 CTGTCGGGGAGTGGGAGGCTGGG - Intergenic
1096465734 12:51847153-51847175 CGGTTCCGGACTGAGAGGCTCGG + Intergenic
1099962253 12:89407953-89407975 CTGTCAGGGAGTGGGAGGCTAGG - Intergenic
1101628065 12:106465610-106465632 CCTGCCTGGGGTGGGAGGCTAGG - Intronic
1104199074 12:126569958-126569980 TGGGCCAGGGGTGGGAGCCTTGG + Intergenic
1104642911 12:130478873-130478895 CGGGCGCGGCGTGCGAGGCAGGG - Intronic
1104926391 12:132316169-132316191 CGAGCCTGGACTGGGACGCTGGG - Intronic
1104948391 12:132427527-132427549 AGGGCCTGGGGTGGGTGGCTGGG + Intergenic
1105409247 13:20157577-20157599 TGGGCCAGGAGTTGGAGGTTGGG - Intronic
1105583015 13:21718563-21718585 AGGGGCTGGGGTGGGAGGCTTGG + Intergenic
1107401541 13:40074292-40074314 GGGTCCCTGAGTGGGTGGCTGGG - Intergenic
1107481616 13:40789983-40790005 CTGCCCAGGAGTGGGCGGCTGGG + Intronic
1111934852 13:94548283-94548305 CTGGCTCGTAGTGGGAGGTTAGG + Intergenic
1112554266 13:100452279-100452301 AGGGCCAGGAGTGGGGGGCGTGG - Intronic
1113009470 13:105747312-105747334 CTGTCCCGGGGTGGGGGGCTAGG + Intergenic
1113693928 13:112330820-112330842 CGGGCCCGGGGTCGGAGGAGGGG - Intergenic
1114473946 14:22981519-22981541 CGGGGCCGGAGTGGGAGCGGCGG - Exonic
1114660354 14:24339687-24339709 GGGGGCCGGCGAGGGAGGCTGGG - Intronic
1116905188 14:50396959-50396981 CGGGCCGGGGGTGGGAAGCTGGG - Intronic
1119727960 14:76933497-76933519 AGGGCCAGGAGTTTGAGGCTGGG - Intergenic
1119771029 14:77220865-77220887 CGGGGCGTGAGTGGGAGGCGGGG - Intronic
1119771035 14:77220883-77220905 CGGGGCGTGAGTGGGAGGCGGGG - Intronic
1121355117 14:93207481-93207503 CGGGCCGGGAAGGGGAGGTTCGG - Intronic
1121617069 14:95320112-95320134 CGGGGCAGGGGCGGGAGGCTGGG + Intergenic
1122661970 14:103302036-103302058 GGGGCCGGGAGTGGTTGGCTAGG - Intergenic
1123055385 14:105566868-105566890 GGGGGCTGGAGTGGGAGGCCTGG - Intergenic
1123079837 14:105686712-105686734 GGGGGCTGGAGTGGGAGGCCTGG - Intergenic
1125672905 15:41486455-41486477 CGGGCCCGGAGTGGGGAACGAGG - Intergenic
1130986993 15:88851106-88851128 AGGGTCAGGGGTGGGAGGCTGGG - Intronic
1131228217 15:90642534-90642556 CGGGCCCGGAGTGGGAGGCTCGG + Exonic
1132314527 15:100880123-100880145 CGCGCCCGGGCAGGGAGGCTCGG - Intronic
1132573659 16:655186-655208 TGGGCCCGGAGTGGGGGCCGAGG + Intronic
1133299993 16:4776553-4776575 CGGGCCAGGAGTAAGGGGCTGGG + Intergenic
1135038234 16:19096327-19096349 CGAGAAAGGAGTGGGAGGCTGGG - Intergenic
1136224036 16:28846668-28846690 CGGACCCGGAGGGAGGGGCTCGG + Exonic
1136347693 16:29686799-29686821 AAGGCCAGGAGTTGGAGGCTGGG - Intronic
1136613178 16:31379670-31379692 CTGGGCTGGGGTGGGAGGCTGGG + Intronic
1138421572 16:56902610-56902632 AGGGGCCGGAGTGGAAGGCAGGG - Intronic
1141569926 16:84928266-84928288 CAGGCCCTGAGTGCGAGGCTGGG + Intergenic
1141768150 16:86072200-86072222 TGGGACCACAGTGGGAGGCTAGG - Intergenic
1141855788 16:86680861-86680883 CGGGCTCAGAGTGGGGGCCTGGG + Intergenic
1142795518 17:2303906-2303928 CGGGACCGGAGCGAGAGCCTGGG + Exonic
1142902319 17:3019805-3019827 TGGGGCCTGAGTTGGAGGCTTGG + Intronic
1143137697 17:4720875-4720897 AGGGCAGGGAGTGGGAGGCTGGG + Intronic
1143781307 17:9230995-9231017 GGTGCCCGGAGTGTGGGGCTGGG + Intronic
1147315361 17:39617808-39617830 CGAGCCGGGATTGGGCGGCTGGG - Intergenic
1148397809 17:47324068-47324090 CGGGCCGGTAGTGGGACCCTTGG + Exonic
1148676797 17:49450514-49450536 CGGGCACTGGGTGGGAGACTAGG - Intronic
1151197956 17:72445390-72445412 TGGGGCCAGAGTGGGAGGTTGGG - Intergenic
1151703327 17:75754508-75754530 CGGGCCCCGTGGGGCAGGCTGGG - Intronic
1152132317 17:78484834-78484856 CGGGGCCGGAGGGGAAGGCGTGG - Intronic
1152517527 17:80834545-80834567 CAGCCCCGGGGTGGGAGGCGGGG - Intronic
1153185480 18:2481478-2481500 AGGGCCGGGAGTGGGAAGCTGGG + Intergenic
1153997413 18:10454455-10454477 GGCGCCCGGAGTGGGAGGAGGGG + Intergenic
1158962322 18:62596947-62596969 GGTGCCCGGAGAGGGAGGCACGG + Intergenic
1160205089 18:76824846-76824868 CCAGCCCGGAGAGGGAGGCTGGG - Intronic
1160672036 19:370058-370080 TGGGCCGGGAGTGGGAGCCCAGG - Intronic
1160785215 19:897209-897231 AAGTCCCGGAGTGGGAAGCTTGG + Exonic
1161063133 19:2225216-2225238 CAGGCCTGGACTGGGTGGCTGGG - Intronic
1161091283 19:2361178-2361200 CGGGGCTGGGGTGGGAGGCTGGG + Intergenic
1161091298 19:2361209-2361231 TGGGGCTGGGGTGGGAGGCTGGG + Intergenic
1161139110 19:2637462-2637484 CGGGCACAGGGTGGGAAGCTTGG - Intronic
1161337142 19:3720746-3720768 AGGCCCCTGAGCGGGAGGCTGGG + Intronic
1162068043 19:8137488-8137510 TGGGCCCAGAGTGGGAGTCTGGG - Intronic
1162794614 19:13080074-13080096 CAGGCCCTGGGTGGGAGACTGGG - Intronic
1163509910 19:17728146-17728168 CGGGCCTCGAGTGGCAGTCTTGG - Exonic
1163547387 19:17948261-17948283 GGGGGCCGGAGTGGGAACCTCGG - Intergenic
1163651696 19:18521665-18521687 CGGGCCCGGCGCGCGAGTCTGGG + Intronic
1163691952 19:18743072-18743094 CTGGCCCCCAGTGGGAGGCTGGG - Intronic
1164197548 19:22983849-22983871 CTGTCGGGGAGTGGGAGGCTAGG + Intronic
1164855236 19:31516031-31516053 CGGCCCCGGAGCTGGAGTCTTGG - Intergenic
1165059081 19:33195998-33196020 CGGGCCCAGAGTCGGGGGGTGGG - Intronic
1165104689 19:33462039-33462061 GGGGCCCGTAGTGGGCTGCTTGG - Intronic
1165744545 19:38222839-38222861 GGGTCCCGGAGTGGGAGGAGGGG - Intronic
1165907927 19:39204905-39204927 GGAGGCAGGAGTGGGAGGCTGGG + Intergenic
1166074043 19:40403678-40403700 CGGGCCCGGGGTGTGGGGCGGGG - Intronic
1166721754 19:45001282-45001304 CCGGCCGGGAAAGGGAGGCTGGG - Intergenic
1166846260 19:45730580-45730602 TGGGCCCCGAGTTGGAGACTGGG - Intronic
1166857945 19:45792543-45792565 CGGGACCGGAGGCGGAGGCAGGG + Exonic
1167570636 19:50286546-50286568 AGGGCCGGGAGCGTGAGGCTCGG + Exonic
1167697633 19:51024596-51024618 CGGTGCCGGGGTGGGGGGCTGGG - Intronic
925610568 2:5697491-5697513 CTCGCCCAGAGCGGGAGGCTGGG - Exonic
926130768 2:10302374-10302396 CGGGCCTGGAGTGGGAAGCCTGG - Intergenic
926772642 2:16392142-16392164 TGGGCCAGGCGTGGGAGGCATGG + Intergenic
932457202 2:71857416-71857438 ATGGCCCTCAGTGGGAGGCTCGG + Intergenic
932466945 2:71930136-71930158 TTGGCCAGGAGTGGCAGGCTGGG - Intergenic
934681241 2:96285483-96285505 CTGGCCTGGAGTTAGAGGCTTGG - Intronic
935112258 2:100104614-100104636 CCGGCCCGGAGTCGGGGGCGGGG - Intronic
935761281 2:106322938-106322960 CGAGCTGGGAGTGGGAGCCTTGG + Intergenic
936122724 2:109760545-109760567 CCGGCCCGGAGTCGGGGGCGGGG + Intergenic
936221969 2:110610928-110610950 CCGGCCCGGAGTCGGGGGCGGGG - Intergenic
936795516 2:116198125-116198147 CGGGCACGGTTTGGGAGGCTGGG - Intergenic
937290670 2:120779821-120779843 CGGGCCAGGACTGGCAGCCTCGG + Intronic
939622777 2:144440680-144440702 AGGGGCAGGAGTGGGTGGCTGGG + Intronic
939710927 2:145519282-145519304 CTGTCTGGGAGTGGGAGGCTGGG - Intergenic
941853186 2:170204785-170204807 CAGGGCTGGGGTGGGAGGCTTGG + Intronic
945115860 2:206407354-206407376 CTGTCCTGGGGTGGGAGGCTGGG - Intergenic
946334702 2:219029135-219029157 TGGGCTGGGAGAGGGAGGCTTGG - Intronic
946422231 2:219571362-219571384 CGAGCCGGGAGCGGGAGGCCCGG - Intronic
946692424 2:222319514-222319536 CGGGGCCGGGGTGGGCGGCGGGG + Intergenic
946741494 2:222806884-222806906 GGGGCAGGGAGTGGGAGTCTAGG + Intergenic
947119523 2:226800157-226800179 AGAGCCCCGAGTGGGAGGCCGGG + Intergenic
947836480 2:233179565-233179587 CGGGCCCGGAATATGAGGGTTGG + Intronic
948465147 2:238148631-238148653 CAGGCCCGGGGTTGGGGGCTGGG + Intronic
1170982644 20:21229143-21229165 GGGGCCCAGAGTGGCAGGCAGGG + Intronic
1172101067 20:32484079-32484101 CAGGCCAGGAGAGGGAGACTTGG + Intronic
1172155313 20:32820042-32820064 CGGGCCCGGGGGGTGCGGCTGGG + Intronic
1172502468 20:35437168-35437190 CTGGCCCGGGGTGGGTGTCTGGG - Intronic
1172662065 20:36574493-36574515 TGGGCCCGGAGGGGGAGGGGAGG - Intronic
1173181473 20:40809461-40809483 CTGGCCCATAGTGGCAGGCTCGG + Intergenic
1173793666 20:45843936-45843958 GGGGCCTAGAGTGGGAGACTTGG - Intronic
1174059397 20:47821810-47821832 GGAGCCAGGAGTGGGAAGCTGGG + Intergenic
1174292555 20:49519456-49519478 AGAGCCGGGAGTGGGAAGCTGGG - Intronic
1174352636 20:49979425-49979447 CGGGCCTGGAGGGGGTGGCGGGG + Intergenic
1174475875 20:50795263-50795285 CGCTCCCGGAGTGGGGGGCCCGG + Intronic
1175083073 20:56437438-56437460 GGGGCCTGGAGTGGGAGGGCGGG - Exonic
1175522596 20:59611697-59611719 TGGGGCCGGAGAGGGAGGCAGGG - Intronic
1175585405 20:60135349-60135371 GTGGCCCAGAGTGGGAGGCTGGG + Intergenic
1178561512 21:33642936-33642958 CGGACCCGCACTGGGAGGCCGGG + Intronic
1179514784 21:41899020-41899042 GGGGCCCGGGATGGGGGGCTCGG + Intronic
1179586107 21:42375205-42375227 GGGTCCCGGAGGGGGAGGCGTGG - Intronic
1179605686 21:42513939-42513961 CGGGGCCGGACCGGGAGGCGGGG + Exonic
1179785810 21:43729053-43729075 CGGGTGCGGGGTGGGGGGCTGGG - Intronic
1182098980 22:27644816-27644838 CCTGCCTGGAGTGGGAGGGTGGG + Intergenic
1182257532 22:29049643-29049665 GGGCCCCGGGGTGCGAGGCTAGG - Exonic
1182485193 22:30635168-30635190 CCGCCCTGGACTGGGAGGCTGGG + Intergenic
1182622073 22:31623811-31623833 CTGGCCCTGAGGCGGAGGCTGGG - Exonic
1183328992 22:37209303-37209325 CGGGCTCAGAGTGCCAGGCTGGG + Intronic
1183353472 22:37346257-37346279 GGGGCCTGGTCTGGGAGGCTTGG - Intergenic
1183942027 22:41301450-41301472 CGCGCCCGGGGTGGGCGGCGCGG - Intergenic
1184593744 22:45502518-45502540 CGGGCCTGCAGTCGGAGGCCCGG - Intronic
1184698135 22:46150818-46150840 GGGGCCCGGGGTGCGCGGCTGGG + Intronic
1185114527 22:48924281-48924303 CGTCCCCGGAGTGTGAAGCTGGG + Intergenic
1185248922 22:49789483-49789505 CGGGGCGGGGGGGGGAGGCTAGG - Intronic
1185299535 22:50072304-50072326 CGGGGCTGGAGTTGGGGGCTGGG - Intronic
1185376856 22:50486630-50486652 CAGGGCCCAAGTGGGAGGCTGGG + Intergenic
950128784 3:10527731-10527753 CTGGCCAGGTATGGGAGGCTGGG - Intronic
951518617 3:23589645-23589667 CTGGCAAGGAGTGGGAGGGTAGG - Intronic
952430419 3:33218518-33218540 TGGGCCAGGAGAGGGATGCTGGG + Intronic
952900814 3:38110458-38110480 CGGGCCCTGAGTGGGCGTGTGGG + Intronic
952966732 3:38625691-38625713 CTGGCCCTGAGTGGGAGCCAGGG + Intronic
953246805 3:41200050-41200072 CGGGCCCTGGGTGGGGGGCGGGG + Intronic
954118103 3:48478358-48478380 CTGGGCCTGAGTGGGGGGCTTGG - Intronic
954146206 3:48635510-48635532 CGGGGCAGGACGGGGAGGCTTGG + Intergenic
954882619 3:53846113-53846135 CGGGACCGGAGCGGGAGGAGCGG + Exonic
959498122 3:107074627-107074649 TGGGGCATGAGTGGGAGGCTTGG + Intergenic
960050778 3:113237422-113237444 ATGGCCCTGAGTTGGAGGCTGGG - Intronic
961614781 3:128170139-128170161 CGGGCCAGGCGGGGGAGGCGGGG - Intronic
963022152 3:140882783-140882805 CTGTCCAGGAGTGGGGGGCTAGG + Intergenic
966762306 3:183428759-183428781 AGGACCCGGAGCGGGAGGCTGGG + Intronic
966917088 3:184590974-184590996 CTGGCCCAGAGAGGGAGGGTCGG - Intronic
968130286 3:196189101-196189123 AGGGCCTGGAGATGGAGGCTTGG + Intergenic
968616724 4:1580758-1580780 GGGGCCTTGAGTGGGAGGCGGGG - Intergenic
968616731 4:1580777-1580799 CGGGGCCTGGGTGGGAGGCGGGG - Intergenic
968616740 4:1580795-1580817 GGGGCCTTGAGTGGGAGGCGGGG - Intergenic
968616767 4:1580851-1580873 GGGGCCCTGAGTGGGAGCCGTGG - Intergenic
968616812 4:1580960-1580982 GGGGCCCTGAGTGGGAGCCGTGG - Intergenic
968616857 4:1581069-1581091 GGGGCCCTGAGTGGGAGCCGTGG - Intergenic
968616902 4:1581178-1581200 GGGGCCCTGAGTGGGAGCCGTGG - Intergenic
968810553 4:2797820-2797842 CTGCCCAGGAGTGGGAGGCTGGG - Intronic
969344747 4:6563687-6563709 CGGGCCCGGGGCGGGGGGCGGGG + Intergenic
971959744 4:33470918-33470940 AGTGCCCGGAGTGGCTGGCTGGG - Intergenic
972158956 4:36198984-36199006 GAGGCCTGGAGTGGGAGGCCTGG + Intronic
972763669 4:42131857-42131879 AGGACCAGGAGTGGGAGGATGGG - Intronic
975661125 4:76689721-76689743 TGGGCACGGAGAGGGAGGCGGGG + Intronic
980948433 4:139347033-139347055 CGCACCTGTAGTGGGAGGCTGGG - Intronic
985010864 4:185580765-185580787 TGGGCTCAGAGTGGGAGCCTCGG - Intergenic
985781966 5:1876348-1876370 CGGGCCCTGAGGGGGACCCTCGG - Intergenic
986729699 5:10626108-10626130 AGGGGCCGGAGTGGGAGGCAGGG + Intronic
992663503 5:78984585-78984607 CGGTCCTGAGGTGGGAGGCTGGG - Intronic
994197625 5:96936635-96936657 CGGGGTGGGGGTGGGAGGCTTGG + Intronic
994985783 5:106932222-106932244 GGGGCCTGGAGTGGGGGGGTGGG - Intergenic
997787736 5:136728852-136728874 GGGGCCTGGAGTCTGAGGCTAGG + Intergenic
997984597 5:138492334-138492356 CTGGCCCGGCGCGGGAGGCGCGG + Intergenic
998108718 5:139484973-139484995 CAGGCCTGGAGAGTGAGGCTAGG + Intergenic
1001205240 5:169756152-169756174 CCTACCTGGAGTGGGAGGCTGGG + Intronic
1001575024 5:172757719-172757741 CGGGCCCTGCATGGGACGCTGGG - Intergenic
1003098174 6:3157860-3157882 GGGGTCCAGAGTGGGCGGCTCGG - Intergenic
1005851585 6:29827404-29827426 CAGGCAAGGAGTGGGAGGCAGGG + Intronic
1006155201 6:32009929-32009951 CGGGCCCGGGGCCGGGGGCTGGG - Intergenic
1006161507 6:32042663-32042685 CGGGCCCGGGGCCGGGGGCTGGG - Intronic
1006405697 6:33843570-33843592 ACTGCCCGGCGTGGGAGGCTTGG - Intergenic
1007100526 6:39243190-39243212 GGGGCCTGGAGATGGAGGCTGGG + Intergenic
1007248957 6:40482754-40482776 CTGGCCAGGAGGGGGAGGCAGGG - Intronic
1007400516 6:41600009-41600031 TGGGGCCGGGGTGGGAGACTGGG - Exonic
1008859091 6:56127760-56127782 GGAGCCTGGAGTGGGAGGGTAGG + Intronic
1015053390 6:128869670-128869692 AGTGCCTGGAGTGGGTGGCTGGG - Intergenic
1015907490 6:138131736-138131758 AGGGCCAGGCGTGGTAGGCTGGG - Intergenic
1018662289 6:166099302-166099324 CGGACCAGGAGTGGGAGGGACGG + Intergenic
1019279987 7:194768-194790 CGGGGGCGGGGTGGGGGGCTAGG - Intronic
1019575263 7:1734632-1734654 AGGCCCCGGAGTGGGAGCCCAGG - Intronic
1020130239 7:5555387-5555409 CGGGCCCGGCGTGGGGGTCGCGG - Intronic
1021665109 7:22969289-22969311 CAGGTGCGGTGTGGGAGGCTGGG - Intronic
1021801974 7:24316507-24316529 CGGGGTCGGAGTGGGGTGCTGGG - Intergenic
1023038459 7:36153064-36153086 CGGGCCTGGAGTGGGAGAGGCGG - Intergenic
1028953670 7:96665165-96665187 CTGGCTGGGAGTGGGAGGCTAGG - Intronic
1032837214 7:135685456-135685478 GGGGCCTGGAGTGGCAGGCCTGG - Intronic
1033253203 7:139777837-139777859 CGGGCCCGGCGCGGGGGGCTCGG + Intronic
1033757045 7:144403989-144404011 CGGGGCTGGAGGGCGAGGCTGGG + Intronic
1034243042 7:149624363-149624385 TCGGCCCGGAGTGGGGGGCCCGG + Intergenic
1034291758 7:149938019-149938041 CGGGTCGGGAGGAGGAGGCTGGG - Intergenic
1034293204 7:149948538-149948560 CGGGCCTGGACTGGAGGGCTGGG - Intergenic
1034812870 7:154148341-154148363 CGGGCCTGGACTGGAGGGCTGGG + Intronic
1034814327 7:154158879-154158901 CGGGTCGGGAGGAGGAGGCTGGG + Intronic
1036446825 8:8828949-8828971 CGGGCCGGAAGAGGGAGGCAGGG - Intronic
1037833331 8:22201646-22201668 GTGGCCGGGAGTGGGAGGCCAGG - Intronic
1038612650 8:29069963-29069985 TGGGACCAGGGTGGGAGGCTGGG + Exonic
1038612670 8:29070015-29070037 TGGGACCAGGGTGGGAGGCTGGG + Exonic
1038828458 8:31032881-31032903 CGGGCCCGGCGTGGGGGTCGCGG - Exonic
1040874986 8:52141775-52141797 GAAGCCCAGAGTGGGAGGCTGGG + Intronic
1040875785 8:52150573-52150595 CGGGCAGGGAGAGGGAGGCAGGG + Intronic
1041729729 8:61051858-61051880 GGGGCCCAGCGTGGGTGGCTGGG - Intergenic
1045388075 8:101690100-101690122 CGGGGTCGGAGTGGGAGCCCAGG - Intronic
1049109712 8:140635403-140635425 CGGGCCCGGCGCGGGCGGCAGGG - Intronic
1049380848 8:142315110-142315132 CTGGCACGGCATGGGAGGCTTGG + Intronic
1049476058 8:142797469-142797491 AGGGCCCGGGGTGGGGTGCTGGG + Intergenic
1049622175 8:143603479-143603501 TGGGCCAGGAGTGGCTGGCTTGG + Intergenic
1049828482 8:144685392-144685414 CGGGCTGGGAGTGTGAGGGTGGG - Intergenic
1060105265 9:120869171-120869193 CGGGCCCGGAGAGTAAGGCAGGG - Exonic
1060485250 9:124042342-124042364 AGGGCCAGGAGGGGGAGGCAGGG - Intergenic
1061402993 9:130378474-130378496 GGAGCTGGGAGTGGGAGGCTGGG + Intronic
1061664331 9:132151663-132151685 TGGGCCCTGAGGGGGATGCTTGG + Intergenic
1061828321 9:133275249-133275271 CGGGCCGGGAGGGGGCGCCTCGG - Intergenic
1061868931 9:133509903-133509925 CGGGGCCGGAGTGTGGGGCTGGG + Intergenic
1061926856 9:133810164-133810186 GTGGCCCGGAAGGGGAGGCTGGG - Intronic
1062006748 9:134242283-134242305 CTGGCCGGGACTGGGAGGGTGGG - Intergenic
1062532844 9:137009314-137009336 CGGGCCCGGGGGGGGCGGCCAGG - Intronic
1062554969 9:137109777-137109799 CGGGCCCCGAGTGTGGGCCTCGG + Intergenic
1062696194 9:137877608-137877630 CAGCCCCGGGGTGGGAGGCGCGG + Intergenic
1185747382 X:2583909-2583931 GGGGCCCGGAGTAGGGGGCGCGG + Intergenic
1191184216 X:57592491-57592513 CGGGGCCGGAGTGGGAACCGCGG - Exonic
1191213177 X:57909968-57909990 CGGGGCCGGAGTGGGAACCGCGG + Exonic
1192240638 X:69324994-69325016 CAGGGCAGGGGTGGGAGGCTGGG - Intergenic
1192326227 X:70134436-70134458 GGGGGACGGAGTGGGAGGCTGGG - Intronic
1195749412 X:108149278-108149300 CAGGCCCGGACAGTGAGGCTGGG + Intronic
1200943798 Y:8811364-8811386 CGGGCCCAGAGTGTGGTGCTGGG - Intergenic