ID: 1131228220

View in Genome Browser
Species Human (GRCh38)
Location 15:90642539-90642561
Sequence CCGGAGTGGGAGGCTCGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228206_1131228220 8 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228220 15:90642539-90642561 CCGGAGTGGGAGGCTCGGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 203
1131228212_1131228220 -6 Left 1131228212 15:90642522-90642544 CCGCACCGAAGGCGGGCCCGGAG 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1131228220 15:90642539-90642561 CCGGAGTGGGAGGCTCGGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 203
1131228210_1131228220 -2 Left 1131228210 15:90642518-90642540 CCGTCCGCACCGAAGGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1131228220 15:90642539-90642561 CCGGAGTGGGAGGCTCGGCCTGG 0: 1
1: 0
2: 2
3: 21
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228220 Original CRISPR CCGGAGTGGGAGGCTCGGCC TGG Exonic
900113538 1:1019585-1019607 CCGGACACCGAGGCTCGGCCGGG - Intergenic
901494839 1:9614990-9615012 CTGGAGTGGGGGGCTCGGGTTGG + Intergenic
901672805 1:10866167-10866189 GCGGGGTGGGGGGCTCGGGCTGG + Intergenic
906416230 1:45622894-45622916 CCGGGGTGGGAGGGGCGGGCTGG - Intronic
907513759 1:54980687-54980709 CCGGAGTGGAGGGCGAGGCCCGG + Intergenic
912798608 1:112707182-112707204 CGGCAGGGGGAGGGTCGGCCGGG + Intronic
914677165 1:149914117-149914139 CCAGATTGGGAGGCTAAGCCAGG + Exonic
915587467 1:156851948-156851970 CCGAAGGTGGAGGCACGGCCGGG + Exonic
915936950 1:160095227-160095249 CAGGAATGGGATGCTGGGCCCGG - Exonic
916750884 1:167722008-167722030 CCGGAGTGGGGAGCGCGGCGTGG + Exonic
918216087 1:182392407-182392429 CCGGAGCGGGCGGCTCTTCCAGG - Intergenic
919689637 1:200517517-200517539 CCGGAGTGGGAAGCACAGCAGGG - Intergenic
919977020 1:202619357-202619379 CCGGAGAGGGAGGCTGGGGGTGG + Intronic
924585032 1:245354560-245354582 GGGGAGTTGGAGGCTGGGCCAGG + Intronic
1063389371 10:5639283-5639305 CTGCGGTGGGAGGCTCGGGCCGG + Exonic
1063998443 10:11642714-11642736 ACGGAGTGGAAGACTCAGCCGGG - Intergenic
1067112065 10:43408167-43408189 GCGCAGTGGGAGGCCCAGCCGGG - Intronic
1067929101 10:50541686-50541708 CCAGAGTGGGTGGCTCAGCCAGG - Intronic
1069445772 10:68472007-68472029 CCGGCGCGGGAGGGGCGGCCTGG - Intronic
1072691205 10:97573223-97573245 ACTGAGTGGGAGGCTGGGGCAGG + Intronic
1073251123 10:102120790-102120812 CCGGAGCGGGAGCCGCGGCTGGG + Intergenic
1074237264 10:111598257-111598279 CTGGAGTGGTAGGCTGTGCCAGG - Intergenic
1075401365 10:122163653-122163675 CCGGCGTGCGCGGCTCTGCCCGG - Intronic
1075865973 10:125719615-125719637 CCGCAGCGGGAGGCGGGGCCGGG + Exonic
1076218682 10:128715988-128716010 CCGGAGAGAGAGGCTGCGCCCGG + Intergenic
1076864370 10:133159963-133159985 CCGGGGTGGGGGGCGGGGCCCGG - Intergenic
1076905395 10:133358395-133358417 TCGGGGTGGGAGGCTCGGGTAGG - Intergenic
1077026542 11:442353-442375 CCGGGGTGGGGGGCATGGCCTGG - Intergenic
1077254608 11:1574607-1574629 CGGGGGTGGGAGGCGCGACCAGG + Intergenic
1077305217 11:1865891-1865913 CCTGAGTGGGAGGCTCCTCAGGG + Intronic
1077311586 11:1891229-1891251 CCAGGGTGGGCGGCTTGGCCGGG - Intronic
1077372072 11:2187042-2187064 CAGGAGCAGGAGGCACGGCCGGG + Intergenic
1077392910 11:2308250-2308272 CCTGAGAGGGAGACTTGGCCTGG - Intronic
1078450045 11:11433936-11433958 CCAGAGTGGGAGGTGCAGCCAGG + Intronic
1081469731 11:43358924-43358946 CCGGTGTGAGCGGCCCGGCCGGG + Exonic
1083637828 11:64129820-64129842 GGGGAGTTGGAGGCTCAGCCAGG + Intronic
1083941715 11:65899767-65899789 CCAGGGTGGGAGTCCCGGCCCGG - Intronic
1084062714 11:66686660-66686682 CCGGAGCAGGAGGCCCGGGCTGG - Intronic
1084128609 11:67118004-67118026 CGGGCGCGGGAGGCCCGGCCGGG - Intergenic
1084737736 11:71116705-71116727 CCGGTGTTGGAGGCGGGGCCAGG + Intronic
1087075431 11:94123628-94123650 CAGGAATGGGAGGTTCTGCCTGG - Intergenic
1087318827 11:96635822-96635844 GCGGAGGGAGAGGCTCGGGCAGG + Intergenic
1089689912 11:120180818-120180840 TGGGAGTGGGAGGCTGGCCCTGG + Intronic
1091718439 12:2795612-2795634 GTGGCGTGGGAGGCCCGGCCTGG - Intronic
1093685185 12:22046575-22046597 CGAGAGTGGGCGGCGCGGCCTGG + Intronic
1095085081 12:38051553-38051575 CTGGAGTGGGTGGCTTGGGCAGG + Intergenic
1095773638 12:45990102-45990124 CCCGCGAGGGAGGCTCGGCCCGG - Intronic
1096123269 12:49102424-49102446 CTGGGGTGGTAGGCTTGGCCTGG - Intronic
1096465738 12:51847158-51847180 CCGGACTGAGAGGCTCGGGGAGG + Intergenic
1096475605 12:51907256-51907278 CGGATGTGGGAGGCCCGGCCCGG + Intronic
1099738399 12:86600673-86600695 CCAGTGAGGAAGGCTCGGCCAGG + Intronic
1101003643 12:100380772-100380794 GCAGAGTGGGGGGCTTGGCCTGG - Exonic
1101606053 12:106248154-106248176 CCGGAGAGGGAGGGCCGGGCGGG + Intronic
1103521004 12:121537131-121537153 GCGGGGTGGGAGGGGCGGCCAGG - Intronic
1103996665 12:124834414-124834436 CTGGAGTGGGAGGCTCTGCCCGG - Intronic
1107481620 13:40789988-40790010 CAGGAGTGGGCGGCTGGGCAGGG + Intronic
1108422525 13:50265699-50265721 CCGGTGTGGGAGGATCGGCTGGG - Intronic
1111232569 13:85363145-85363167 GTGGAGTGGGAGGCGCGGGCGGG + Intergenic
1112326290 13:98444587-98444609 GGGGAGCGGGAGGCTCGGCCCGG + Intronic
1113741537 13:112715380-112715402 CAGGTGTGGGGGGATCGGCCAGG - Intronic
1117867505 14:60165132-60165154 CCCGAGTGGGAGGCCGGGCTCGG - Intronic
1122076341 14:99237519-99237541 CAGGAGTGGGAGGTGGGGCCTGG - Intronic
1122120637 14:99551803-99551825 GGGGAGTGGGAGGCTGAGCCTGG - Intronic
1122873247 14:104650978-104651000 TGGGAGTGGGAGGGTGGGCCTGG + Intergenic
1123044132 14:105503219-105503241 CCGGGGTGGGAGGCAGGGCAGGG + Intergenic
1124432536 15:29619786-29619808 CAGGAGTGGGAGGATGAGCCTGG - Intergenic
1124628719 15:31325740-31325762 CCGGGCTGGGAGGCGCGGGCTGG + Intergenic
1128087875 15:64898235-64898257 CTGGGGTGGGAGGCTGTGCCTGG - Intronic
1128752073 15:70156854-70156876 CCTGTGTGGGAGGCTCGGGCTGG + Intergenic
1129462623 15:75707528-75707550 CAGGAGTGGGAAGCTGGGGCAGG + Intronic
1129722246 15:77883888-77883910 CAGGAGTGGGAAGCTGGGGCAGG - Intergenic
1131228220 15:90642539-90642561 CCGGAGTGGGAGGCTCGGCCTGG + Exonic
1132495021 16:258755-258777 CCGGAGGGGGCAGCTGGGCCCGG + Intronic
1132931312 16:2460460-2460482 CCGAAGTGGGCGGCTGCGCCCGG - Intronic
1135023858 16:18984195-18984217 CGGGTGCTGGAGGCTCGGCCTGG + Intronic
1135038233 16:19096322-19096344 AAGGAGTGGGAGGCTGGGCGCGG - Intergenic
1139319862 16:66105676-66105698 CCGAAGCAGGAGGCTCTGCCAGG + Intergenic
1139953309 16:70682036-70682058 CCTCAGAGGGAGGCTCTGCCTGG + Intronic
1140033845 16:71358584-71358606 GCGGCGCGAGAGGCTCGGCCCGG - Intergenic
1140103361 16:71937965-71937987 CTGCAGTGGGAGGCATGGCCGGG + Intronic
1141436583 16:84003043-84003065 CCGGAGTGGGGGGCCAGGCACGG + Intergenic
1142191374 16:88719764-88719786 CCGGGGTGGGGGTCACGGCCCGG - Intronic
1142267228 16:89070293-89070315 CCAGGGTGGGAGGGTCTGCCTGG + Intergenic
1143205824 17:5138862-5138884 CCGCAGTGGGTGACTGGGCCCGG - Intronic
1143491157 17:7285918-7285940 ACGGTGTGGGAGGCTGGGGCGGG - Intronic
1144570069 17:16391944-16391966 CTGGAGGGGGAGGCTCAGGCAGG - Intergenic
1145362221 17:22221706-22221728 CTGGAGGGGGAGGCTCAGGCAGG - Intergenic
1145792059 17:27633498-27633520 CCGAAGTGGGGAGCTCAGCCTGG - Intronic
1147985938 17:44308051-44308073 CAGGAGAGGTTGGCTCGGCCTGG + Intergenic
1148931656 17:51131969-51131991 CAGGAGTTGGAGACTCAGCCTGG + Intergenic
1149676896 17:58472810-58472832 CTAGAGTGGGAGGTTCAGCCTGG - Intronic
1150311034 17:64129823-64129845 CAGCCGTGGGAGGCTCGGGCCGG - Intronic
1150475400 17:65471010-65471032 CAGCTGTGGGAGGCTCTGCCTGG - Intergenic
1151434015 17:74083021-74083043 CAGGGGTGGGAGGATGGGCCTGG - Intergenic
1152585578 17:81188114-81188136 TCAGAGCTGGAGGCTCGGCCTGG - Intergenic
1153185482 18:2481483-2481505 CGGGAGTGGGAAGCTGGGACTGG + Intergenic
1153786189 18:8537400-8537422 CAGAAGTGGGAGCCTCCGCCTGG - Intergenic
1161161021 19:2761978-2762000 CAGGAGGGGGCGGCTCTGCCAGG - Intronic
1161169153 19:2804444-2804466 TCTGAGCGGGAGGCTCTGCCTGG + Intronic
1161337147 19:3720751-3720773 CCTGAGCGGGAGGCTGGGCTGGG + Intronic
1161474009 19:4474390-4474412 CGGGAGAGGGATGCTGGGCCTGG + Intronic
1161487523 19:4543911-4543933 TCGCCGTGGGAGGCGCGGCCGGG + Exonic
1162070393 19:8149232-8149254 CCGGCGGGAGGGGCTCGGCCGGG - Intronic
1162474624 19:10892536-10892558 CAGGAGAGGGAGGCCAGGCCGGG + Intronic
1162705510 19:12551880-12551902 TCGGAGTAGGAGGCGCGCCCAGG + Intronic
1162940441 19:14006047-14006069 CCGGGGTGGGCGGCGGGGCCGGG - Intronic
1163665902 19:18604038-18604060 ACAGAGTGGGAGGCACGGCCAGG + Intronic
1164498703 19:28793671-28793693 GCGGAGCGCGGGGCTCGGCCGGG - Intergenic
1164530388 19:29043959-29043981 CCAGTGTGGGAGGTTGGGCCTGG - Intergenic
1164543776 19:29142312-29142334 CTGCAGTGGCAGGCTCTGCCTGG + Intergenic
1164693772 19:30228538-30228560 CCGGACTGGGAGGCGCGGGATGG - Intronic
1164932638 19:32187125-32187147 CCTGAGTGGGAAGCTGAGCCTGG - Intergenic
1164950939 19:32336424-32336446 CAGGAGTTGGAGGCTCAGCTAGG + Intergenic
1165642628 19:37403178-37403200 CAGGGGTGGGAGGCTCCTCCTGG - Intergenic
1165796268 19:38521582-38521604 CCTGAGTGGGAGGCTGAGGCAGG + Intronic
1165895733 19:39139745-39139767 CCGGGGTGGGAGGCACTGCAGGG + Intronic
1166333006 19:42089528-42089550 CCGGAGGGGGCGGCTGGGGCAGG - Intronic
1166334831 19:42099526-42099548 CCTGTGTGGGAAGCCCGGCCCGG + Exonic
1166857948 19:45792548-45792570 CCGGAGGCGGAGGCAGGGCCGGG + Exonic
1166999865 19:46739361-46739383 CAAGAGTGGGTGGCTCGGCTCGG + Intronic
1167412520 19:49353387-49353409 TGGGAGTGGGAGGCCCGGCATGG - Intronic
1167738789 19:51311939-51311961 CGGGGGCGGGGGGCTCGGCCGGG + Intronic
1168417113 19:56176108-56176130 CCGGGGTGAGAGCCTAGGCCAGG + Intronic
1168417170 19:56176308-56176330 CCGGGGTGAGAGCCTAGGCCAGG + Intronic
1168417186 19:56176358-56176380 CCGGGGTGAGAGCCTAGGCCAGG + Intronic
1168417202 19:56176408-56176430 CCGGGGTGAGAGCCTAGGCCAGG + Intronic
1168417261 19:56176608-56176630 CCGGGGTGAGAGCCTAGGCCAGG + Intronic
927466438 2:23340301-23340323 CCAGACTGGGAGCCTCTGCCAGG - Intergenic
927477248 2:23423331-23423353 CTGGGGTGGGAGGCACGGCCTGG - Intronic
927717509 2:25362044-25362066 GCGAAGTGGGCGGCTCCGCCAGG + Intergenic
928001035 2:27523282-27523304 CCGGAATAGGAGGCTCAGCAAGG - Exonic
931513317 2:63024048-63024070 CCAAAGTGGGAGGATCAGCCAGG + Intronic
932201230 2:69829960-69829982 CCAGGGCGGGGGGCTCGGCCCGG + Exonic
932457205 2:71857421-71857443 CCTCAGTGGGAGGCTCGGCCAGG + Intergenic
934534454 2:95121671-95121693 CGGGAGTGGGGGGCTCGCCTGGG - Intronic
936024999 2:109024680-109024702 AGGTAGTGGGAGGCTTGGCCCGG + Intergenic
941160626 2:162030505-162030527 CTGGAGTGGGAAGCCTGGCCAGG - Intronic
943695893 2:190930264-190930286 CAGGAGTTGGAGGCTAGGCTGGG - Intronic
946112716 2:217434228-217434250 CTGGAGAGAGAGGCTCTGCCTGG + Intronic
946190037 2:218003191-218003213 CGGGGGTGGGGGGCACGGCCTGG - Intergenic
946300357 2:218820097-218820119 CAGGAGTTCGAGGCTCAGCCTGG - Intergenic
946386845 2:219388487-219388509 CCGGAGGCGGAGGCGCGGCCTGG - Intronic
946395469 2:219441972-219441994 GCGGAGTCGGAGGCGGGGCCGGG - Intronic
947748739 2:232522335-232522357 CCGGAGGGGGTGGCACGGCCGGG + Intronic
948844635 2:240677164-240677186 CCTGGGTGGGAGGCTGGGCCTGG + Intronic
948849225 2:240697715-240697737 CCTGGGTGGGAGGCTGGGCCTGG - Intronic
1169214618 20:3786012-3786034 CCGGACTGGCAGGCGCCGCCGGG + Exonic
1171123219 20:22582939-22582961 CGGGCATGGGCGGCTCGGCCGGG - Exonic
1171812554 20:29757005-29757027 CCGCAGTGGGAGACTTGGCTGGG + Intergenic
1172443787 20:34982673-34982695 CCAGGGTGGGAGGCTCAGGCAGG - Intronic
1173046907 20:39521346-39521368 CTGCTGTGGGAGGCTCAGCCTGG + Intergenic
1174562677 20:51442791-51442813 CCTGAGAGGGAGGCTGGGCATGG + Intronic
1175584461 20:60126935-60126957 CCTGAGTGGGACGCTCAGCGAGG + Intergenic
1175883034 20:62271421-62271443 ACGGCGTGGGTGGCTCTGCCTGG + Intronic
1175894241 20:62329087-62329109 CCGGGGTGGGGGTCTGGGCCGGG - Intronic
1176429090 21:6565050-6565072 ACGGGGAGGGAGACTCGGCCTGG + Intergenic
1178513790 21:33229809-33229831 CCGGAGGCGGAGGCCGGGCCGGG - Intergenic
1179704580 21:43173366-43173388 ACGGGGAGGGAGACTCGGCCTGG + Intergenic
1179812826 21:43883338-43883360 CCGGTGTCGGAGGCTCAGCGAGG - Intronic
1181631710 22:24155121-24155143 CTGGAGTGGGAGGAGCAGCCAGG + Intronic
1182421124 22:30249054-30249076 CAGGAGGGGGAGGCTGGGCCTGG - Intergenic
1182475547 22:30574663-30574685 CCGGCGCCGGAGGCTGGGCCAGG - Intergenic
1184515634 22:44960384-44960406 CAGGAGTGGGGGGCTTTGCCTGG - Intronic
1184649185 22:45911838-45911860 CTGGAGCGGGAGGCTCTGCGGGG + Intergenic
1184679336 22:46061834-46061856 CTGGAGTCGGAGCCTGGGCCCGG - Intronic
1184783002 22:46658431-46658453 CCTGAGTGTGAGGGTGGGCCCGG + Intronic
1184795122 22:46727819-46727841 CCGGGGGGGGTGGCTGGGCCAGG - Intronic
949927759 3:9055554-9055576 CAGGGGAGGGAGGCTGGGCCTGG + Intronic
950045801 3:9947870-9947892 CCGGAGGGGGAGGCTGGCCCAGG + Exonic
950676238 3:14555990-14556012 CAGGCGTGGGAGGCTGGGGCAGG - Intergenic
951139706 3:19146921-19146943 CCGGAGTGGGCGGCGCGGGGCGG - Intergenic
952881812 3:37990432-37990454 CCGGAGTGGTGGGCTCCGCCTGG - Intronic
958748432 3:98165382-98165404 CCGGGGAGGGAGGGTCGACCAGG - Intergenic
962927407 3:140007646-140007668 CGGCGGTGGGAGGCTCGGTCTGG + Intronic
965433621 3:168619998-168620020 CTGGATTGGGAGGCAAGGCCTGG - Intergenic
966762309 3:183428764-183428786 CCGGAGCGGGAGGCTGGGTGAGG + Intronic
966849435 3:184155566-184155588 GCCGTCTGGGAGGCTCGGCCCGG + Exonic
968611841 4:1560786-1560808 CTGGTGTGGGAGGCACAGCCAGG + Intergenic
968616689 4:1580660-1580682 CCTCAGTGGGAGGCGTGGCCTGG - Intergenic
968616738 4:1580790-1580812 CTTGAGTGGGAGGCGGGGCCTGG - Intergenic
979991392 4:127379809-127379831 CCGAAGTGGGAGCCTAGGCAGGG - Intergenic
982363516 4:154550094-154550116 CCCGAGTCGGAGGTTCAGCCTGG - Intronic
984462930 4:180058833-180058855 CCGGAGAGGGAGGCGCGGGGAGG + Intergenic
985554047 5:547427-547449 CCGGTGTGGGAGGGTTGTCCTGG - Intergenic
992565175 5:77988908-77988930 CCGGAGAGGGCGGCTGGGCATGG - Intergenic
997233011 5:132257542-132257564 CCGAAGTGGGAGGGTCGGGCTGG + Intronic
999461177 5:151758664-151758686 CCGGAGTGGGAGGGGCCTCCGGG - Exonic
1000133972 5:158326449-158326471 TAGGAGTGGGAGCCTGGGCCTGG - Intergenic
1002176567 5:177404295-177404317 CCGGGGTCGGAGGCGCCGCCTGG + Exonic
1002322534 5:178384290-178384312 CCGGCGACGGAGGCCCGGCCTGG + Intronic
1002895655 6:1378697-1378719 CCGGCGGGGGTGGCGCGGCCGGG + Intergenic
1003098170 6:3157855-3157877 CCAGAGTGGGCGGCTCGGGGTGG - Intergenic
1004562139 6:16761007-16761029 CCAGAGTGGGGGTGTCGGCCCGG + Intronic
1007159186 6:39775105-39775127 AGGGAGTGGGAGGCTGGGCAGGG + Intergenic
1007248955 6:40482749-40482771 CAGGAGGGGGAGGCAGGGCCTGG - Intronic
1017151296 6:151282657-151282679 CCGCAGTGAGGGGCTCTGCCTGG + Intronic
1017929371 6:158939039-158939061 CCAGAGTGGGAGCCACAGCCGGG - Intergenic
1018969731 6:168517919-168517941 CCGGAGCGCGAGCCTGGGCCGGG + Intronic
1019219283 6:170461976-170461998 GAGGAGTGGGAGGCTGGGCCGGG - Intergenic
1019575258 7:1734627-1734649 CCGGAGTGGGAGCCCAGGGCTGG - Intronic
1019771587 7:2886786-2886808 CCTGAGAGGGAGGGTCTGCCAGG + Intergenic
1025951079 7:66145946-66145968 CCGGCGTGGGAGGCCAGGCCAGG - Intronic
1026955138 7:74372279-74372301 CGGGAGTGGGAGGCACAGCCCGG + Intronic
1028087498 7:86654185-86654207 AGGGAGGGGGAGGCTCAGCCTGG + Intronic
1029123216 7:98281768-98281790 CCGGAGCGGCGGGCGCGGCCGGG + Exonic
1029479081 7:100802203-100802225 CTGGAGAGGGAGGCTGGGGCAGG - Intergenic
1032469785 7:132169955-132169977 AGGGAGTGGGAGGGACGGCCTGG + Intronic
1033756993 7:144403857-144403879 CCGGCCCGGGAGGCTCGGCTGGG + Intronic
1034383752 7:150720817-150720839 CAGGAGCTGGAGGCTGGGCCTGG + Exonic
1035126071 7:156608267-156608289 CCGCAGTGGGAGGAACGGCCTGG - Intergenic
1037865723 8:22440997-22441019 TCGGGGCGGGAGGCCCGGCCGGG + Intronic
1040915439 8:52563749-52563771 CTGGACTGAGAGGCTCTGCCCGG + Intronic
1041270059 8:56102963-56102985 CCAGAGTTGGAGGCAGGGCCTGG + Intergenic
1041472809 8:58230106-58230128 CCGGAGTTTGAGGCCCAGCCTGG + Intergenic
1044221226 8:89672438-89672460 CCGGTGTTGGAGGCGGGGCCTGG - Intergenic
1044857720 8:96493734-96493756 CCGGGGAGGGAGGCGCGGCGCGG + Exonic
1045782734 8:105886709-105886731 CTGCAGTGGGAGGTGCGGCCGGG + Intergenic
1049090601 8:140511253-140511275 CCCGAGTGCGAGGCCCGGCGCGG - Intergenic
1053153282 9:35756526-35756548 GCGGTGTGGGAGGCACGGCCTGG + Exonic
1057752202 9:97802299-97802321 CCAGAGTAAGAGGGTCGGCCTGG - Intergenic
1059403327 9:114084450-114084472 CAGGAGTGGGTGGCTTAGCCTGG + Intergenic
1061290713 9:129649105-129649127 CCGGAGTAGGGGGCTCTGGCCGG - Intergenic
1061420829 9:130472177-130472199 CCGGGGTGTGGGGCTGGGCCCGG - Intronic
1191184214 X:57592486-57592508 CCGGAGTGGGAACCGCGGACAGG - Exonic
1191213179 X:57909973-57909995 CCGGAGTGGGAACCGCGGACAGG + Exonic
1192240636 X:69324989-69325011 CAGGGGTGGGAGGCTGGGGCTGG - Intergenic
1192326225 X:70134431-70134453 ACGGAGTGGGAGGCTGGGCTGGG - Intronic