ID: 1131228221

View in Genome Browser
Species Human (GRCh38)
Location 15:90642540-90642562
Sequence CGGAGTGGGAGGCTCGGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228212_1131228221 -5 Left 1131228212 15:90642522-90642544 CCGCACCGAAGGCGGGCCCGGAG 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1131228221 15:90642540-90642562 CGGAGTGGGAGGCTCGGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1131228215_1131228221 -10 Left 1131228215 15:90642527-90642549 CCGAAGGCGGGCCCGGAGTGGGA 0: 1
1: 0
2: 1
3: 4
4: 88
Right 1131228221 15:90642540-90642562 CGGAGTGGGAGGCTCGGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1131228210_1131228221 -1 Left 1131228210 15:90642518-90642540 CCGTCCGCACCGAAGGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1131228221 15:90642540-90642562 CGGAGTGGGAGGCTCGGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1131228206_1131228221 9 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228221 15:90642540-90642562 CGGAGTGGGAGGCTCGGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228221 Original CRISPR CGGAGTGGGAGGCTCGGCCT GGG Exonic
900269074 1:1778085-1778107 CCCAGGGCGAGGCTCGGCCTTGG - Intronic
900423150 1:2564404-2564426 TGGGGTGGGTGGCTCAGCCTGGG - Intronic
901490623 1:9594667-9594689 CTGAGGGGGAGGCTGGGCCCTGG - Intronic
901494840 1:9614991-9615013 TGGAGTGGGGGGCTCGGGTTGGG + Intergenic
901672806 1:10866168-10866190 CGGGGTGGGGGGCTCGGGCTGGG + Intergenic
902350077 1:15847821-15847843 CGGAGCGCGAGGGTCGGCTTCGG + Intergenic
903349602 1:22710205-22710227 CCGAGTGGGAGACTGGGCCTTGG - Intergenic
903359829 1:22769914-22769936 CGAAGTGGGATGCTGGGCATAGG + Intronic
904267482 1:29326048-29326070 CTGAGTGGGAACCTTGGCCTGGG - Intronic
905237391 1:36559547-36559569 CGGAGGGGAAGGCCCTGCCTTGG + Intergenic
905647285 1:39633302-39633324 CGGAGTGGGAGGAGAGGCCGAGG - Intronic
906536239 1:46552361-46552383 GGGAGTGGGAGGCTGGGTCATGG + Intergenic
907102207 1:51847473-51847495 CGGGGTGGGAGGCTCAGGCACGG + Intronic
911220507 1:95240627-95240649 CAGAGTGGTAGGCTGGCCCTAGG + Intronic
911259568 1:95669724-95669746 GGGGGTGGGAGGCTCAGGCTTGG + Intergenic
911517976 1:98891574-98891596 CTGAGTGGGAGGCTGGGACCTGG + Exonic
911664657 1:100539312-100539334 CGGGGTGGGCTGCTGGGCCTCGG + Exonic
912387959 1:109281938-109281960 CAGGGTGTGAGGCTCAGCCTAGG - Exonic
912471640 1:109910934-109910956 CGGAGTGGGCGCCCCGGCCGAGG - Exonic
912967942 1:114252759-114252781 CTGAGTGGGAGGCTCTTCTTTGG - Intergenic
914674776 1:149900063-149900085 CTGAGTGGGCGGCTGGTCCTGGG + Exonic
917524555 1:175775389-175775411 AGGAGTTGGAAGCTGGGCCTTGG + Intergenic
919201321 1:194358366-194358388 CGGGGTGGGAGGCTCAGGCATGG + Intergenic
919977021 1:202619358-202619380 CGGAGAGGGAGGCTGGGGGTGGG + Intronic
921230245 1:213062987-213063009 CAGACTGTGAGGCTTGGCCTAGG - Intronic
922801903 1:228368286-228368308 TGGAGAGGGAGGCTGGGGCTGGG + Intronic
924835055 1:247639437-247639459 CGGAGTGGGAGGAGCGGGCCTGG + Intergenic
1063537149 10:6894391-6894413 CGGAGTGACAGCCTCTGCCTGGG - Intergenic
1063790299 10:9437291-9437313 CGGAGGTGAAGGCTTGGCCTGGG + Intergenic
1063998442 10:11642713-11642735 CGGAGTGGAAGACTCAGCCGGGG - Intergenic
1065797973 10:29324377-29324399 GGGTGTGGGAGTCTCGGCCAAGG - Intergenic
1066449069 10:35511551-35511573 CAGAGAGGGAGGCACGGACTTGG + Intronic
1067037475 10:42931005-42931027 TGGAGTGGGCGGCTAGGACTAGG - Intergenic
1067068993 10:43119071-43119093 TAGAGTTGGAGGCTGGGCCTGGG + Intronic
1067929100 10:50541685-50541707 CAGAGTGGGTGGCTCAGCCAGGG - Intronic
1069036754 10:63653723-63653745 CTGATTGGGAGGCTCACCCTTGG + Intergenic
1072691206 10:97573224-97573246 CTGAGTGGGAGGCTGGGGCAGGG + Intronic
1072891645 10:99329843-99329865 GGGCGTGGCAGGCTCGGCCCTGG + Exonic
1076395914 10:130136971-130136993 GGGAGCGGCAGGCTCGGCGTCGG + Intronic
1076727478 10:132420305-132420327 CGCAGTGGGTGGCGTGGCCTGGG + Intergenic
1076905394 10:133358394-133358416 CGGGGTGGGAGGCTCGGGTAGGG - Intergenic
1077026541 11:442352-442374 CGGGGTGGGGGGCATGGCCTGGG - Intergenic
1077392909 11:2308249-2308271 CTGAGAGGGAGACTTGGCCTGGG - Intronic
1078551936 11:12287183-12287205 GGGGGTGGGAGGCTGGGGCTGGG + Intronic
1081329679 11:41788321-41788343 GGGGGTGGGAGGCTCGGGCATGG + Intergenic
1083291971 11:61695541-61695563 CGGGGTGGGAGGCTCAGACCAGG - Intronic
1083943607 11:65911855-65911877 CGGAAAGGGAGGCTCTGACTCGG + Intergenic
1084062713 11:66686659-66686681 CGGAGCAGGAGGCCCGGGCTGGG - Intronic
1084335900 11:68457725-68457747 CTGAGAGGGAGGCTGGGCCATGG - Intergenic
1084726588 11:70946184-70946206 CGGAGAGGGAGGTTGAGCCTGGG - Intronic
1084726791 11:70946986-70947008 CGGAGAGGGAGGTTGAGCCTGGG - Intronic
1084889471 11:72229604-72229626 CTGGGTGGGAGGCTCTGCTTAGG + Intronic
1085769018 11:79308737-79308759 CAGAGTGGGTGGCATGGCCTGGG - Intronic
1089689913 11:120180819-120180841 GGGAGTGGGAGGCTGGCCCTGGG + Intronic
1091788928 12:3260126-3260148 CGGAGTGGGCAGCCCTGCCTGGG - Intronic
1093685186 12:22046576-22046598 GAGAGTGGGCGGCGCGGCCTGGG + Intronic
1095642409 12:44500655-44500677 GGTGGTGGGAGGCTCGGCCATGG - Intergenic
1096123268 12:49102423-49102445 TGGGGTGGTAGGCTTGGCCTGGG - Intronic
1096230148 12:49892236-49892258 GGGGGTGGGAGGATTGGCCTGGG - Intronic
1096233383 12:49909933-49909955 CGGAGTGGGAGGGACTGCCATGG - Intergenic
1099300859 12:80892756-80892778 CAGAGTGGGGGGCTGGGCATGGG + Intronic
1101447543 12:104748145-104748167 GGGAGTTGGAGGCTGGGGCTGGG + Intronic
1102636434 12:114328419-114328441 CAGAGTGGGAGGCTTGGCTGAGG - Intergenic
1104320895 12:127749826-127749848 AGGGGAGGGAGGCTGGGCCTTGG - Intergenic
1106208430 13:27620597-27620619 CGGGTTGGGCCGCTCGGCCTTGG - Intergenic
1106314847 13:28584213-28584235 CGGAGAAGAAGACTCGGCCTCGG + Intergenic
1106469113 13:30039003-30039025 CAGACAGGGAGGCTCAGCCTTGG + Intergenic
1113894999 13:113758956-113758978 CGGGGTCGGAGCCCCGGCCTGGG - Intergenic
1116629534 14:47312330-47312352 CAGAGTGTGAGGCTCAGCCCTGG - Intronic
1118836999 14:69484704-69484726 CGGGGAGGGTGGCTCAGCCTCGG - Intronic
1119639603 14:76304881-76304903 GGGAGAGGGAGTCTGGGCCTGGG + Intergenic
1121443994 14:93967215-93967237 AGGAGTGGGAAGCCAGGCCTGGG - Intronic
1122076340 14:99237518-99237540 AGGAGTGGGAGGTGGGGCCTGGG - Intronic
1122119743 14:99545917-99545939 CGGAGTTGGAGGCTGGGAGTTGG - Intronic
1122234754 14:100325311-100325333 AGGAGGGGGAGGCACAGCCTGGG - Intronic
1122257549 14:100490110-100490132 GGGAGTGGGTGGCTCACCCTTGG + Intronic
1122658716 14:103279787-103279809 CGGGGAGGGAGGCTAGGACTGGG + Intergenic
1122829562 14:104389170-104389192 CGGAAAGGGAGGCTGGGCCCCGG + Intergenic
1122873248 14:104650979-104651001 GGGAGTGGGAGGGTGGGCCTGGG + Intergenic
1122982197 14:105196883-105196905 GGGAGTGGGAGGCTCAGCTGCGG + Intergenic
1124114823 15:26831275-26831297 CGGGGTGGGAGGCTCGGGCATGG + Intronic
1124628720 15:31325741-31325763 CGGGCTGGGAGGCGCGGGCTGGG + Intergenic
1125612104 15:40978565-40978587 AGGTGTGGGCGGCTTGGCCTAGG - Intergenic
1126143541 15:45456345-45456367 CTGAGTGGGAGGGGCTGCCTGGG - Intergenic
1128087874 15:64898234-64898256 TGGGGTGGGAGGCTGTGCCTGGG - Intronic
1131094816 15:89648503-89648525 CGGAGGCGGTGGCTGGGCCTGGG + Exonic
1131181257 15:90241526-90241548 CAGCCTGGGAGGCTTGGCCTCGG + Exonic
1131228221 15:90642540-90642562 CGGAGTGGGAGGCTCGGCCTGGG + Exonic
1132209354 15:100008534-100008556 CTGAGGGGAAGGCTTGGCCTTGG + Intronic
1133279500 16:4657173-4657195 CGGAGTGGGAGGGACGGGCACGG + Intronic
1135015995 16:18925855-18925877 GGGGCTGGGAGGCGCGGCCTAGG - Intronic
1135321616 16:21501682-21501704 GGGGCTGGGAGGCGCGGCCTAGG - Intergenic
1135751031 16:25059006-25059028 GGGAGTGGGAGGCTCAGGCATGG + Intergenic
1136333091 16:29594792-29594814 GGGGCTGGGAGGCGCGGCCTAGG - Intergenic
1136447787 16:30334880-30334902 GGGGCTGGGAGGCGCGGCCTAGG - Intergenic
1136515549 16:30766137-30766159 AGGAGTGGGAGGCAGGGCCATGG - Intronic
1139467115 16:67159931-67159953 CGGACGGGGCGGCTCGGGCTAGG - Exonic
1139849064 16:69939941-69939963 GGGCGTGGGAGGGGCGGCCTCGG - Exonic
1142156492 16:88534777-88534799 CGGCGGGGGCGGCACGGCCTCGG - Exonic
1142259667 16:89036783-89036805 CGGAGTCTGAGGCTCTGGCTGGG - Intergenic
1142267229 16:89070294-89070316 CAGGGTGGGAGGGTCTGCCTGGG + Intergenic
1143479158 17:7218769-7218791 CGAAGTGGGGGGCTGGGGCTCGG - Intronic
1143491156 17:7285917-7285939 CGGTGTGGGAGGCTGGGGCGGGG - Intronic
1143726222 17:8848706-8848728 TGGGGTGGGAGGCTCGGAATGGG - Intronic
1146382614 17:32342061-32342083 CGAAGAGGGAGGCTCAGCCGAGG - Exonic
1147786270 17:42980710-42980732 CGGTGGCGGAGGCCCGGCCTGGG + Exonic
1148215064 17:45829863-45829885 TGGAGTGCCAGGCTCTGCCTGGG + Intronic
1148770089 17:50061490-50061512 CTCAGTGGGAGGCCGGGCCTTGG - Intronic
1149676895 17:58472809-58472831 TAGAGTGGGAGGTTCAGCCTGGG - Intronic
1152744375 17:82032137-82032159 CGGAGTCGGGGCCTCTGCCTGGG + Intronic
1152837734 17:82545242-82545264 AGGAGTGGGAGGCCCTGGCTGGG - Intronic
1160498351 18:79388207-79388229 ATGGGTGGGAGGCTGGGCCTTGG + Intergenic
1161169154 19:2804445-2804467 CTGAGCGGGAGGCTCTGCCTGGG + Intronic
1161230355 19:3171954-3171976 CAGAGTGGGGGGCTGGTCCTGGG + Intergenic
1161230381 19:3172072-3172094 CAGAGTGGGGGGCTGGGCCTAGG + Intergenic
1161318949 19:3632288-3632310 CAGAGCGGGAGGCCGGGCCTTGG - Exonic
1161620135 19:5293261-5293283 CGGCCTGGGGAGCTCGGCCTGGG + Intronic
1161963413 19:7535071-7535093 CGGAGTAGGGGGTGCGGCCTGGG + Intronic
1162718084 19:12646578-12646600 CGGAGCAGGAGGCTTGGGCTTGG + Exonic
1163743852 19:19033376-19033398 CGGGGTGGGAAGCTCGGGCTCGG - Intronic
1164543777 19:29142313-29142335 TGCAGTGGCAGGCTCTGCCTGGG + Intergenic
1164932637 19:32187124-32187146 CTGAGTGGGAAGCTGAGCCTGGG - Intergenic
1165003936 19:32788907-32788929 CTGAGTGGGAGGCACAGGCTGGG + Intronic
1165642627 19:37403177-37403199 AGGGGTGGGAGGCTCCTCCTGGG - Intergenic
1165912252 19:39236719-39236741 CGGTGTGTGAGGCGGGGCCTGGG + Intergenic
1167362954 19:49039955-49039977 CGGGGTGGGGGGCGCGGCTTGGG + Intergenic
1167423060 19:49415072-49415094 TGGAGTGTGAGGCTGGGGCTTGG - Intronic
1167455680 19:49595877-49595899 GGGAGTGGGCGGCTGGCCCTGGG - Exonic
1167638600 19:50668408-50668430 CTGGGTGGGGGGCTCCGCCTCGG + Exonic
927477247 2:23423330-23423352 TGGGGTGGGAGGCACGGCCTGGG - Intronic
927809988 2:26175391-26175413 AGGAGTGGGAGGCCCAGCCCTGG - Intronic
929593170 2:43159940-43159962 GAGAGTGGGTGGCTGGGCCTGGG + Intergenic
933813993 2:86051492-86051514 CAGAGTGGGAGTCTCAGCGTAGG - Intronic
937181170 2:119997250-119997272 CGGGGTGGGAGGCTCAGGCATGG - Intergenic
938364960 2:130727318-130727340 AGCAGAGAGAGGCTCGGCCTTGG + Intergenic
942003253 2:171672104-171672126 CGAGGTGGGAGGATCAGCCTGGG - Intergenic
943189883 2:184663063-184663085 CAGAGTGGGAGGCATGGCCAAGG + Intronic
946190036 2:218003190-218003212 GGGGGTGGGGGGCACGGCCTGGG - Intergenic
946300356 2:218820096-218820118 AGGAGTTCGAGGCTCAGCCTGGG - Intergenic
946395468 2:219441971-219441993 CGGAGTCGGAGGCGGGGCCGGGG - Intronic
946401176 2:219469105-219469127 TGGGGTGGGAGGCACGGCCCTGG + Intronic
946467115 2:219921700-219921722 CGGAGTGGGAAGATGGGTCTGGG + Intergenic
948560162 2:238847068-238847090 TGGAGTGTGGGGCCCGGCCTCGG - Intergenic
1170383938 20:15795457-15795479 GGGAGTGGGAGGGTAGGCCATGG + Intronic
1173046908 20:39521347-39521369 TGCTGTGGGAGGCTCAGCCTGGG + Intergenic
1173166365 20:40689450-40689472 CGGAGTGGGACGGCCAGCCTGGG + Intergenic
1173849219 20:46207366-46207388 CGGAGCGGGAGGCGAGTCCTTGG - Intronic
1174549814 20:51354299-51354321 GGGTGTGGGAGGCAGGGCCTGGG - Intergenic
1175883035 20:62271422-62271444 CGGCGTGGGTGGCTCTGCCTGGG + Intronic
1176429091 21:6565051-6565073 CGGGGAGGGAGACTCGGCCTGGG + Intergenic
1179616733 21:42587832-42587854 CGGGGCGGGAGGCTCGGTGTAGG - Intergenic
1179704581 21:43173367-43173389 CGGGGAGGGAGACTCGGCCTGGG + Intergenic
1180096384 21:45557165-45557187 CGGAGCTGGAGGCTGGGCCCTGG + Intergenic
1181440082 22:22931249-22931271 CTGAGTGGGAGGCTCCCCTTTGG - Intergenic
1181522470 22:23457542-23457564 CGCATTGGGAGGCTCCACCTCGG - Intergenic
1182421123 22:30249053-30249075 AGGAGGGGGAGGCTGGGCCTGGG - Intergenic
1183406484 22:37632905-37632927 CCCAGTAGGAGGCTGGGCCTGGG + Exonic
1184492117 22:44815750-44815772 AGGCCTGGGAGGCTCTGCCTGGG + Intronic
950045802 3:9947871-9947893 CGGAGGGGGAGGCTGGCCCAGGG + Exonic
952730673 3:36634172-36634194 CGGGGTGGGAGGCTCAGGCATGG - Intergenic
953002921 3:38951416-38951438 GGGAGTGGGAGGCTCAGGCATGG - Intergenic
953235625 3:41103731-41103753 CGGAGTGAGAGGCAGAGCCTAGG + Intergenic
953399500 3:42600657-42600679 GGCATTGGGAGGCCCGGCCTGGG + Exonic
954701087 3:52451229-52451251 TGGAGTTGGAGGCTGGGCATAGG + Exonic
963862203 3:150323233-150323255 GGGAGTGGGAGGCTCAGGCATGG - Intergenic
966291197 3:178361394-178361416 CGATGTGGGATGCTCGACCTTGG + Intergenic
967915923 3:194578169-194578191 CGGGGTGGGAAGCAAGGCCTAGG - Intergenic
968616688 4:1580659-1580681 CTCAGTGGGAGGCGTGGCCTGGG - Intergenic
968616737 4:1580789-1580811 TTGAGTGGGAGGCGGGGCCTGGG - Intergenic
968665251 4:1817856-1817878 GGGAGTGGGAGGCTGGGAGTTGG - Intronic
968831322 4:2934219-2934241 GGGCGTGGGAGGCGCGGCCGTGG - Exonic
973319734 4:48797822-48797844 AGGAGTTCGAGGCTCAGCCTCGG - Intergenic
978999547 4:115200289-115200311 GGGGGTGGGAGGCTCAGCCATGG + Intergenic
981146690 4:141333113-141333135 GGGAGTGGGAGGCTCAGGCATGG + Intergenic
982180977 4:152748393-152748415 CGGCTGGGGAGGCACGGCCTAGG + Intronic
982363514 4:154550093-154550115 CCGAGTCGGAGGTTCAGCCTGGG - Intronic
982921297 4:161277494-161277516 AGGAGGGGGAGGCTCGGGCATGG - Intergenic
983026131 4:162739806-162739828 AGGAGTGGGAGGCTCAGGCATGG - Intergenic
983290642 4:165799493-165799515 CGGGGTGGGAGGCTCAGGCATGG + Intergenic
985534038 5:453111-453133 CGGGGTGGGAGGTGGGGCCTCGG + Intronic
985554046 5:547426-547448 CGGTGTGGGAGGGTTGTCCTGGG - Intergenic
987283762 5:16436447-16436469 GGGAGTGGGAGGCTCAGGCATGG - Intergenic
989023233 5:37035176-37035198 CTGTGTGGGAGGCTGAGCCTGGG + Intronic
989275031 5:39578643-39578665 GGGAGGGGGAGGCTTGGCTTGGG + Intergenic
989751120 5:44895290-44895312 CAGAGAGGGAGACTCGGTCTGGG - Intergenic
990490098 5:56295590-56295612 GGGAGTGGGAGGCTCAGGCATGG - Intergenic
996234251 5:121107443-121107465 GGGAGTGGGAGGCTCAGGCATGG - Intergenic
1000133971 5:158326448-158326470 AGGAGTGGGAGCCTGGGCCTGGG - Intergenic
1001382276 5:171312427-171312449 GGGAGTGAAAGGCTGGGCCTGGG + Intergenic
1002176568 5:177404296-177404318 CGGGGTCGGAGGCGCCGCCTGGG + Exonic
1003098169 6:3157854-3157876 CAGAGTGGGCGGCTCGGGGTGGG - Intergenic
1003107533 6:3227719-3227741 GGGACTGGGGGGCTCGGGCTGGG - Exonic
1003495572 6:6660638-6660660 CAGAGTGGGAGGAATGGCCTGGG + Intergenic
1004001152 6:11598469-11598491 GGGACTGGGAGGGTGGGCCTGGG - Intergenic
1004259465 6:14095669-14095691 AGCATTGGGAGGCTCGTCCTCGG + Intergenic
1006505486 6:34486189-34486211 GGGAGAGGGAGGCAGGGCCTAGG + Intronic
1006696039 6:35931536-35931558 CGGGGTGGGAGGCTCAGGCATGG - Intergenic
1006806779 6:36793981-36794003 AGGAGGGGGAGGCTCTGCGTTGG + Intronic
1007248954 6:40482748-40482770 AGGAGGGGGAGGCAGGGCCTGGG - Intronic
1009905496 6:69866496-69866518 CGGAGTGGGAGGGTCACACTGGG + Intergenic
1010519579 6:76817420-76817442 CAGTGGGGGAGGCTCTGCCTGGG + Intergenic
1017151297 6:151282658-151282680 CGCAGTGAGGGGCTCTGCCTGGG + Intronic
1018746217 6:166764332-166764354 AAGAGTGGGAGGCTCTGCCCAGG + Intronic
1019575257 7:1734626-1734648 CGGAGTGGGAGCCCAGGGCTGGG - Intronic
1019686397 7:2384374-2384396 AGGACTGGGAGGCAAGGCCTTGG + Intergenic
1019743696 7:2688213-2688235 CAGCGTGGGCAGCTCGGCCTGGG - Intronic
1019829429 7:3311931-3311953 AGGAGTAGGAGGCATGGCCTTGG + Intronic
1023174847 7:37425866-37425888 TGGAGTGGGGGACTCTGCCTAGG - Intronic
1028087499 7:86654186-86654208 GGGAGGGGGAGGCTCAGCCTGGG + Intronic
1029111458 7:98214867-98214889 AGGACTGGGCGGCTCGGCCCAGG - Exonic
1029448366 7:100627210-100627232 GGGAGTGGGAGGCACTGCCCAGG - Intronic
1032469786 7:132169956-132169978 GGGAGTGGGAGGGACGGCCTGGG + Intronic
1033554283 7:142474830-142474852 CGGAGTGGGTGTCTTAGCCTTGG + Intergenic
1038494601 8:27992500-27992522 CAGAGTGGGGGTCTGGGCCTGGG + Exonic
1040076982 8:43246705-43246727 CGGGGCGGGAGGCACGGCCTAGG + Intergenic
1041534370 8:58909529-58909551 AGGTGTGGGAGGTTAGGCCTAGG - Intronic
1043640187 8:82441642-82441664 CGGAGGGGGAGGCTCAGGCATGG - Intergenic
1046208860 8:111040932-111040954 GGGGGTGGGAGGCTCGGGCATGG + Intergenic
1047179212 8:122571245-122571267 TGGAGTGTGAGGCTCAGCCATGG - Intergenic
1049191469 8:141290324-141290346 CTGAGTGGGAGGGCCGGGCTTGG - Intronic
1051364240 9:16309798-16309820 CAGAGTTGGAGCCGCGGCCTGGG - Intergenic
1053153283 9:35756527-35756549 CGGTGTGGGAGGCACGGCCTGGG + Exonic
1053436115 9:38075589-38075611 CGCAGGGGGAGGCTCAGCCATGG - Intergenic
1053752372 9:41269399-41269421 GTGGGTGGGAGGCACGGCCTGGG - Intergenic
1054257900 9:62833731-62833753 GTGGGTGGGAGGCACGGCCTGGG - Intergenic
1057118194 9:92545514-92545536 CGGGGCGGGAGGCTCAGTCTTGG - Intronic
1057752201 9:97802298-97802320 CAGAGTAAGAGGGTCGGCCTGGG - Intergenic
1058598912 9:106647602-106647624 TGGAGTGGGAGAGTGGGCCTAGG - Intergenic
1061740244 9:132698353-132698375 AAAAGTGGGAGGCTCAGCCTGGG - Intergenic
1189145986 X:38655225-38655247 GGGAGATGGAGGCTTGGCCTAGG + Intronic
1189289645 X:39876091-39876113 GGGAGTGGGAGGCTGGGGGTGGG - Intergenic
1190106923 X:47567457-47567479 GGGGGTGGCAGGCCCGGCCTTGG + Intronic
1194836286 X:98687201-98687223 AGGAGTGGGGGGCTAGGCGTTGG - Intergenic
1198186189 X:134256199-134256221 CAGAGAGGGAGGCTAAGCCTGGG - Intergenic
1198694476 X:139321067-139321089 CGGAGGGGGAGGCTCAGGCATGG - Intergenic