ID: 1131228222

View in Genome Browser
Species Human (GRCh38)
Location 15:90642541-90642563
Sequence GGAGTGGGAGGCTCGGCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 383}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228215_1131228222 -9 Left 1131228215 15:90642527-90642549 CCGAAGGCGGGCCCGGAGTGGGA 0: 1
1: 0
2: 1
3: 4
4: 88
Right 1131228222 15:90642541-90642563 GGAGTGGGAGGCTCGGCCTGGGG 0: 1
1: 0
2: 6
3: 37
4: 383
1131228212_1131228222 -4 Left 1131228212 15:90642522-90642544 CCGCACCGAAGGCGGGCCCGGAG 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1131228222 15:90642541-90642563 GGAGTGGGAGGCTCGGCCTGGGG 0: 1
1: 0
2: 6
3: 37
4: 383
1131228210_1131228222 0 Left 1131228210 15:90642518-90642540 CCGTCCGCACCGAAGGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1131228222 15:90642541-90642563 GGAGTGGGAGGCTCGGCCTGGGG 0: 1
1: 0
2: 6
3: 37
4: 383
1131228206_1131228222 10 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228222 15:90642541-90642563 GGAGTGGGAGGCTCGGCCTGGGG 0: 1
1: 0
2: 6
3: 37
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228222 Original CRISPR GGAGTGGGAGGCTCGGCCTG GGG Exonic
900148150 1:1167233-1167255 GGAGTGTGGGGCTCGGCGGGAGG - Intergenic
900154578 1:1198814-1198836 GGAGTCGGAGGCAGGGCATGTGG - Intergenic
900294813 1:1943533-1943555 GGACGGCGAGGCTGGGCCTGCGG - Intronic
900357713 1:2272819-2272841 GGAGGGGGAGGCTCGGGGCGTGG - Intronic
900417491 1:2541856-2541878 ATCGTGGGAGGCTCTGCCTGGGG - Intergenic
900423149 1:2564403-2564425 GGGGTGGGTGGCTCAGCCTGGGG - Intronic
900676940 1:3893081-3893103 GGAGTGGGAGGGGCGGTCTTCGG - Intronic
900705225 1:4076295-4076317 GAGGTGGGAGGCTGGGACTGTGG + Intergenic
900911797 1:5601813-5601835 GGTGTGGGAGACGCGGCATGGGG + Intergenic
900911816 1:5601874-5601896 GGTGTGGGAGACGCGGCATGGGG + Intergenic
901236407 1:7669802-7669824 GTAGAGGGAGGCTCTCCCTGGGG - Intronic
901331048 1:8408825-8408847 GGAGGTGGAGGCTGGGCTTGGGG + Intronic
901494841 1:9614992-9615014 GGAGTGGGGGGCTCGGGTTGGGG + Intergenic
902334389 1:15746770-15746792 GGAGGGGAAGGCTCATCCTGTGG + Intronic
902612163 1:17603632-17603654 GGGGAGGGAGGCTGGGACTGGGG + Intronic
902768047 1:18630083-18630105 GGAGTTATAGGCCCGGCCTGGGG + Intergenic
903066456 1:20702406-20702428 AGTGGGGGAGGCTCGGCCCGCGG - Intronic
903959109 1:27045424-27045446 GGAGGGTGAGGCTGGGTCTGGGG + Intergenic
904165746 1:28553586-28553608 GGAGTGGGAAGCCCGGCCGCCGG + Intronic
904210976 1:28886998-28887020 GGAGGGGGAGGCCCGGGCAGAGG - Intergenic
904782981 1:32964510-32964532 GGGGGCGGCGGCTCGGCCTGCGG + Exonic
905296226 1:36956087-36956109 GCCGTGGGGTGCTCGGCCTGGGG + Intronic
906164799 1:43678237-43678259 GGGGTGGGAGGGTTGGTCTGTGG + Intronic
907251816 1:53144481-53144503 GTAGTGGTAGGCTCAGCCTGTGG - Intergenic
907414544 1:54305095-54305117 GGCGTGGGAGGCCAGGCCAGGGG + Intronic
907425398 1:54376098-54376120 GGAGTGGATGGCTGGGCTTGGGG - Intronic
908977805 1:69919889-69919911 GGAGTGGGGGGTTCGGCCACTGG - Intronic
909600631 1:77457791-77457813 GGAGTAGGAGGCTCAGCCAGTGG + Intronic
910301024 1:85707966-85707988 GGAGGTGGAGGATAGGCCTGAGG - Exonic
910351093 1:86298497-86298519 GTAGTGGGAGGTTGGGCCGGGGG - Intergenic
910367599 1:86483267-86483289 GGTGTGGAAGCCTCTGCCTGGGG + Intronic
912178182 1:107186017-107186039 AGAGTGGGAGGGTGGGCGTGAGG - Intronic
912798610 1:112707184-112707206 GCAGGGGGAGGGTCGGCCGGGGG + Intronic
913133457 1:115863962-115863984 GGAGTGGGAGTCTGTGGCTGGGG + Intergenic
914196180 1:145449136-145449158 GGAGTGAGAGGCTGGGGCAGCGG + Intergenic
915277838 1:154801813-154801835 GGAGTGAAAGACTCGGCCTCCGG + Intronic
916674593 1:167054788-167054810 GGACTGGGAGGCAGGTCCTGGGG + Intronic
916882669 1:169035174-169035196 GGGCTGGGAGGCTCTGCCTTAGG - Intergenic
918244447 1:182646608-182646630 GGGGTGGGAGGCTGGGGGTGAGG - Intronic
919833788 1:201559977-201559999 GGGGTGAGAGGCTCAGGCTGGGG + Intergenic
919977022 1:202619359-202619381 GGAGAGGGAGGCTGGGGGTGGGG + Intronic
920384900 1:205564185-205564207 GGATTGGAAGGCTCTGTCTGAGG - Intergenic
921287804 1:213624650-213624672 GTAGTGGGTGGCTGGGCCTATGG - Intergenic
921924461 1:220699904-220699926 CAAGTGGGAGGCTGGGCCAGAGG + Intergenic
1062901124 10:1147733-1147755 GGGGTGGGACGCTGGGCCTGTGG + Intergenic
1063053193 10:2475585-2475607 GGGGTGGGAGGATCAGTCTGTGG + Intergenic
1063087798 10:2835449-2835471 GGAGTGGCTGGCTAGCCCTGGGG - Intergenic
1063267961 10:4475180-4475202 AGAATGGGAGTCTCAGCCTGTGG - Intergenic
1063462928 10:6225807-6225829 GGAGGGAGAGGCTGGGCCTGAGG - Intronic
1064061158 10:12138540-12138562 TGAGTGGTAGCCTGGGCCTGTGG - Intronic
1067209150 10:44244036-44244058 GCAGTGGGAGGAGAGGCCTGAGG - Intergenic
1067300268 10:45001220-45001242 GGAACGGGAGGCTTGGACTGGGG + Intronic
1067929099 10:50541684-50541706 AGAGTGGGTGGCTCAGCCAGGGG - Intronic
1070282723 10:75061681-75061703 GGGGTGGGAGGCCCGGTCTTTGG + Intergenic
1070572565 10:77651136-77651158 GGGATGGGAGGCACTGCCTGGGG - Intergenic
1072691207 10:97573225-97573247 TGAGTGGGAGGCTGGGGCAGGGG + Intronic
1073928564 10:108546194-108546216 GGAGTGGGAGGCTGGGGAGGCGG + Intergenic
1074081106 10:110168824-110168846 GGTGTGGGAGGCATGGCCTTAGG - Intergenic
1074314245 10:112347278-112347300 GGAGAGAGAGGGTCCGCCTGTGG - Intergenic
1074405451 10:113177051-113177073 GGAGGTGGAGGCTCGGCCTTTGG + Intergenic
1074618583 10:115093804-115093826 GGTGTGGAGGGCTCGGCCGGCGG + Exonic
1074853657 10:117457896-117457918 GGGGTGGGGGGCCAGGCCTGGGG - Intergenic
1076727479 10:132420306-132420328 GCAGTGGGTGGCGTGGCCTGGGG + Intergenic
1076897494 10:133320059-133320081 GGAGTGGGGGGTGGGGCCTGAGG - Intronic
1077026540 11:442351-442373 GGGGTGGGGGGCATGGCCTGGGG - Intergenic
1077131215 11:973685-973707 GGAGAGGGAGGGTGGGGCTGGGG + Intronic
1077210874 11:1370444-1370466 GCAGTCGGGAGCTCGGCCTGGGG + Intergenic
1077392908 11:2308248-2308270 TGAGAGGGAGACTTGGCCTGGGG - Intronic
1077888649 11:6403677-6403699 TGAGGGGGAGGCCCGGCCGGGGG + Exonic
1077922951 11:6655423-6655445 GGAGGGGGGGCCTGGGCCTGCGG - Intronic
1078730735 11:13971699-13971721 TGTGTGGGAGGCTGGGGCTGGGG - Intronic
1080685769 11:34513607-34513629 GGGCTCAGAGGCTCGGCCTGGGG - Intronic
1083638968 11:64135270-64135292 CTAGTGGGAGGGCCGGCCTGAGG - Intronic
1083827355 11:65211171-65211193 GGAGTTGGGGGCTGGACCTGGGG + Intronic
1084004112 11:66314269-66314291 GCAGTGGGAGGTTTGGCATGGGG - Intergenic
1084062712 11:66686658-66686680 GGAGCAGGAGGCCCGGGCTGGGG - Intronic
1084332511 11:68438295-68438317 GAGCTGGGAGGCTAGGCCTGGGG - Intronic
1084409223 11:68996863-68996885 GCAGTGGGAAGCCGGGCCTGAGG + Intergenic
1084726769 11:70946912-70946934 GGAGAGGGAGGGTGAGCCTGGGG - Intronic
1084726779 11:70946949-70946971 GGAGAGGGAGGGTGAGCCTGGGG - Intronic
1085535349 11:77214063-77214085 GTAGTGTGCGGCTGGGCCTGGGG + Intronic
1089111815 11:116063214-116063236 GGACTGAGAGCCTGGGCCTGGGG + Intergenic
1089598356 11:119597311-119597333 GGAGTGGTTGCCTCTGCCTGGGG + Intergenic
1090017659 11:123100576-123100598 GGAAAGGGAGGCGCCGCCTGGGG - Intronic
1091224003 11:133946889-133946911 GGAGAGGCCGGCTCAGCCTGCGG - Intronic
1091381800 12:66759-66781 GGGGAGGGAGGCTGGGCCGGTGG + Exonic
1091654403 12:2334993-2335015 GGAATGGGTGCCTCAGCCTGGGG - Intronic
1091847906 12:3671476-3671498 GAAGTGGGAGGCTCGGAATCAGG - Intronic
1092155826 12:6280966-6280988 GGAGTGGGAGGCTGGGGTGGAGG - Intergenic
1092957501 12:13563604-13563626 GGAGTGGGAGGACCGGTCCGGGG - Exonic
1093668604 12:21845089-21845111 GCAGGTGGAGGCTTGGCCTGTGG - Intronic
1094536094 12:31324193-31324215 CGTGCGGGAGGCGCGGCCTGCGG - Intronic
1096189051 12:49603101-49603123 GAAGTCAGAGGCTGGGCCTGGGG - Intronic
1096542990 12:52318565-52318587 GGAGGGGTATGCTGGGCCTGGGG + Intronic
1099300860 12:80892757-80892779 AGAGTGGGGGGCTGGGCATGGGG + Intronic
1101447544 12:104748146-104748168 GGAGTTGGAGGCTGGGGCTGGGG + Intronic
1102514397 12:113436660-113436682 GGAGGGGGTGGCTGGGGCTGGGG + Intronic
1102678361 12:114673607-114673629 GGAATGGGACTCTAGGCCTGGGG - Intronic
1103610700 12:122122501-122122523 GGAGTGGTAGCCTGTGCCTGTGG - Intronic
1104638536 12:130452643-130452665 GGAGTGGCAGGCTCCACTTGTGG + Intronic
1104987827 12:132607005-132607027 GGAGCGGGGGCCTCAGCCTGGGG + Intronic
1106050063 13:26181219-26181241 AGAGTCGGGGGCTCTGCCTGGGG + Intronic
1106950511 13:34878826-34878848 GGAGTGTGTTGCTGGGCCTGAGG - Intergenic
1107270165 13:38606923-38606945 GGAGTGGGAAGCTAGTACTGAGG - Intergenic
1108533320 13:51347266-51347288 GGAGAGGAAGCCTGGGCCTGAGG + Intronic
1112484497 13:99808223-99808245 GGAGTGGGGGTGTGGGCCTGTGG - Intronic
1113696073 13:112346411-112346433 TGAGAGGGCGGCTCGGCCAGGGG - Intergenic
1113962273 13:114132642-114132664 GGACCGGGAGGCTCCGCCCGCGG + Intergenic
1114070218 14:19099505-19099527 GGCCTCGGAGGCTGGGCCTGGGG + Intergenic
1114092046 14:19300497-19300519 GGCCTCGGAGGCTGGGCCTGGGG - Intergenic
1114636194 14:24188327-24188349 GGAGAGGTGGGCTGGGCCTGGGG - Exonic
1115399032 14:32938424-32938446 GGACTGGGAGGCTCGGCTGCCGG - Intronic
1119233167 14:72997124-72997146 TGAGTGGAAGGGTCGGCCTTAGG - Intronic
1119486125 14:74988182-74988204 GGTGTGGGGGGCCAGGCCTGTGG + Intergenic
1119639604 14:76304882-76304904 GGAGAGGGAGTCTGGGCCTGGGG + Intergenic
1120991712 14:90383188-90383210 GGAGTGAGCGGCTCCGCCTATGG - Intergenic
1121199645 14:92106577-92106599 GGAGGGGGTGGTTCGGCGTGGGG - Exonic
1121439996 14:93942533-93942555 GGAGTGGGAGCCCAGACCTGGGG - Intronic
1122076339 14:99237517-99237539 GGAGTGGGAGGTGGGGCCTGGGG - Intronic
1122153001 14:99734707-99734729 GGAATGGGAGGCATGGACTGGGG - Intergenic
1122257550 14:100490111-100490133 GGAGTGGGTGGCTCACCCTTGGG + Intronic
1122658717 14:103279788-103279810 GGGGAGGGAGGCTAGGACTGGGG + Intergenic
1122873249 14:104650980-104651002 GGAGTGGGAGGGTGGGCCTGGGG + Intergenic
1123029157 14:105442913-105442935 GCAATGGGAGGCCTGGCCTGAGG + Intronic
1123997247 15:25727414-25727436 AGAGTGGGTGGCTCGCCCTGTGG + Intronic
1124370127 15:29099762-29099784 GGGGTGGGAGGATGGGCTTGGGG + Intronic
1124527557 15:30471176-30471198 GGAGTCTGGGGCTCGGGCTGTGG + Intergenic
1124771102 15:32536526-32536548 GGAGTCTGGGGCTCGGGCTGTGG - Intergenic
1125761117 15:42096108-42096130 GGAGTGGGGCGCTGGGGCTGGGG - Intergenic
1126143540 15:45456344-45456366 TGAGTGGGAGGGGCTGCCTGGGG - Intergenic
1127562829 15:60157619-60157641 AGAATGGGAGGCCCGGCCAGGGG + Intergenic
1128226618 15:66006184-66006206 GGAGAGGCAGGCTGGGACTGGGG + Intronic
1130193952 15:81761619-81761641 GAAGTGGAAGGCGGGGCCTGGGG - Intergenic
1131094817 15:89648504-89648526 GGAGGCGGTGGCTGGGCCTGGGG + Exonic
1131228222 15:90642541-90642563 GGAGTGGGAGGCTCGGCCTGGGG + Exonic
1131301292 15:91201882-91201904 GGAGTGGGAGGCTAGGCACAAGG - Intronic
1132668216 16:1091387-1091409 TGCGTGGGAGGCTGGGCCGGAGG + Intronic
1132672517 16:1107638-1107660 GGCCTGGGGGGCACGGCCTGAGG + Intergenic
1133035350 16:3031075-3031097 CGAGTGGGAGGCCCGGGCCGTGG - Exonic
1133320305 16:4909390-4909412 GGAGTGGGAGGCTGAGGGTGGGG - Intronic
1136027868 16:27481579-27481601 GGAGTGTGAGGCTGGGGCAGAGG - Intronic
1136515548 16:30766136-30766158 GGAGTGGGAGGCAGGGCCATGGG - Intronic
1137408474 16:48208337-48208359 GCAGTGGGGGGCCCCGCCTGGGG + Intronic
1137665634 16:50247292-50247314 GGAGTGGCTGACTGGGCCTGGGG + Intronic
1139545636 16:67648369-67648391 GAAGTGGGAAGGTGGGCCTGGGG - Intronic
1141671679 16:85495303-85495325 GGAGTGGGAGTCCCGGCCTGTGG + Intergenic
1141874503 16:86813366-86813388 AGAGTGGGAAACTTGGCCTGTGG + Intergenic
1142153088 16:88521296-88521318 GGAGGGGAAGGCTGGGCTTGGGG - Intronic
1142252302 16:88997568-88997590 CTGGTGGGAGGCTGGGCCTGGGG + Intergenic
1142259666 16:89036782-89036804 GGAGTCTGAGGCTCTGGCTGGGG - Intergenic
1142489685 17:270180-270202 GGAGTGGGTGGCTGGTGCTGGGG - Intronic
1143409764 17:6701892-6701914 GGGATGGGAGGCGGGGCCTGTGG - Intronic
1143476826 17:7207957-7207979 GGAGGGGGATGCTGGGACTGGGG - Intronic
1143491155 17:7285916-7285938 GGTGTGGGAGGCTGGGGCGGGGG - Intronic
1143726221 17:8848705-8848727 GGGGTGGGAGGCTCGGAATGGGG - Intronic
1145824422 17:27866321-27866343 TGACTGGGGGGCCCGGCCTGGGG - Intronic
1145899067 17:28478198-28478220 GGTGTTGGAGTCTCTGCCTGAGG + Intronic
1145912297 17:28549733-28549755 ACAGTGGGAGGCCCTGCCTGAGG + Intronic
1146742414 17:35298251-35298273 GGACTGTGAGGCTCAGGCTGGGG + Intergenic
1147786271 17:42980711-42980733 GGTGGCGGAGGCCCGGCCTGGGG + Exonic
1148215065 17:45829864-45829886 GGAGTGCCAGGCTCTGCCTGGGG + Intronic
1148342815 17:46883694-46883716 GGAGTGCTGGGCACGGCCTGGGG + Intronic
1149663732 17:58351667-58351689 GGAGTGGGAGGGTGGGACTTAGG - Intronic
1149676894 17:58472808-58472830 AGAGTGGGAGGTTCAGCCTGGGG - Intronic
1150266801 17:63837456-63837478 GGCATGGGAGGCTGCGCCTGGGG + Exonic
1151660108 17:75514536-75514558 GGTGTCGGAGCCTCGGGCTGTGG - Intronic
1151751362 17:76040132-76040154 AGAGTGGCAGGCTAGGACTGGGG + Intronic
1152122498 17:78427280-78427302 GGAGAGGGAGCCTTGGCCAGCGG + Intronic
1152559890 17:81072665-81072687 AGAGTGGGAGGCGTGGCCTCTGG - Intronic
1152636589 17:81432822-81432844 GGGGGGGGAGGGTGGGCCTGGGG - Intronic
1152636617 17:81432871-81432893 GGGGGGGGAGGTTGGGCCTGGGG - Intronic
1152685010 17:81689639-81689661 GGAGTTGGACGCTTGCCCTGTGG + Intronic
1152744376 17:82032138-82032160 GGAGTCGGGGCCTCTGCCTGGGG + Intronic
1153959932 18:10132032-10132054 GGTGTGGGCGGCCCAGCCTGCGG - Intergenic
1154173033 18:12064202-12064224 GGACTGGAAGGCCTGGCCTGTGG + Intergenic
1157606695 18:48930360-48930382 GGAGTGGGAGGACCCGCCAGAGG - Intronic
1158265307 18:55654665-55654687 GGAGAGGCTGGCTAGGCCTGAGG + Intronic
1159107209 18:64016100-64016122 GGGCTGGGAGTCTGGGCCTGAGG + Intergenic
1159471351 18:68860595-68860617 GCAGTGGAAGGCTCTCCCTGAGG - Intronic
1160205086 18:76824839-76824861 GGAGAGGGAGGCTGGGTCAGAGG - Intronic
1160398496 18:78590173-78590195 GGGATGGGAGACTCTGCCTGAGG - Intergenic
1160498352 18:79388208-79388230 TGGGTGGGAGGCTGGGCCTTGGG + Intergenic
1160726152 19:618681-618703 TGAGTGGGGGGCCCGGGCTGGGG - Intronic
1160838936 19:1137480-1137502 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160838945 19:1137500-1137522 GGGGGGTGAGGCTCGGGCTGGGG + Intronic
1160838969 19:1137554-1137576 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160838981 19:1137581-1137603 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160838993 19:1137608-1137630 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839004 19:1137635-1137657 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839015 19:1137662-1137684 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839045 19:1137733-1137755 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839057 19:1137760-1137782 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839069 19:1137787-1137809 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839111 19:1137885-1137907 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839123 19:1137912-1137934 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839135 19:1137939-1137961 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839146 19:1137966-1137988 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839176 19:1138037-1138059 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839188 19:1138064-1138086 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839200 19:1138091-1138113 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839212 19:1138118-1138140 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839242 19:1138189-1138211 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160946235 19:1645261-1645283 GGAGTGGGGGCCTCGGGTTGGGG - Intronic
1161101553 19:2424386-2424408 GGGGTGGGAGGAGTGGCCTGGGG - Intronic
1161112043 19:2475973-2475995 GGAGGGGGAGGAGCGGCGTGCGG - Intergenic
1161169155 19:2804446-2804468 TGAGCGGGAGGCTCTGCCTGGGG + Intronic
1161620136 19:5293262-5293284 GGCCTGGGGAGCTCGGCCTGGGG + Intronic
1161963414 19:7535072-7535094 GGAGTAGGGGGTGCGGCCTGGGG + Intronic
1162301917 19:9849273-9849295 GGAGTGGGGGGTTCGGCCACTGG - Exonic
1162372238 19:10286674-10286696 GAAGTGGGAGGATCAGGCTGTGG - Intergenic
1162567596 19:11452992-11453014 GGAGTGTGGGGCTGGGCCTTTGG + Exonic
1162574294 19:11489862-11489884 GGCCTGGAAGGCTTGGCCTGGGG + Intronic
1163311594 19:16518238-16518260 GGAGTGGAAGGCGCTGGCTGGGG + Exonic
1163315515 19:16538162-16538184 GGAGTTGGAGGCCTGGCTTGGGG - Intronic
1163586636 19:18167985-18168007 GGAGGTGGAGGCTCTGGCTGAGG - Intronic
1163737937 19:18992922-18992944 GGAGAGGCAGGCTCCTCCTGGGG - Exonic
1163859903 19:19737282-19737304 GGCGTGGGAGCATCGGCCTGTGG - Intergenic
1164543778 19:29142314-29142336 GCAGTGGCAGGCTCTGCCTGGGG + Intergenic
1165080732 19:33304582-33304604 GGAGTGGGACTCCCGGCCCGGGG + Intergenic
1165313709 19:35042418-35042440 GGACGGGGAGGCAGGGCCTGGGG - Exonic
1165443136 19:35842253-35842275 GGAGTGGGGTGCTCCACCTGGGG + Exonic
1165476241 19:36032584-36032606 AGAATGGGGGGCTGGGCCTGGGG - Intronic
1165787914 19:38473472-38473494 GGACTGGGAGGCTCAGCCGCAGG - Exonic
1165830674 19:38728818-38728840 GCAGTGGCAGGCTCTGCCCGGGG + Intronic
1166069323 19:40378049-40378071 AGAATGGGAGGGGCGGCCTGCGG + Exonic
1166342743 19:42148694-42148716 TGAGTGGGAGGCACAGCCGGAGG - Intronic
1166833755 19:45654141-45654163 GGAGAGGGCGGCTCTGTCTGAGG + Intergenic
1167362955 19:49039956-49039978 GGGGTGGGGGGCGCGGCTTGGGG + Intergenic
1167423059 19:49415071-49415093 GGAGTGTGAGGCTGGGGCTTGGG - Intronic
1167612857 19:50515550-50515572 CAAGCGGGAGGCTGGGCCTGCGG - Intergenic
1168414657 19:56160501-56160523 GGAGAGGGAGGCTGGGCCGCAGG - Exonic
927477246 2:23423329-23423351 GGGGTGGGAGGCACGGCCTGGGG - Intronic
927809987 2:26175390-26175412 GGAGTGGGAGGCCCAGCCCTGGG - Intronic
927841970 2:26450487-26450509 AGAGCGGGAGGCTTGGCTTGTGG - Intronic
928249106 2:29659375-29659397 GGAGTGGGCTGTTCTGCCTGGGG + Intronic
929060123 2:37915028-37915050 TGAGTTGGAGTCTCTGCCTGTGG + Intergenic
929264904 2:39907211-39907233 GGAGTGAGATTCTCAGCCTGTGG - Intergenic
929593171 2:43159941-43159963 AGAGTGGGTGGCTGGGCCTGGGG + Intergenic
930762259 2:55049864-55049886 GGAGGGGGAGGCCGGGCCGGAGG + Exonic
932552139 2:72782678-72782700 GGAGTGGGAGGGTGGGTGTGTGG - Intronic
934989283 2:98910163-98910185 GAAGTGGGAGGTCCTGCCTGAGG - Intronic
936153001 2:110031882-110031904 GGAGAGGGAGGGTGGGGCTGGGG + Intergenic
936191679 2:110339530-110339552 GGAGAGGGAGGGTGGGGCTGGGG - Intergenic
937082950 2:119153487-119153509 GGAGTGGGAACCTCTGTCTGGGG + Intergenic
937904966 2:127048683-127048705 GGAGTGGGATGCGTGCCCTGTGG - Intronic
942219848 2:173758301-173758323 GGAGTGGGAGGTTGGGGGTGGGG + Intergenic
942461216 2:176170295-176170317 GGAGTGGGAGAATTGGGCTGAGG - Intronic
946190035 2:218003189-218003211 GGGGTGGGGGGCACGGCCTGGGG - Intergenic
946395467 2:219441970-219441992 GGAGTCGGAGGCGGGGCCGGGGG - Intronic
946401177 2:219469106-219469128 GGGGTGGGAGGCACGGCCCTGGG + Intronic
946467116 2:219921701-219921723 GGAGTGGGAAGATGGGTCTGGGG + Intergenic
947736436 2:232457716-232457738 GGTGTGGGAGGCACGGCAGGGGG + Intronic
948578494 2:238969111-238969133 GCAGTGGGAGGCTCAGCATGAGG + Intergenic
948777516 2:240297362-240297384 GCTGTGGAAGGCTTGGCCTGAGG - Intergenic
948795964 2:240402223-240402245 AGAGTGGGGAGCTCAGCCTGCGG - Intergenic
1169074141 20:2751188-2751210 GAAGTGGGTGGCTTGGGCTGGGG - Intronic
1172426034 20:34856753-34856775 GGACTGGGAGGCTTCTCCTGAGG + Intronic
1172774007 20:37396915-37396937 GGAGGAGGAGGCTCGGGGTGGGG - Intronic
1173227394 20:41169849-41169871 GGAGAGGGAGACACGGCCTGAGG + Intronic
1174180595 20:48672032-48672054 GGAGTTGTGGGCTCGGCCAGAGG - Intronic
1174378746 20:50143042-50143064 GGAGTGGCATGATCTGCCTGGGG + Intronic
1175073894 20:56358013-56358035 GGAGTGGGAGGAACGTCTTGGGG - Intergenic
1176034875 20:63031368-63031390 GGCGTGGGAGCCTGGGGCTGGGG + Intergenic
1176222875 20:63978499-63978521 GGAGTGGGTGGCTGAGTCTGAGG - Intronic
1176283404 20:64328074-64328096 GGGGAGGGAGGCTGGGCCGGTGG - Intergenic
1176429092 21:6565052-6565074 GGGGAGGGAGACTCGGCCTGGGG + Intergenic
1177790140 21:25714048-25714070 GGTGTTGGAGGCCAGGCCTGTGG - Intronic
1178916428 21:36707936-36707958 GCAGTGGGGGGCTGGGGCTGGGG + Intronic
1178936919 21:36870893-36870915 GGAGTGGGGGGCCAGGGCTGGGG - Intronic
1179307357 21:40167158-40167180 GGAGTGAAGGGCTCGCCCTGGGG + Intronic
1179704582 21:43173368-43173390 GGGGAGGGAGACTCGGCCTGGGG + Intergenic
1179913502 21:44462232-44462254 GGAGGGGGAGGCTCGGGGTTTGG - Intergenic
1180256792 21:46635378-46635400 GGGTTGGGGGGCTCGGCTTGGGG - Intronic
1180488688 22:15822067-15822089 GGCCTCGGAGGCTGGGCCTGGGG + Intergenic
1181005517 22:20011571-20011593 GGGGTGGGATGCAGGGCCTGAGG + Intronic
1181089247 22:20460917-20460939 GTAGTGGGAGGCATGGCCTTTGG + Intronic
1182353844 22:29713360-29713382 GGTGAGGGAGGCTTGGCCAGGGG - Intergenic
1182410748 22:30183364-30183386 GGAGTTGGTGCCTGGGCCTGGGG - Intergenic
1182421122 22:30249052-30249074 GGAGGGGGAGGCTGGGCCTGGGG - Intergenic
1183214773 22:36472508-36472530 AGTGTGGGAGGCTGGGCATGCGG + Intronic
1183397449 22:37580145-37580167 GGAGGGGGAGGCTGGGCTGGAGG - Intronic
1183675477 22:39296905-39296927 GGGGAGGGAGCCCCGGCCTGGGG - Intergenic
1184455451 22:44607354-44607376 GAGATGGGAGGCTCAGCCTGCGG + Intergenic
1184486875 22:44785091-44785113 GGAGCGTGAGGCGGGGCCTGAGG - Intronic
1184717450 22:46290091-46290113 AGGGTGGGAGGTTGGGCCTGGGG - Intronic
950507983 3:13407555-13407577 GGAGTGGGAGGCAGGGGCTTTGG - Intronic
950718926 3:14868651-14868673 GGAGTGGGAAGCACAGGCTGTGG - Intronic
953399501 3:42600658-42600680 GCATTGGGAGGCCCGGCCTGGGG + Exonic
953880904 3:46690863-46690885 GGAGTTGTAGGCTCTGCCAGGGG - Intronic
957184478 3:76924266-76924288 GTATTGGGAGGCTGGGCCTCTGG + Intronic
961322166 3:126083843-126083865 GGGGTCGGAGGGGCGGCCTGGGG - Intronic
961386142 3:126524438-126524460 GGGGTGCGCGGCTCGGCCGGCGG - Intronic
961821683 3:129578575-129578597 CGAGTGGGAGGCACGGGGTGGGG - Intronic
963687154 3:148450881-148450903 GGTGTTGGAGGCGTGGCCTGTGG + Intergenic
965701112 3:171460174-171460196 GGCGGGGGAGGCTGGGCCCGGGG - Exonic
967759547 3:193207927-193207949 GGAGAGGGAGGCTTGGCTAGGGG + Intergenic
968287472 3:197517392-197517414 GGGGTGGGGGGGTCAGCCTGAGG - Intronic
968287533 3:197517605-197517627 TGATTGGGGGGGTCGGCCTGAGG - Intronic
968317564 3:197737064-197737086 GGATTGGAGGGCGCGGCCTGCGG - Intronic
968698472 4:2043706-2043728 TGAGTGGGAGGCTCTGGGTGTGG + Intronic
968699535 4:2048003-2048025 GCAGTGGCAGGCTCAGGCTGAGG + Intergenic
968831321 4:2934218-2934240 GGCGTGGGAGGCGCGGCCGTGGG - Exonic
968904307 4:3444501-3444523 CGAGTGGGAGGAATGGCCTGAGG + Intronic
969016418 4:4107000-4107022 GGAGGGGGGGGCGCGTCCTGGGG - Intergenic
969230577 4:5827454-5827476 GGACTGGGAGGCTCTGCATCTGG - Intronic
969669213 4:8580509-8580531 GGGCTGGGAGGCTCGGCTGGAGG + Intronic
969689509 4:8696488-8696510 GGAGTGGGAGGCTTTGCAGGAGG + Intergenic
972360875 4:38324878-38324900 GGACTGGCAGGCTCCGCCTGCGG - Intergenic
973199741 4:47486602-47486624 GGAGTGGGAGGTTCTTGCTGCGG - Intronic
980948427 4:139347026-139347048 GTAGTGGGAGGCTGGGGGTGGGG - Intronic
982202382 4:152973397-152973419 AGAGAAGGAGGCTCAGCCTGTGG + Intronic
982312978 4:154004685-154004707 AGAGTGGAAGGCCTGGCCTGGGG + Intergenic
984985977 4:185329816-185329838 GGACTGTGAGGCTCAGGCTGGGG - Intronic
985665399 5:1179418-1179440 GGAGAGGCAGGCGGGGCCTGTGG + Intergenic
985777901 5:1854657-1854679 GGAGTCAGAGGCTCAGGCTGTGG - Intergenic
985904600 5:2823498-2823520 GGGGTAGGAGCCCCGGCCTGGGG + Intergenic
986594659 5:9408909-9408931 GGAGAGGGAGGCTGGGCTTGAGG - Intronic
987189053 5:15454738-15454760 GTAGTGGGAGGCTCGGGGAGAGG - Intergenic
987472535 5:18350922-18350944 GGAGAGGGAGGCTATGACTGTGG + Intergenic
988702176 5:33686222-33686244 GGGGAGGGAGGCTGAGCCTGCGG - Intronic
989368443 5:40680945-40680967 GGAGTGCAAGGCTGGGTCTGGGG - Exonic
989751119 5:44895289-44895311 AGAGAGGGAGACTCGGTCTGGGG - Intergenic
990487491 5:56273605-56273627 GGAATGGGAGGCTGGTTCTGGGG + Intergenic
992014205 5:72559157-72559179 GGAGTGAGGGGCTGGGCCTCAGG + Intergenic
993728237 5:91392632-91392654 GGAGTGGGAGGAGCGGCAAGTGG + Intergenic
997583502 5:135031445-135031467 GGTGCGGGAGGCACGGGCTGCGG - Exonic
998094300 5:139388599-139388621 GGACTGGGAGGCAGGGCCTCAGG + Intronic
998575690 5:143313388-143313410 GGAGAGAGAAACTCGGCCTGAGG - Intronic
999244161 5:150144561-150144583 GGAGAGCGGGGCTCGGGCTGGGG - Intronic
999368070 5:151035764-151035786 GGCATGGGAGTCTGGGCCTGAGG - Intronic
1000133970 5:158326447-158326469 GGAGTGGGAGCCTGGGCCTGGGG - Intergenic
1002327350 5:178418545-178418567 TGAGTAGGTGGCTCTGCCTGAGG - Intronic
1002452427 5:179326479-179326501 GGAGTGGGGGGCGGGGCCGGGGG - Intronic
1002576479 5:180176995-180177017 GGAGTTGGAGGCCAGGCCAGGGG - Intronic
1003098168 6:3157853-3157875 AGAGTGGGCGGCTCGGGGTGGGG - Intergenic
1003107532 6:3227718-3227740 GGACTGGGGGGCTCGGGCTGGGG - Exonic
1003495573 6:6660639-6660661 AGAGTGGGAGGAATGGCCTGGGG + Intergenic
1004001151 6:11598468-11598490 GGACTGGGAGGGTGGGCCTGGGG - Intergenic
1004194050 6:13487955-13487977 GCAGTGGGCGCCTTGGCCTGGGG + Intergenic
1005348337 6:24911130-24911152 GGAGGGGGAGGCGCGGCGCGGGG + Intronic
1006052845 6:31356947-31356969 GGAGTGGGAGCCTGGGGGTGAGG + Exonic
1006067300 6:31471400-31471422 GGACTGAGAGGAACGGCCTGGGG + Intergenic
1006372958 6:33656713-33656735 AGAGTGGGAGGCTTTGGCTGTGG + Intronic
1006405196 6:33841151-33841173 GGAGTGGGGGCCTGGGACTGGGG - Intergenic
1006505487 6:34486190-34486212 GGAGAGGGAGGCAGGGCCTAGGG + Intronic
1007248953 6:40482747-40482769 GGAGGGGGAGGCAGGGCCTGGGG - Intronic
1009595417 6:65729227-65729249 AGAAAGGGAGGCTCAGCCTGGGG + Intergenic
1010243684 6:73642281-73642303 GGAGGGGGAGGCAGGGCCGGGGG - Intronic
1013292732 6:108732811-108732833 GGTGTGGCAGGCACGGCCTTAGG - Intergenic
1016462050 6:144287123-144287145 GGCGTGGGAGACGCAGCCTGCGG + Intronic
1017018317 6:150118961-150118983 GGAGTGGGAGGCTGGAGTTGAGG + Intergenic
1017453713 6:154578477-154578499 GGTGTGGGAGCTTCTGCCTGGGG - Intergenic
1017888518 6:158620625-158620647 GGACTGCGAGGCTCGGGCGGGGG - Intronic
1018443475 6:163834448-163834470 AGAGTGGGAGGCATGGCCTCCGG + Intergenic
1018702134 6:166435753-166435775 GGTGTGGGTGGCTTGGCCTGTGG + Intronic
1018746218 6:166764333-166764355 AGAGTGGGAGGCTCTGCCCAGGG + Intronic
1019179413 6:170177270-170177292 GGCGGGGGAGGGGCGGCCTGTGG + Intergenic
1019207121 6:170371140-170371162 GGAGTGTGGGGCTGGGGCTGGGG - Intronic
1019455274 7:1123536-1123558 AGGGTGGGCGGCTGGGCCTGGGG - Intronic
1019508966 7:1407728-1407750 GGAGAGTGAGGCGCGGCCAGGGG + Intergenic
1019686398 7:2384375-2384397 GGACTGGGAGGCAAGGCCTTGGG + Intergenic
1019707574 7:2503829-2503851 GGAGTGGGAGGATCAGCTGGGGG - Intergenic
1019829430 7:3311932-3311954 GGAGTAGGAGGCATGGCCTTGGG + Intronic
1020071081 7:5227383-5227405 GGACTGGGCCCCTCGGCCTGAGG - Intronic
1021258353 7:18422592-18422614 GGAGGGGGAAGCCAGGCCTGTGG + Intronic
1026526008 7:71154106-71154128 GGTGAGGGAGCCTCTGCCTGAGG + Intronic
1026956009 7:74376845-74376867 GGGGCGGGAGGGTCGGGCTGGGG + Intronic
1029439084 7:100577450-100577472 GGGGTGGGAGGATCGGGCAGTGG + Intronic
1031886950 7:127253201-127253223 GGAGGGGGACCCTCGGCCCGCGG + Exonic
1032023188 7:128421459-128421481 CAAGTGGGAGGCTATGCCTGGGG - Intergenic
1032415711 7:131733797-131733819 GCAGTGGGAGGCTTGGGCAGAGG + Intergenic
1032469787 7:132169957-132169979 GGAGTGGGAGGGACGGCCTGGGG + Intronic
1035010439 7:155711197-155711219 GGAGGGGGAGCCTGGGGCTGTGG - Exonic
1035451418 7:158979519-158979541 GGAGGAGGAGGCTTGGACTGTGG + Intergenic
1036414839 8:8537445-8537467 GGCGTGGGAAGCATGGCCTGGGG - Intergenic
1037820468 8:22132531-22132553 GGAGTGGGAGGCCGGGCCTCAGG - Intronic
1038494602 8:27992501-27992523 AGAGTGGGGGTCTGGGCCTGGGG + Exonic
1039484248 8:37899034-37899056 GGAGGGGAGGGCCCGGCCTGGGG - Intronic
1040076983 8:43246706-43246728 GGGGCGGGAGGCACGGCCTAGGG + Intergenic
1041719729 8:60965109-60965131 GAAGTGTGAGGTCCGGCCTGAGG + Intergenic
1044541373 8:93411988-93412010 GCAGTGGAAGGCTCTCCCTGAGG - Intergenic
1045701744 8:104874366-104874388 GGAATTTGAGGCTTGGCCTGAGG + Intronic
1047104793 8:121720388-121720410 GGAGTGGGAGGCTCAGGCCCAGG + Intergenic
1048287352 8:133152140-133152162 CTAGTGGGAGGCTGGGCTTGGGG - Intergenic
1048299031 8:133238072-133238094 GGGGTGGGAGGTTGGGGCTGTGG + Exonic
1048571841 8:135663233-135663255 GGAGAGGGAGGCTGGGCCAGAGG - Intergenic
1049288301 8:141788436-141788458 GGAGGGGGTGGCTGGGCCAGCGG - Intergenic
1049479861 8:142816762-142816784 GGAGTGGGAGGCGAGAGCTGTGG - Intergenic
1049501558 8:142970418-142970440 GGGGTGGGGGGCAGGGCCTGAGG - Intergenic
1051374602 9:16390315-16390337 GGAATGGGAGGCTAGGCTGGGGG - Intergenic
1053503542 9:38621416-38621438 TGGGCGGGAGGCACGGCCTGGGG - Intergenic
1053752371 9:41269398-41269420 TGGGTGGGAGGCACGGCCTGGGG - Intergenic
1053907109 9:42852878-42852900 GTAGCGGGGGGCTCAGCCTGGGG + Intergenic
1054257899 9:62833730-62833752 TGGGTGGGAGGCACGGCCTGGGG - Intergenic
1056766329 9:89446797-89446819 GGAGTGGAAGGCACGTCCTGAGG - Intronic
1057003360 9:91533497-91533519 GGGGTGGGAGGCAGGGCCAGCGG - Intergenic
1058699594 9:107589461-107589483 GAATGGGGAGGCTGGGCCTGGGG - Intergenic
1060797387 9:126522052-126522074 GGAGTCTGAGGCTGGGGCTGGGG - Intergenic
1061079409 9:128361096-128361118 GGACTGAGAGGCCCTGCCTGAGG - Exonic
1062457453 9:136646348-136646370 GGGGTGGGAGGCCCAGCCTCCGG - Intergenic
1062513883 9:136922615-136922637 GGATGGGGAGGATGGGCCTGGGG + Intronic
1062513898 9:136922654-136922676 GGATGGGGAGGATGGGCCTGGGG + Intronic
1062513971 9:136922851-136922873 GGATGGGGAGGATGGGCCTGGGG + Intronic
1062513999 9:136922935-136922957 GGATGGGGAGGATGGGCCTGGGG + Intronic
1062689132 9:137832455-137832477 CGCGTGGGAGGCGGGGCCTGAGG - Intronic
1062698552 9:137887699-137887721 GGAGTGAGAGGCTGGGGCAGCGG - Intronic
1202800876 9_KI270719v1_random:174650-174672 TGGGTGGGAGGCATGGCCTGGGG + Intergenic
1203697142 Un_GL000214v1:109256-109278 TGGGCGGGAGGCACGGCCTGGGG - Intergenic
1203552071 Un_KI270743v1:171773-171795 TGGTTGGGAGGCACGGCCTGGGG + Intergenic
1185611238 X:1394794-1394816 GGGGAGGGCGGCTCAGCCTGGGG + Intergenic
1186496396 X:10015385-10015407 GGAGTGGGCGGCGCGGGCAGCGG + Intergenic
1188730710 X:33642435-33642457 GTAGTGGAAGGCTGGGCTTGGGG + Intergenic
1189145987 X:38655226-38655248 GGAGATGGAGGCTTGGCCTAGGG + Intronic
1189289644 X:39876090-39876112 GGAGTGGGAGGCTGGGGGTGGGG - Intergenic
1189613554 X:42762941-42762963 GGACTGCGAGGCTCTGGCTGGGG + Intergenic
1190878162 X:54474495-54474517 GGGGAGGGGCGCTCGGCCTGGGG - Intronic
1192151873 X:68717742-68717764 GGCCTGGGAGGCCTGGCCTGTGG + Exonic
1198637015 X:138711783-138711805 GGGGTGGGAGGGGCGGCCTGCGG - Intronic
1198750375 X:139932391-139932413 GGAGCGCGAGGCTCCTCCTGTGG + Intronic
1199248338 X:145631890-145631912 GGAGTGGAAGGAGCCGCCTGAGG + Intergenic
1200745317 Y:6899103-6899125 TGAATGGGTGGCTGGGCCTGAGG + Intergenic
1201153349 Y:11107343-11107365 TGGGCGGGAGGCACGGCCTGGGG + Intergenic
1201630839 Y:16070725-16070747 GGACTGTGAGGCTCAGGCTGGGG + Intergenic
1202272701 Y:23086129-23086151 GGAGGGGGAGGCACGGCGGGGGG - Intergenic
1202293325 Y:23334553-23334575 GGAGGGGGAGGCACGGCGGGGGG + Intergenic
1202425698 Y:24719873-24719895 GGAGGGGGAGGCACGGCGGGGGG - Intergenic
1202445091 Y:24950212-24950234 GGAGGGGGAGGCACGGCGGGGGG + Intergenic