ID: 1131228223

View in Genome Browser
Species Human (GRCh38)
Location 15:90642544-90642566
Sequence GTGGGAGGCTCGGCCTGGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 1, 2: 4, 3: 56, 4: 533}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228210_1131228223 3 Left 1131228210 15:90642518-90642540 CCGTCCGCACCGAAGGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1131228223 15:90642544-90642566 GTGGGAGGCTCGGCCTGGGGCGG 0: 1
1: 1
2: 4
3: 56
4: 533
1131228212_1131228223 -1 Left 1131228212 15:90642522-90642544 CCGCACCGAAGGCGGGCCCGGAG 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1131228223 15:90642544-90642566 GTGGGAGGCTCGGCCTGGGGCGG 0: 1
1: 1
2: 4
3: 56
4: 533
1131228215_1131228223 -6 Left 1131228215 15:90642527-90642549 CCGAAGGCGGGCCCGGAGTGGGA 0: 1
1: 0
2: 1
3: 4
4: 88
Right 1131228223 15:90642544-90642566 GTGGGAGGCTCGGCCTGGGGCGG 0: 1
1: 1
2: 4
3: 56
4: 533
1131228206_1131228223 13 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228223 15:90642544-90642566 GTGGGAGGCTCGGCCTGGGGCGG 0: 1
1: 1
2: 4
3: 56
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228223 Original CRISPR GTGGGAGGCTCGGCCTGGGG CGG Exonic
900119305 1:1041750-1041772 GTGGGCGGCTCCCCCGGGGGAGG + Intronic
900119325 1:1041797-1041819 GTGGGCGGCTCCCCCGGGGGAGG + Intronic
900169372 1:1258848-1258870 GTGTGGGCCTCGGGCTGGGGCGG - Intronic
900329613 1:2127489-2127511 GTGGGAGGCGGGACGTGGGGCGG - Intronic
900342169 1:2194490-2194512 GGGGGAAGCTCGGCGTGGGGTGG + Intronic
900369756 1:2326445-2326467 TCGGGAGTCTCGGCCTAGGGAGG + Intronic
900372412 1:2337819-2337841 GAGGGAGGCAGGGGCTGGGGCGG + Intronic
900578207 1:3394504-3394526 GTGGGTGGTGCGGCCTGGAGTGG + Intronic
900935939 1:5766425-5766447 GTGGGAGGGCTGCCCTGGGGAGG - Intergenic
900993895 1:6110060-6110082 CCGGGAGCCTTGGCCTGGGGTGG - Intronic
901050477 1:6423750-6423772 GTGCCAGGCTGGGGCTGGGGCGG + Intronic
901052476 1:6432248-6432270 GCTGGAGGCTGTGCCTGGGGTGG + Intronic
901202473 1:7474571-7474593 GTGGGATGCTAGGGATGGGGTGG - Intronic
901494842 1:9614995-9615017 GTGGGGGGCTCGGGTTGGGGTGG + Intergenic
901647721 1:10725668-10725690 GGGGGAGGCCAGGCTTGGGGAGG + Intronic
902481763 1:16715770-16715792 GCTGGAGGCTCTGCCTGGGGTGG - Intergenic
902612164 1:17603635-17603657 GAGGGAGGCTGGGACTGGGGAGG + Intronic
902803946 1:18849301-18849323 GTGGGTGGGCAGGCCTGGGGCGG - Exonic
903136561 1:21313285-21313307 ATGGGAAGCTGAGCCTGGGGTGG - Intronic
903189486 1:21648873-21648895 CTGGGAAGCCAGGCCTGGGGTGG - Intronic
904891289 1:33781610-33781632 CTGGGAGGCTGGCCCAGGGGAGG - Intronic
905368759 1:37471446-37471468 CTGGGCAGCTCAGCCTGGGGAGG - Intergenic
905463393 1:38135598-38135620 TTGGGAGGCACGGCCTGGTAAGG + Intergenic
905643807 1:39610341-39610363 GTGGGAGACCCCGCCTGGGGAGG - Intergenic
905690039 1:39936405-39936427 GTGGGAGGCTCAGGCAGAGGTGG + Intergenic
907540664 1:55214073-55214095 GTGGGAGGCCTGGGCAGGGGTGG - Intronic
907987468 1:59546417-59546439 GTGGGAGGGTTGGGGTGGGGAGG + Intronic
909600632 1:77457794-77457816 GTAGGAGGCTCAGCCAGTGGTGG + Intronic
909972409 1:82006622-82006644 GATGGAGGCTCGGCCAGGTGGGG + Intergenic
911259570 1:95669728-95669750 GTGGGAGGCTCAGGCTTGGCGGG + Intergenic
911634131 1:100214509-100214531 TTGGGAGGCTGGGGCGGGGGTGG + Intronic
912798611 1:112707187-112707209 GGGGGAGGGTCGGCCGGGGGCGG + Intronic
912935612 1:114001744-114001766 CTGGGAGGCTTGGCCTCGCGCGG + Intergenic
914878838 1:151532335-151532357 TTGGGAGTCTGGGCCTGGAGAGG + Intronic
915117780 1:153611219-153611241 GTGGGAGGGTGGGGCTGGAGTGG - Intronic
916052686 1:161047551-161047573 GTGGGAGGCACTGCCTTGGTTGG - Exonic
917348922 1:174056794-174056816 GTGGGAGCCTCTTCCTGGGCTGG - Intergenic
917797255 1:178541560-178541582 GTGGGGGGAGCGGGCTGGGGTGG - Intronic
917930327 1:179818275-179818297 CTGGGAGTCTCGGCCTTAGGCGG + Intergenic
918102852 1:181391525-181391547 GTGGGAGGGGCTGTCTGGGGGGG + Intergenic
918244446 1:182646605-182646627 GTGGGAGGCTGGGGGTGAGGAGG - Intronic
920528309 1:206684842-206684864 GCGGGGGGCGGGGCCTGGGGAGG - Intergenic
921472761 1:215567865-215567887 GTGGGAGGCCAAGCCTGGAGGGG + Intronic
921924462 1:220699907-220699929 GTGGGAGGCTGGGCCAGAGGAGG + Intergenic
922734017 1:227970070-227970092 GCAGGAGGCTGGGCCTGGAGAGG - Intergenic
923048459 1:230372876-230372898 GAGGAAGGCTGGGCCAGGGGAGG - Intronic
923150133 1:231225696-231225718 GTGAAAGGCTGGGCCTGGCGTGG + Intronic
923631058 1:235649827-235649849 GCGGGAGGCGCGGCGCGGGGCGG - Exonic
923655275 1:235910465-235910487 GGTGGAGGCTCTGCCTGGGAGGG + Intergenic
1062895862 10:1102693-1102715 GTTGGAGGCCGGGCCTGGTGGGG - Intronic
1063053196 10:2475588-2475610 GTGGGAGGATCAGTCTGTGGGGG + Intergenic
1063115575 10:3069130-3069152 GGGGGGCGCTGGGCCTGGGGAGG - Intronic
1063387393 10:5624659-5624681 GGGGGATGCTTGGCCTGGAGTGG + Intergenic
1063389372 10:5639288-5639310 GTGGGAGGCTCGGGCCGGCCTGG + Exonic
1067077207 10:43194959-43194981 GGGAAAGGCTGGGCCTGGGGAGG - Exonic
1067209149 10:44244033-44244055 GTGGGAGGAGAGGCCTGAGGAGG - Intergenic
1067713875 10:48672001-48672023 CTGGGAGGCTGGGGCTGGTGGGG - Intergenic
1069239131 10:66116939-66116961 GTTGGAGGAGGGGCCTGGGGGGG - Intronic
1069616902 10:69811985-69812007 GGGGGCAGCTCGGGCTGGGGAGG - Intronic
1069712576 10:70499474-70499496 AGGGGCGGCTTGGCCTGGGGTGG + Intronic
1069723045 10:70561698-70561720 GTGAGAGGCCAGGCCTGGAGTGG - Intronic
1069828142 10:71266645-71266667 CTGGGAGGCTGGGGCAGGGGTGG + Intronic
1069881564 10:71596864-71596886 CTGGGAGGCAGGCCCTGGGGCGG - Intronic
1071949178 10:90683255-90683277 ATAGGAGGCTGGGCCTGGGTGGG + Intergenic
1072326238 10:94301504-94301526 TTGGGAGGCTGGCCCTGGGAGGG - Intronic
1072530083 10:96310600-96310622 GTGGGAGTCACTGCCTAGGGTGG + Intronic
1072631521 10:97150133-97150155 GAAGGAGGCTCTGGCTGGGGAGG + Intronic
1074316951 10:112369720-112369742 GTGGGAGCCCCTGCCTGGGCTGG + Intergenic
1074365589 10:112855097-112855119 ATGGGAAGCTCGACCTGGGATGG + Intergenic
1075256911 10:120932594-120932616 GTGGGAGGATGGCCCTGGGAAGG - Intergenic
1075331331 10:121576363-121576385 GTAGGAGGCTCGGGCTGGGCTGG - Intronic
1076265783 10:129109067-129109089 GTGGGAGGCCCTGCCTGTTGGGG + Intergenic
1076857093 10:133122735-133122757 CAGGGAGGCACGGCCAGGGGTGG - Intronic
1076864367 10:133159958-133159980 GTGGGGGGCGGGGCCCGGGGTGG - Intergenic
1076911525 10:133392430-133392452 GAGGGAGGCTGGGGCTCGGGAGG - Intronic
1077026539 11:442348-442370 GTGGGGGGCATGGCCTGGGGTGG - Intergenic
1077185839 11:1234963-1234985 GGGTCAGGCTGGGCCTGGGGAGG + Intronic
1077194353 11:1272008-1272030 GTGGGAGGCTCAGCCCTGCGCGG - Intergenic
1077254414 11:1573907-1573929 GGGGGAGGCTTGGCCCTGGGAGG + Intergenic
1077254611 11:1574612-1574634 GTGGGAGGCGCGACCAGGGAGGG + Intergenic
1077300127 11:1842938-1842960 GTGGGGGGTTCGGACTGGCGTGG - Intergenic
1077316527 11:1921860-1921882 CTGGGCGGCCAGGCCTGGGGAGG - Intronic
1078600573 11:12726746-12726768 TTGGGAGGCTGAGCCTGGGGAGG + Intronic
1079114956 11:17634949-17634971 GTGAGAGGCCCGGGGTGGGGAGG + Intronic
1079393673 11:20043533-20043555 GTGGGAGGATCACCCCGGGGAGG - Intronic
1081329681 11:41788325-41788347 GTGGGAGGCTCGGGCATGGCGGG + Intergenic
1081736388 11:45407536-45407558 GAGGGTGGCAAGGCCTGGGGAGG - Intergenic
1082260194 11:50072348-50072370 GCAGGAGGCTAGGCCTGGAGAGG + Intergenic
1082260320 11:50072897-50072919 GGTGGAGGCTGGGCCTGGAGAGG + Intergenic
1082672178 11:56047385-56047407 CTGGGAAGCTTGGCCTGGGCCGG - Intergenic
1083226725 11:61290080-61290102 TTGGGAGGGTTGGCCAGGGGAGG - Intronic
1083232617 11:61332842-61332864 GGGGGAGCCGCGGCCTAGGGAGG - Intronic
1083256104 11:61496353-61496375 GTGGGAGGCCCTGCGTGGGGAGG + Intergenic
1083335668 11:61920261-61920283 GTGTGAGGCTCAGCCTGGTGGGG - Intronic
1083606021 11:63979359-63979381 GTGGGAGCATCGGCCAGGGAGGG + Intronic
1083715795 11:64576206-64576228 GTGGGAGGATTTGACTGGGGAGG - Intergenic
1083776817 11:64898063-64898085 GTGAGAGGCTGGGCCAGGGAGGG - Intronic
1084062711 11:66686655-66686677 GCAGGAGGCCCGGGCTGGGGTGG - Intronic
1084771962 11:71349205-71349227 GTGGAAGGCTGGGGCTGGGGCGG + Intergenic
1085272510 11:75278586-75278608 GTAGGAGGCTCGGACTTGGCAGG - Intronic
1085304772 11:75479094-75479116 GTGGGAGCCTCGGCCTCTGGGGG + Intronic
1085516104 11:77112823-77112845 GTGGGAGGCCCAGACGGGGGTGG + Intronic
1085615486 11:77994870-77994892 GTGGGAGGCGGGGCCTCTGGCGG + Intergenic
1086550646 11:88048469-88048491 GTTGGAGGCTGGGCTTGGTGAGG - Intergenic
1086584034 11:88431695-88431717 GTGGGGGGCTGGGGGTGGGGTGG + Intergenic
1088904086 11:114140922-114140944 GCGGGAGGCTCAGCGTGGGCAGG - Intronic
1089111816 11:116063217-116063239 CTGAGAGCCTGGGCCTGGGGTGG + Intergenic
1089296163 11:117469665-117469687 GATGGAGGCTCTGCCTGGGGTGG - Intronic
1089359548 11:117876732-117876754 CTGGGAGGCGCGTCCTGCGGGGG + Exonic
1089538224 11:119173655-119173677 GGGGGGAGCCCGGCCTGGGGTGG - Exonic
1089598357 11:119597314-119597336 GTGGTTGCCTCTGCCTGGGGTGG + Intergenic
1090003646 11:122981936-122981958 GCGGGAGGCTCGGGGCGGGGCGG + Intergenic
1090642984 11:128745362-128745384 GAGGGAGGTGGGGCCTGGGGAGG - Intronic
1090773689 11:129944905-129944927 GGGGGAGGCTCGCCCTGGCCCGG + Exonic
1091239243 11:134041626-134041648 GTGTGAGGCAGGGGCTGGGGTGG - Intergenic
1091239701 11:134044147-134044169 CTCGGTGGCTCGGCCTCGGGAGG - Intergenic
1091693474 12:2612381-2612403 CTGGGGGGCTGGGCCTGGAGAGG - Intronic
1092062592 12:5563600-5563622 TGGAGAGGCCCGGCCTGGGGAGG + Intronic
1092151248 12:6250506-6250528 GTGGGAAGCTGAGCTTGGGGTGG - Intergenic
1092350489 12:7752173-7752195 GTGGGAGGCTCAGGCTTGGCGGG + Intergenic
1092897541 12:13027589-13027611 GTGGGAGGCTTGGGCCTGGGAGG + Intergenic
1092905566 12:13097812-13097834 GGGGGAGGAACGGCCGGGGGCGG - Intronic
1093685188 12:22046580-22046602 GTGGGCGGCGCGGCCTGGGCGGG + Intronic
1094023204 12:25935899-25935921 GTGTGGGTCTCGGGCTGGGGAGG + Intergenic
1094703956 12:32896865-32896887 GTGAGAGGCCCGGGCCGGGGGGG + Intergenic
1095642408 12:44500651-44500673 GTGGGAGGCTCGGCCATGGCAGG - Intergenic
1096230147 12:49892232-49892254 GTGGGAGGATTGGCCTGGGACGG - Intronic
1096258754 12:50078139-50078161 ATGGGAGGCTGGTCCTGGGGTGG + Intronic
1096572169 12:52529906-52529928 CTGGGAGGCAGGGCCAGGGGAGG - Intergenic
1096628012 12:52907094-52907116 GCAGGAGGCAGGGCCTGGGGAGG - Intronic
1097105051 12:56617364-56617386 GAGGGCTGCTTGGCCTGGGGAGG - Intronic
1097158695 12:57030353-57030375 GTGGGAGGGCAGGGCTGGGGAGG + Intronic
1098092821 12:66922271-66922293 GTGCAAGGCTTGCCCTGGGGTGG + Intergenic
1098275452 12:68807959-68807981 GGGTGGGGCTCGGCCTGGCGCGG - Intergenic
1099668680 12:85662398-85662420 GTGGGAGCTTAGGCATGGGGTGG - Intergenic
1100142283 12:91633877-91633899 GTGGGAGCCTCTTCCTGGGATGG + Intergenic
1100162830 12:91880546-91880568 GTTGATGGCTCGGCCTGGGTGGG + Intergenic
1102278185 12:111598783-111598805 GCGGGAGGCCCGGCCTGGGCAGG - Exonic
1102585480 12:113920013-113920035 GTGGCAGGGGCGGCGTGGGGTGG - Intronic
1102636430 12:114328415-114328437 GTGGGAGGCTTGGCTGAGGGGGG - Intergenic
1102678360 12:114673604-114673626 ATGGGACTCTAGGCCTGGGGAGG - Intronic
1102784599 12:115594238-115594260 GGGGGAGGGTCGGAGTGGGGAGG + Intergenic
1104429650 12:128705933-128705955 GTGGTGTGCTCGTCCTGGGGCGG - Exonic
1104554132 12:129784756-129784778 CTGGGAGGCTCGCCCTGAAGTGG + Intronic
1104568401 12:129904323-129904345 CCGGGAGGCTGGGCGTGGGGCGG - Intergenic
1104628700 12:130381021-130381043 GGGGGAGGCTGGGCCTGTGTGGG - Intergenic
1105964521 13:25372310-25372332 GAGGGAGGGTGGGCCCGGGGCGG + Intronic
1106784261 13:33091524-33091546 CTGTGAGGCTGAGCCTGGGGCGG - Intergenic
1108615570 13:52128927-52128949 GATGGAGTTTCGGCCTGGGGCGG - Intronic
1112580783 13:100674857-100674879 GCGGGAGGCGCGGCGCGGGGGGG - Intronic
1113696072 13:112346408-112346430 GAGGGCGGCTCGGCCAGGGGAGG - Intergenic
1113741536 13:112715375-112715397 GTGGGGGGATCGGCCAGGTGTGG - Intronic
1113894998 13:113758952-113758974 GTCGGAGCCCCGGCCTGGGACGG - Intergenic
1113948180 13:114056580-114056602 GTGGGGGGCTCGGTGGGGGGAGG + Intronic
1113961524 13:114128814-114128836 GTGGGAGGCCGGGCCTGCCGTGG - Intronic
1114184421 14:20389410-20389432 GTGGTAGGCTAGGGCTAGGGTGG + Intronic
1114549609 14:23525338-23525360 TTGGGAGGCTCTGCAAGGGGCGG + Exonic
1114636193 14:24188324-24188346 GAGGTGGGCTGGGCCTGGGGTGG - Exonic
1115248029 14:31316779-31316801 GTGGGAGGATCCCCCTGTGGAGG - Intronic
1119701750 14:76760795-76760817 GTGGGAGGCAATGCTTGGGGAGG - Intergenic
1120952084 14:90050906-90050928 CTGGGAGGCTCAGTCTAGGGAGG - Intergenic
1121075041 14:91060672-91060694 GTGGGCGGAGCGGCCTGAGGAGG - Intronic
1122151297 14:99727505-99727527 GTGTGAGGTTGGGCCTGGGTGGG + Intergenic
1122405379 14:101497683-101497705 GTGGGAGGGTGGGGGTGGGGAGG - Intergenic
1122608818 14:102966935-102966957 CTGAGAGGCACGGCCTGGCGTGG + Intronic
1122744465 14:103889692-103889714 GTTCGAGGCTCGGCCGTGGGCGG + Intergenic
1122831294 14:104397666-104397688 GTGGGAGGGCAGTCCTGGGGCGG - Intergenic
1122860614 14:104580811-104580833 ATGGGAGGAAGGGCCTGGGGGGG + Intronic
1123001973 14:105300707-105300729 CTGGGCGGCTGGGCCTGGGCGGG - Exonic
1123014816 14:105368594-105368616 CTGGGAGCCTGGGCGTGGGGGGG + Intronic
1123799170 15:23803174-23803196 GTGGGAGGCTCGGGCATGGCGGG - Intergenic
1124114825 15:26831279-26831301 GTGGGAGGCTCGGGCATGGCGGG + Intronic
1124573156 15:30884017-30884039 GTGGGAGGCTCAGGCATGGGGGG - Intergenic
1124587212 15:31020858-31020880 GTGGGAAGCGAGGCCTGTGGTGG + Intronic
1124688020 15:31798796-31798818 GGGGGAGGCTCAGCTTGGGGGGG + Intronic
1126158568 15:45587540-45587562 GTGGGAAGCGCGGCCCGGGCTGG + Intronic
1127897624 15:63316265-63316287 GAGGGGGGCTCTTCCTGGGGAGG + Intergenic
1129280367 15:74480445-74480467 GTGGGAGGCTCAGGCATGGGGGG + Intergenic
1129392813 15:75228994-75229016 GTGGGAGGCAGGACCTGGGAGGG + Intergenic
1129410576 15:75348300-75348322 GAGCGAAGCTCGGCCTGGCGCGG - Intronic
1129424718 15:75455040-75455062 GCGGGAGGGGCGGCCGGGGGCGG - Intronic
1129788343 15:78323784-78323806 GTGTGGGGCTCTGCCTGGTGTGG - Intergenic
1130193951 15:81761616-81761638 GTGGAAGGCGGGGCCTGGGGAGG - Intergenic
1130460046 15:84153947-84153969 GTGGGAGGTTCGGGGTTGGGGGG - Intergenic
1131132299 15:89908113-89908135 ATGGGAGGCAAGGCCAGGGGTGG + Intronic
1131228223 15:90642544-90642566 GTGGGAGGCTCGGCCTGGGGCGG + Exonic
1131260436 15:90884770-90884792 GTGGGTGGAAGGGCCTGGGGAGG + Intronic
1131270855 15:90946915-90946937 GTGAGACGGTGGGCCTGGGGTGG + Intronic
1132304528 15:100801706-100801728 GAGCGAGGCACGGCCTGGAGGGG + Intergenic
1132462352 16:61769-61791 GTGGCAGGCAAGGCCTGGGTTGG - Intronic
1132597803 16:761248-761270 GCTGGAAGCCCGGCCTGGGGCGG - Intronic
1132749906 16:1452732-1452754 GTGGGAGGCTGGGCCCGGGCGGG - Intronic
1133023044 16:2975261-2975283 GTGGGAGGCCCTTCCTGGGACGG - Intronic
1133155567 16:3872890-3872912 GTGGGAGGCAGGCCCTGGGATGG - Intronic
1133320304 16:4909387-4909409 GTGGGAGGCTGAGGGTGGGGAGG - Intronic
1134021108 16:10922272-10922294 GTGGGTGGCTCAGCCCGGGGTGG + Intronic
1134625014 16:15717335-15717357 CTGAGCTGCTCGGCCTGGGGAGG + Exonic
1135676683 16:24421045-24421067 GTTGGAGGTGGGGCCTGGGGTGG + Intergenic
1135851510 16:25968061-25968083 GTGGGAGGCTCTTTCAGGGGAGG + Intronic
1136110039 16:28059047-28059069 GTGGGTGGCTCAGCCCAGGGTGG + Intronic
1136110691 16:28062548-28062570 CTGGGAGGTTCGGCGTGGGTTGG + Intronic
1136178245 16:28533319-28533341 AGAGGAGGGTCGGCCTGGGGTGG + Intronic
1136188365 16:28601124-28601146 GCTGGAGGCGCGGCCTGAGGTGG - Intergenic
1136190837 16:28614118-28614140 GCTGGAGGCGCGGCCTGAGGTGG - Intronic
1136412428 16:30085132-30085154 GACGGAGGCTGGGCGTGGGGGGG + Exonic
1136428368 16:30183790-30183812 GTGGGAGCCGCGGGCTGCGGGGG + Intronic
1136515547 16:30766133-30766155 GTGGGAGGCAGGGCCATGGGAGG - Intronic
1136909513 16:34134587-34134609 GTTGTAGGCTCAGCGTGGGGAGG + Intergenic
1137720565 16:50625275-50625297 AGGGGAGGTTTGGCCTGGGGAGG - Intronic
1137869876 16:51939810-51939832 ATGGGAGGCAGGGCCGGGGGAGG - Intergenic
1137979184 16:53055290-53055312 CTGGGAGGCGAGGGCTGGGGAGG - Intronic
1138497283 16:57416239-57416261 GTGAGAGGCCCGGGCAGGGGCGG + Intergenic
1138597799 16:58038429-58038451 GTCTGAGGCTCGGCCTGCCGAGG - Intronic
1139058166 16:63213184-63213206 GTGGGTGCCTAGGACTGGGGAGG + Intergenic
1139547553 16:67656736-67656758 GTGGGAGGCAAGGGCTGGAGTGG + Intronic
1139696452 16:68678698-68678720 GTGGGATCCTAGGCCTGGTGAGG + Intronic
1139920110 16:70454513-70454535 GACGGGGGCTCGGCCTTGGGGGG + Exonic
1139965088 16:70740884-70740906 GTGGGCGACTCTGCCTCGGGGGG + Intronic
1140442285 16:74997632-74997654 GTGGGAGGCTGGGGGTGGGGGGG - Intronic
1140473366 16:75226905-75226927 GTGGGGTGCACGGCCTGGGGTGG - Intergenic
1141655785 16:85415695-85415717 GTGGGAGGCGCAGCCCGGGTCGG + Intergenic
1141684345 16:85561807-85561829 GAGTGAAGCTCGGCCTGTGGGGG + Intergenic
1142009437 16:87706369-87706391 TTGGGGGGGTCGGCGTGGGGGGG + Intronic
1142413706 16:89929631-89929653 GTGGAAGGCTGTGCCTGGGGAGG - Intronic
1203079986 16_KI270728v1_random:1142055-1142077 GTGCGGGGCTCGGCCTGAGCTGG - Intergenic
1142489684 17:270177-270199 GTGGGTGGCTGGTGCTGGGGCGG - Intronic
1142592535 17:1012618-1012640 CTGGGGGGCCCGGGCTGGGGGGG + Intronic
1143391825 17:6563480-6563502 GTGTGAGGCTGGGGCAGGGGAGG - Intergenic
1143409763 17:6701889-6701911 ATGGGAGGCGGGGCCTGTGGTGG - Intronic
1143443532 17:6994210-6994232 GTGAGAGGCTAGGCCTAGAGAGG + Intronic
1143586921 17:7854996-7855018 GGGAGAGGCTGGGCCGGGGGAGG + Intergenic
1143780623 17:9226951-9226973 GTGTGAGGCGGGGCCTCGGGGGG - Intronic
1145941223 17:28744296-28744318 GCGGGGGGCGCCGCCTGGGGAGG + Intronic
1146654776 17:34628782-34628804 GGAGGAGGCTAGGCTTGGGGAGG + Intronic
1146799852 17:35809681-35809703 GAGGGAGGCTTGGGGTGGGGGGG + Intronic
1146892505 17:36515065-36515087 GTGGGAGGATGGGACTGGGGAGG - Intronic
1147306366 17:39567034-39567056 GAGGGAGGCTCTGCTTTGGGAGG + Intergenic
1147402866 17:40191551-40191573 GTGGGAGGCGGGGTCAGGGGCGG - Intronic
1147559250 17:41498948-41498970 GTGGGTGGCGGGGTCTGGGGTGG + Intergenic
1148240471 17:45996693-45996715 GTGGGGGGCTGCGCCTGGAGGGG + Intronic
1148562932 17:48616526-48616548 GTGTGGGGGTCGGCCTGGGAAGG - Intronic
1148648151 17:49230869-49230891 GAGGGAGGCGTGGCCTCGGGCGG - Intergenic
1148779423 17:50113087-50113109 GTGGGAGGCCAGGACTGGGAAGG - Intronic
1150675811 17:67245274-67245296 GCGGGAGGCGCGGCCGGAGGGGG - Intronic
1150682457 17:67294683-67294705 GTGGGAGACCCGTCCTGGGCTGG + Intergenic
1151595236 17:75074421-75074443 GGGGAAGCCTGGGCCTGGGGTGG - Intergenic
1151750423 17:76034086-76034108 ATGGGAGGCACTGCCTGGTGAGG + Intergenic
1151971555 17:77460075-77460097 GTTGGAGGTAAGGCCTGGGGGGG - Intronic
1152259509 17:79259519-79259541 CTGGGAGGCAAGGCCTGAGGAGG + Intronic
1152318423 17:79594454-79594476 GTGGGAGGCAGAGCCTGGAGGGG - Intergenic
1152577263 17:81148337-81148359 GTGGGAGGCTGAGCGTGGTGGGG - Intronic
1152585211 17:81186228-81186250 GCGGGAGGCTGGGAGTGGGGTGG - Intergenic
1152600425 17:81259489-81259511 GTGGGAGGGCTGGCCTGGGGAGG + Intronic
1152710437 17:81868444-81868466 GTGGGATGCACGGCCTCGTGGGG - Exonic
1152736812 17:82001155-82001177 GGAGGAGGCTGGGCCTGGAGCGG + Intronic
1152745415 17:82036494-82036516 GGGCGAGGCTGGGGCTGGGGTGG + Intronic
1152804833 17:82350645-82350667 GTGGGGGGCTCAGCCTGTGCAGG - Intergenic
1152945911 17:83197269-83197291 GTGGGAAGCCCAGCCTGGAGGGG + Intergenic
1153901620 18:9622176-9622198 GTGGGAGACTCCGTCTTGGGGGG + Intergenic
1154231385 18:12559129-12559151 GGGGGAGGCGCCCCCTGGGGAGG + Intronic
1154357574 18:13633506-13633528 GTGGGAGGCTGAGGCAGGGGTGG - Intronic
1155096228 18:22559227-22559249 GTGGGAGGATGGGGGTGGGGAGG + Intergenic
1156489036 18:37485594-37485616 GAGGAAGGCGCAGCCTGGGGAGG + Exonic
1157376960 18:47176058-47176080 GCGGAAGGCTCGGCTTGGAGTGG - Intronic
1157711033 18:49849932-49849954 GGAGGAGGCTTGGCTTGGGGAGG - Intronic
1159025677 18:63180513-63180535 GTGGGATGGGCGGTCTGGGGTGG - Intronic
1160201847 18:76802265-76802287 GTAGGAGGCTGGGGCTGGGCTGG + Intronic
1160398495 18:78590170-78590192 ATGGGAGACTCTGCCTGAGGAGG - Intergenic
1160691083 19:460929-460951 GTGGGCGCCTCGGGCTCGGGGGG + Exonic
1160703367 19:518386-518408 GAGGGAGGCCCGGGCTGGGTAGG + Intronic
1160721583 19:599456-599478 GGGAGGGGCTGGGCCTGGGGTGG + Intronic
1160767530 19:815089-815111 GCGGAAGGCTCGGCCAGGCGGGG + Intronic
1160771571 19:834316-834338 GTGGGTGCCGCGGACTGGGGAGG - Intergenic
1160829172 19:1095005-1095027 GTGGGCGGCTTGGGCTGGTGCGG - Intronic
1160838939 19:1137483-1137505 GGGGGAGGCTCGGGCTGGGGGGG + Intronic
1160858053 19:1226252-1226274 GCGGGAGGCTCAGCCCCGGGGGG + Intronic
1160914267 19:1489422-1489444 GTAGGAGGCTTGGCCCGGCGCGG - Intronic
1161018658 19:1997298-1997320 CTGGGGAGCTGGGCCTGGGGAGG - Intronic
1161087984 19:2343914-2343936 GGGGGAGGCACGGGCCGGGGTGG + Intronic
1161266312 19:3366333-3366355 GTGGGAGGTTCGGGGTGGGAGGG + Intronic
1161461506 19:4400373-4400395 GCGGGAGGCTCGGCGGCGGGCGG - Exonic
1161487526 19:4543916-4543938 GTGGGAGGCGCGGCCGGGCCGGG + Exonic
1161575521 19:5052445-5052467 GTGGAAGGCAGAGCCTGGGGTGG + Intronic
1161660699 19:5544174-5544196 GAGGGAGGCTCTGGCAGGGGCGG - Intergenic
1162018510 19:7858119-7858141 GCGGGAGGCAGGGCCTTGGGTGG + Intronic
1162419834 19:10559787-10559809 GTGTGTGGCTGGGGCTGGGGAGG - Intronic
1162461375 19:10816113-10816135 GGGGGAGGGTCCCCCTGGGGTGG + Intronic
1162729845 19:12711665-12711687 GGGGGAGGCACAGCTTGGGGAGG + Intronic
1162808262 19:13150185-13150207 GAGGGGGGTTCGGCCTGGGGGGG - Exonic
1163125684 19:15243112-15243134 GGTGGAGGCTGGGGCTGGGGTGG + Exonic
1163315514 19:16538159-16538181 GTTGGAGGCCTGGCTTGGGGAGG - Intronic
1163340707 19:16705002-16705024 TTGGGAGGCTTGGAGTGGGGGGG + Intergenic
1163415753 19:17185645-17185667 GTGGAAGGCTGGGGCTGGGGAGG - Intronic
1163634930 19:18433415-18433437 GTGGAGGGTTGGGCCTGGGGGGG - Intronic
1163720356 19:18895670-18895692 GTGGGGGCCTCGGGCTGGAGAGG - Intronic
1163737936 19:18992919-18992941 GAGGCAGGCTCCTCCTGGGGTGG - Exonic
1163758428 19:19120410-19120432 GCAGGAGGCGGGGCCTGGGGAGG - Intronic
1164575843 19:29404876-29404898 GAGGCAGGTCCGGCCTGGGGAGG + Intergenic
1165429913 19:35766779-35766801 GTGGGGGTCTGGGCCTGGGCTGG - Exonic
1165495654 19:36150872-36150894 GTGGGAGGATGGGCTTGGTGGGG + Intergenic
1165901161 19:39169959-39169981 GGGGGAGGCTCAGGTTGGGGTGG - Intronic
1166084835 19:40467553-40467575 GAGAGAGGCGCGGCCTGGGAAGG + Intronic
1166336339 19:42110368-42110390 GTGGGACGCACTGCCTGGGAAGG + Intronic
1166367249 19:42284020-42284042 GGGGGAGGCGCGGCGGGGGGAGG + Intronic
1166912928 19:46173700-46173722 GTTGGAGGTGAGGCCTGGGGAGG - Intergenic
1166922152 19:46236328-46236350 GTTGGAGGTGAGGCCTGGGGAGG + Intergenic
1166994054 19:46710870-46710892 GTTGGGGGCGGGGCCTGGGGCGG - Intronic
1167566004 19:50257487-50257509 GTGAGTGACTCAGCCTGGGGAGG + Intronic
1167657541 19:50775337-50775359 GTGGGAGGGGAGCCCTGGGGTGG - Intergenic
1167936571 19:52913563-52913585 TTGGGAGGCTGAGCCGGGGGCGG - Intergenic
1202715802 1_KI270714v1_random:41682-41704 GCTGGAGGCTCTGCCTGGGGTGG - Intergenic
925040929 2:732300-732322 GGGGGAGTCACGGCCCGGGGGGG + Intergenic
925041011 2:732518-732540 GGGGGAGTCACGGCCCGGGGGGG + Intergenic
925041061 2:732651-732673 GGGGGAGTCACGGCCCGGGGGGG + Intergenic
925041133 2:732835-732857 GGGGGAGTCACGGCCCGGGGGGG + Intergenic
925163261 2:1701597-1701619 GTGGGAGGTGCGGAATGGGGTGG + Intronic
925294324 2:2767548-2767570 GTGGGAGCCTGGCCCAGGGGAGG - Intergenic
925431988 2:3802567-3802589 CTGGCAGGCTCGGTCTGAGGAGG + Intronic
927477245 2:23423326-23423348 GTGGGAGGCACGGCCTGGGGAGG - Intronic
927841969 2:26450484-26450506 GCGGGAGGCTTGGCTTGTGGAGG - Intronic
928083985 2:28334311-28334333 GTGTGACTCTGGGCCTGGGGAGG + Intronic
928910744 2:36418391-36418413 TTGGGAAGCTGAGCCTGGGGAGG - Intronic
929880193 2:45829781-45829803 TTGGAAGGCTCGGCCGGGCGCGG + Intronic
931513318 2:63024053-63024075 GTGGGAGGATCAGCCAGGCGCGG + Intronic
931779564 2:65567496-65567518 GAGGGAGCCTCGGCCGGGCGCGG + Intergenic
932021728 2:68094460-68094482 GTGGCAGGGTGGGCATGGGGAGG - Intronic
932457206 2:71857426-71857448 GTGGGAGGCTCGGCCAGGCATGG + Intergenic
933415768 2:81985108-81985130 GTGGGAGGCCCTGTCTGGGCTGG + Intergenic
934556515 2:95289600-95289622 GGGGGAGGCTTGGCAGGGGGAGG - Exonic
935103630 2:100019843-100019865 GTGGGAGAGTTAGCCTGGGGAGG - Intronic
935245942 2:101219037-101219059 GAGGGAGGCTAGGGGTGGGGTGG - Intronic
936091963 2:109507259-109507281 CTGTGAGGCCCGGCCAGGGGTGG - Intergenic
937208089 2:120249675-120249697 GTTGGAGGCGGGGCCTGGTGGGG - Intronic
937643740 2:124243030-124243052 GTGTGGGGCTGGGACTGGGGAGG - Intronic
937894998 2:126971710-126971732 GTGGGAGGACCAGCCTGTGGAGG + Intergenic
937895009 2:126971742-126971764 GTGGGAGGACCAGCCTGTGGAGG + Intergenic
937937732 2:127259542-127259564 CAGGGTGGCTGGGCCTGGGGAGG - Intronic
938110657 2:128562826-128562848 GTGGGACGGTGGGCCTGGGGTGG + Intergenic
938397862 2:130963991-130964013 GGGGAAGGCTGGGCCGGGGGCGG - Intronic
939540161 2:143484120-143484142 TTGGGAGGCTGGGGGTGGGGTGG + Intronic
940883317 2:158968510-158968532 GCGGGAGGCGCGGCCGGGGCGGG + Intergenic
942304281 2:174590455-174590477 GTGGGTGGATCTGCCTGGGTGGG + Intronic
946190032 2:218003186-218003208 GTGGGGGGCACGGCCTGGGGGGG - Intergenic
946301439 2:218826890-218826912 ATGAGAGGCTCGGGCTGGGCTGG - Intronic
946386844 2:219388482-219388504 GGCGGAGGCGCGGCCTGGAGAGG - Intronic
947633310 2:231667057-231667079 ATGGGAGGGACGGCCCGGGGTGG + Intergenic
947736437 2:232457719-232457741 GTGGGAGGCACGGCAGGGGGAGG + Intronic
947904092 2:233747162-233747184 GTAGGAGGCACAGCGTGGGGTGG + Intronic
948465969 2:238151753-238151775 GAGGGAGGCAGGGCGTGGGGCGG + Exonic
948862684 2:240760614-240760636 GTGGGAGGGTCCTCCTGGGCAGG - Intronic
948919004 2:241052677-241052699 GTGAGAGGGTCGGCGGGGGGGGG + Intronic
948979108 2:241483737-241483759 GAAGGAGGCTGGCCCTGGGGTGG - Intronic
1168796056 20:610563-610585 CTGGGAGGGTCGGCCGGGGTGGG + Intergenic
1169036995 20:2461991-2462013 GTGGGAGGCTGGGGCAGGGTTGG - Intronic
1169074140 20:2751185-2751207 GTGGGTGGCTTGGGCTGGGGCGG - Intronic
1169524446 20:6408222-6408244 GTTGGAGGTGGGGCCTGGGGTGG + Intergenic
1169717688 20:8639019-8639041 GTGGGTGCCACTGCCTGGGGTGG + Intronic
1171318823 20:24220820-24220842 GTGGGAGGCTCAGGCATGGGGGG + Intergenic
1172113263 20:32559868-32559890 GTGGGCGGCAGGGCCTGGGCAGG - Intronic
1172762742 20:37333533-37333555 GAGGGAGGCCAGGGCTGGGGAGG + Intergenic
1172781488 20:37439403-37439425 GTGGGCGGCCTGGCCCGGGGAGG - Intergenic
1173017002 20:39234777-39234799 ATGGGAGGCCTGGCCAGGGGTGG + Intergenic
1173494338 20:43507871-43507893 GCGGGGGGCGCGGGCTGGGGAGG + Intronic
1174494885 20:50931884-50931906 GTGTGCGGGGCGGCCTGGGGCGG + Intergenic
1175103356 20:56596023-56596045 GTGGGGGGCGCGGGGTGGGGTGG - Intergenic
1175216015 20:57391997-57392019 GTGGGGGCCGGGGCCTGGGGTGG - Intronic
1175415922 20:58800928-58800950 GTGGGGGCCCTGGCCTGGGGAGG - Intergenic
1175466407 20:59193274-59193296 ATGGGAGGCTGGAACTGGGGTGG + Exonic
1175910648 20:62403820-62403842 CAGGGAGGCTCAGCCTGGTGTGG - Intronic
1175966584 20:62662823-62662845 GTGGGGGGATGGGGCTGGGGTGG - Intronic
1176169523 20:63690650-63690672 GGGGGAGTCTCAGCCTCGGGGGG - Intronic
1176234750 20:64049098-64049120 GGGGGGGGCTCGGGCCGGGGTGG - Intronic
1178374688 21:32056984-32057006 GAGGGAGGCGGGGCCAGGGGAGG + Intergenic
1179135580 21:38677513-38677535 GTGCAAGGATCGGCCTGGCGCGG + Intergenic
1179356496 21:40665192-40665214 GAGGCAGGCTGGGCATGGGGAGG + Intronic
1179473874 21:41631098-41631120 GTGGCAGGGCCGGCCTGGGCTGG + Intergenic
1179899054 21:44379498-44379520 GTGGGAGGCAGGCGCTGGGGAGG + Intronic
1179990578 21:44946479-44946501 GGAGGAGCCTTGGCCTGGGGAGG + Intronic
1180031357 21:45210745-45210767 ATGGGAGGCAAGGCTTGGGGTGG - Intronic
1180132215 21:45834098-45834120 GTGGCAGTCTCAGCCTGTGGGGG - Intronic
1180136522 21:45865863-45865885 TTGGGAGGCTCCGGCTGTGGGGG - Intronic
1180159914 21:45994389-45994411 GGGTGAGGCGCGGCCTGGGCCGG + Intronic
1180183638 21:46129030-46129052 GTGTGTGGCTCGGCCTTGGCAGG - Intronic
1180701212 22:17782270-17782292 GTGGGGGTCCCGGCGTGGGGTGG + Intergenic
1181043543 22:20204103-20204125 GTGGGTGGCTCTGCCGAGGGCGG + Intergenic
1181280587 22:21717122-21717144 TTGGGAGGCCGGGGCTGGGGGGG + Intronic
1181493989 22:23277736-23277758 GTGGGGGTCTGGGGCTGGGGTGG - Intronic
1182410747 22:30183361-30183383 GTTGGTGCCTGGGCCTGGGGAGG - Intergenic
1182485329 22:30635630-30635652 GGGCGGGGCTTGGCCTGGGGCGG + Exonic
1182822425 22:33228816-33228838 GTAGGAGATTTGGCCTGGGGAGG + Intronic
1183329452 22:37211729-37211751 TTGGGAGGCTGGGGCTGGGGAGG - Intronic
1183383803 22:37503650-37503672 GTGAGAGGCTGGGCCCTGGGAGG - Intronic
1183411115 22:37655512-37655534 GGGGGAGGCTGGACCTGGGGAGG - Exonic
1183678447 22:39312841-39312863 GAGAGAGGCTGGGACTGGGGAGG - Intergenic
1184717449 22:46290088-46290110 GTGGGAGGTTGGGCCTGGGGTGG - Intronic
1185156413 22:49195910-49195932 GTCGGAGGCTCAGTCTCGGGAGG - Intergenic
1185366206 22:50438056-50438078 GTGGGAGCCCCGGGCTGGAGGGG - Intronic
1185369863 22:50456033-50456055 CTGGGAGGCTGGGCCTGGCTGGG - Intronic
1185380749 22:50506590-50506612 GTGGGAGGCTGGGTAGGGGGTGG - Intronic
949927760 3:9055559-9055581 GAGGGAGGCTGGGCCTGGTAAGG + Intronic
950520087 3:13493025-13493047 GGGTGAGGCTAGGACTGGGGTGG - Intronic
950534038 3:13569241-13569263 GTGGGAGGGTCGGGTTGGGATGG + Intronic
950636035 3:14315531-14315553 GAGGGAGGCTCCGCCAGGGGAGG - Intergenic
952795272 3:37233264-37233286 GTGGGAGGCTCAGGCAGGGCAGG - Intergenic
953043749 3:39277571-39277593 GTCAGAGGCTGGGGCTGGGGAGG + Intronic
953472175 3:43176947-43176969 GTTGGAGGCACTGCATGGGGTGG + Intergenic
954177559 3:48856636-48856658 GTTGCAGGCTGGGCCTTGGGAGG + Intergenic
954332497 3:49898462-49898484 GGGACAGGCTGGGCCTGGGGTGG - Intronic
954625084 3:52018012-52018034 GTTGGGGGCTCAGCCTGGGTTGG + Intergenic
954976051 3:54696064-54696086 GTGGGAGGCATGGCCAGGGTCGG + Intronic
955391294 3:58524297-58524319 CGGGGAGGCTAGGCATGGGGTGG + Intronic
956040887 3:65143775-65143797 CTGGCAGGCTCAGCCTGTGGAGG + Intergenic
956048571 3:65222919-65222941 GTTGGAGGTGAGGCCTGGGGAGG + Intergenic
956675126 3:71725547-71725569 GTGGGAGGCACGGCCGGGCCGGG + Intronic
961010115 3:123429949-123429971 GGGGGCAGCTCGGCCTGGGAAGG + Intronic
961322165 3:126083840-126083862 GTCGGAGGGGCGGCCTGGGGCGG - Intronic
961433611 3:126901009-126901031 GTTGGAGGTAGGGCCTGGGGGGG - Intronic
961537105 3:127576941-127576963 CAGGGAGGCCTGGCCTGGGGTGG - Intronic
961827965 3:129608401-129608423 GTGGGTGGATGGGCCTGGGAGGG - Intergenic
962349131 3:134644113-134644135 GCAGGAGGCTCGGCCGGGCGCGG - Intronic
962479700 3:135787743-135787765 GTGGAAGAGTCAGCCTGGGGAGG - Intergenic
962873804 3:139520211-139520233 GTGGGAGGCCTGGGGTGGGGAGG - Intronic
963040164 3:141064630-141064652 GTGGGAGGTTGAGGCTGGGGAGG + Intronic
963479666 3:145855072-145855094 GTGGGAGGCTGGGCATTGTGTGG - Intergenic
964024650 3:152058000-152058022 GTGGGAGGCTGAGGCGGGGGAGG - Intergenic
964790552 3:160450154-160450176 GGGAGAGGCTGGGCCTGGCGCGG + Intronic
965514628 3:169607844-169607866 ATGGAAGGCTCTGCTTGGGGTGG + Intronic
966291199 3:178361398-178361420 GTGGGATGCTCGACCTTGGTGGG + Intergenic
967977075 3:195041363-195041385 CTGAGAGGCTCCGGCTGGGGCGG + Intergenic
968159724 3:196416194-196416216 GTGGGAGGCTGAGCGGGGGGCGG + Intronic
968287471 3:197517389-197517411 GTGGGGGGGTCAGCCTGAGGAGG - Intronic
968287530 3:197517602-197517624 TTGGGGGGGTCGGCCTGAGGGGG - Intronic
968287846 3:197518729-197518751 GGGGGGGGGTCGGCCTGAGGGGG - Intronic
968484374 4:851842-851864 GGGGGCGGCTTGGCCTGAGGGGG + Exonic
968519607 4:1029546-1029568 GGGGGAGGCTCAGCATGGCGGGG + Intergenic
968616647 4:1580563-1580585 GTAGGAGGCGGGGCCTAGGGCGG - Intergenic
968616686 4:1580655-1580677 GTGGGAGGCGTGGCCTGGGCGGG - Intergenic
968616729 4:1580767-1580789 GTGGGAGGCGGGGCCTTGAGTGG - Intergenic
968616735 4:1580785-1580807 GTGGGAGGCGGGGCCTGGGTGGG - Intergenic
968616745 4:1580804-1580826 GTGGGAGGCGGGGCCTTGAGTGG - Intergenic
968649296 4:1754062-1754084 GTGCCAGGCTCCCCCTGGGGAGG - Intergenic
968698475 4:2043709-2043731 GTGGGAGGCTCTGGGTGTGGGGG + Intronic
968730045 4:2265239-2265261 CTGGGAGCCCCTGCCTGGGGTGG - Intergenic
969078394 4:4598956-4598978 GTGGGAGGCTGGGCTGGGAGAGG + Intergenic
969493958 4:7515335-7515357 GTGGGAGACTGGGTCAGGGGCGG + Intronic
970574540 4:17414367-17414389 GAGGGAGGCTCGGGCGCGGGCGG + Intergenic
973754747 4:54064136-54064158 GCGGGAGGTGCGGGCTGGGGTGG - Intronic
977685540 4:99843115-99843137 GGGTGAGGCTGGGCCTGGGTGGG - Intronic
978303321 4:107294488-107294510 GGGCCAGGCTCGGCCTGGTGAGG + Intergenic
978999549 4:115200293-115200315 GTGGGAGGCTCAGCCATGGCGGG + Intergenic
979259185 4:118632970-118632992 GCAGGAGGCTGGGCCTGGAGAGG - Intergenic
979329164 4:119407589-119407611 GCAGGAGGCTGGGCCTGGAGAGG + Intergenic
982712164 4:158768836-158768858 GTGGGAGGTGCGGCCAGGAGCGG - Intergenic
985530872 5:433299-433321 GTGGCAGGCAGGCCCTGGGGAGG - Intronic
985672330 5:1213228-1213250 GTGGGGGGCGGGGCCTGCGGAGG - Intronic
985685447 5:1279457-1279479 GTGAGACGCTCGGCCTGGCGGGG + Exonic
985926454 5:3023238-3023260 CTGGGAAACTCAGCCTGGGGAGG - Intergenic
988110493 5:26813151-26813173 GTGGGAGGCCCTGCCTGGTGAGG - Intergenic
988461066 5:31438354-31438376 ATGGGAGGCTTAGGCTGGGGAGG + Intronic
988628329 5:32900968-32900990 GTGGGAGGGTGGGCCTGCGCTGG + Intergenic
988702173 5:33686219-33686241 GAGGGAGGCTGAGCCTGCGGGGG - Intronic
989023235 5:37035180-37035202 GTGGGAGGCTGAGCCTGGGAGGG + Intronic
992125827 5:73640110-73640132 ATGGTAAGCTAGGCCTGGGGTGG + Intronic
992597577 5:78361109-78361131 GAGGGGGGCCCGCCCTGGGGTGG + Intronic
994841330 5:104928925-104928947 GTGGGAGCCTCTTCCTGGGCTGG + Intergenic
996562260 5:124843555-124843577 GTGGCAGGATCGGCCTGGAGTGG - Intergenic
997583501 5:135031442-135031464 GCGGGAGGCACGGGCTGCGGCGG - Exonic
998159624 5:139806128-139806150 GTGGGAGACCCTGCCTGGAGAGG + Intronic
998454928 5:142264636-142264658 TTGGGAGGCTGAGGCTGGGGAGG - Intergenic
998475111 5:142413820-142413842 GTGGGAGGCTTGAGCCGGGGAGG + Intergenic
1001525620 5:172426617-172426639 GTGGTTGGCTGGGCCTGGGAGGG - Intronic
1001933387 5:175688381-175688403 GATGGTGGCTGGGCCTGGGGAGG - Intergenic
1002176569 5:177404300-177404322 GTCGGAGGCGCCGCCTGGGTTGG + Exonic
1002452426 5:179326476-179326498 GTGGGGGGCGGGGCCGGGGGCGG - Intronic
1002644864 5:180648164-180648186 GTGGGAGCCTGGTCCTGGGCTGG + Intronic
1003498853 6:6687447-6687469 GAGGGAGCCTGGGGCTGGGGAGG - Intergenic
1006347935 6:33498173-33498195 GTGGGAGGCACAGCCCTGGGTGG + Intergenic
1006599702 6:35217240-35217262 GGGGGAGGCGCGGCGGGGGGGGG + Intronic
1006634475 6:35452316-35452338 GAGGGAGGCGCGGCCGGGGGCGG - Intergenic
1007248952 6:40482744-40482766 GGGGGAGGCAGGGCCTGGGGTGG - Intronic
1013514772 6:110875502-110875524 GCGGGCGGCGCGGCCCGGGGTGG + Intronic
1017322017 6:153105411-153105433 GTAGGAGGCTGAGCCCGGGGTGG - Intronic
1017470665 6:154734120-154734142 GGGGGAGGGCCGCCCTGGGGCGG + Intronic
1017839464 6:158209849-158209871 GTGGGAGGCTCGGGCTGCACAGG + Intergenic
1018051460 6:160012635-160012657 ATTGGAGGCGGGGCCTGGGGAGG - Intronic
1018473249 6:164114783-164114805 GTGGGAGGATGGGGATGGGGTGG + Intergenic
1018746219 6:166764336-166764358 GTGGGAGGCTCTGCCCAGGGTGG + Intronic
1018779003 6:167045362-167045384 TTGGGAGGCTGGGCCGCGGGGGG - Exonic
1019035134 6:169048347-169048369 CTGGGTGGCTCCGCGTGGGGAGG - Intergenic
1019179416 6:170177273-170177295 GGGGGAGGGGCGGCCTGTGGGGG + Intergenic
1019707573 7:2503826-2503848 GTGGGAGGATCAGCTGGGGGTGG - Intergenic
1019743695 7:2688209-2688231 GTGGGCAGCTCGGCCTGGGCCGG - Intronic
1022045047 7:26616124-26616146 GTGGGAGGCACGGCCAAGGACGG + Intergenic
1022091435 7:27110339-27110361 GCAGGGGGCGCGGCCTGGGGCGG + Exonic
1022094499 7:27130375-27130397 GGGGGCTGCTCGGGCTGGGGCGG + Exonic
1022125461 7:27352098-27352120 GTGGGGGGGTCGGGCAGGGGAGG + Intergenic
1022303611 7:29125681-29125703 GTGGGAGAGTAGGCCGGGGGCGG - Intronic
1022721078 7:32942614-32942636 GCGGGGGCCTCGGCCCGGGGAGG - Intergenic
1022967618 7:35487993-35488015 GAGGGAGCCTAGGCATGGGGAGG - Intergenic
1024074092 7:45810016-45810038 GCAGGAGGCTGGGCCTGGAGAGG - Intergenic
1024230139 7:47357661-47357683 GAGGGAGGGTGGGCCTGGGAGGG - Intronic
1024649240 7:51390182-51390204 GCAGGAGGCTGGGCCTGGAGAGG + Intergenic
1024809909 7:53197224-53197246 GTTGGAGGGTGGGCATGGGGTGG - Intergenic
1025053319 7:55745512-55745534 GCAGGAGGCTGGGCCTGGAGAGG + Intergenic
1025131423 7:56375985-56376007 GCAGGAGGCTGGGCCTGGAGAGG + Intergenic
1025182230 7:56829054-56829076 GCAGGAGGCTGGGCCTGGAGAGG + Intergenic
1025689700 7:63747941-63747963 GCAGGAGGCTGGGCCTGGAGAGG - Intergenic
1025764614 7:64431242-64431264 GTGGGAGGCTGAGGCAGGGGCGG + Intergenic
1026036990 7:66836907-66836929 GGGGAAGGCTGGGGCTGGGGTGG + Intergenic
1026956010 7:74376848-74376870 GCGGGAGGGTCGGGCTGGGGAGG + Intronic
1026984328 7:74545615-74545637 GGGGAAGGCTGGGGCTGGGGCGG - Intronic
1027592570 7:80134785-80134807 GTGGGAGGGGCGGGCAGGGGCGG + Exonic
1028511189 7:91627491-91627513 GTGGGAGGCTCAGGCTTGGCGGG + Intergenic
1029496332 7:100897009-100897031 GTGCGGGGCGCGGCGTGGGGTGG + Intergenic
1029521609 7:101066402-101066424 GGGAGAGGCTCGGCCGTGGGAGG - Intergenic
1030733510 7:113017605-113017627 GTGGGAGGCTCAGGCATGGGGGG - Intergenic
1032469788 7:132169960-132169982 GTGGGAGGGACGGCCTGGGGAGG + Intronic
1032786810 7:135207642-135207664 GGGAGAGGCTCAACCTGGGGAGG - Intronic
1033477137 7:141702047-141702069 GCGGGAGGCTGGGGCCGGGGCGG - Exonic
1033582859 7:142752582-142752604 GTGGGAGCCTCAGCATGGGAAGG - Intronic
1033585884 7:142774067-142774089 GTGGGAGCCTCAGCATGGGAAGG - Intergenic
1033614398 7:142998815-142998837 GTGGGAGGATCGACCCTGGGAGG - Intergenic
1034119181 7:148611448-148611470 GAGGGAAGGTCGGCCAGGGGTGG + Intronic
1034468868 7:151245433-151245455 GTGGGAGGCCCGGCGAGGAGGGG - Intronic
1035074538 7:156169214-156169236 GTGGGAGGCTCAGGTGGGGGAGG + Intergenic
1035126068 7:156608262-156608284 GTGGGAGGAACGGCCTGGAGGGG - Intergenic
1035363292 7:158328522-158328544 GCGTGAGGCTCTGACTGGGGAGG + Intronic
1035833949 8:2728096-2728118 GGGGGAGGCTCGGGCTGCGCAGG - Intergenic
1036793918 8:11742069-11742091 GTGGGAGGCTGGTCCAGGAGAGG - Intronic
1037509137 8:19563879-19563901 GTGGGAGTCTAGGGTTGGGGAGG - Intronic
1037908291 8:22728181-22728203 GTGGGAGGCCCTGCTTGAGGTGG + Intronic
1038905974 8:31903437-31903459 GTTGAAGGCTCGGCCGGGCGCGG - Intronic
1039845927 8:41325384-41325406 GTGGGATGCTCTGGCTGGGCCGG - Intergenic
1040980064 8:53237895-53237917 GTGGGAGGATCTGGATGGGGTGG + Intronic
1041079938 8:54206639-54206661 TTAGGAGGCTCAGACTGGGGTGG + Intergenic
1042926352 8:73972056-73972078 GAGTGAGTCTCGGGCTGGGGCGG - Intronic
1045501874 8:102749746-102749768 GTGTGAGGCTGGAGCTGGGGTGG - Intergenic
1045776963 8:105815980-105816002 GTGGGTGGCTGGGGGTGGGGTGG - Intergenic
1046208862 8:111040936-111040958 GTGGGAGGCTCGGGCATGGCGGG + Intergenic
1047208167 8:122819943-122819965 ATGGGAGGGGAGGCCTGGGGAGG - Intronic
1048299032 8:133238075-133238097 GTGGGAGGTTGGGGCTGTGGAGG + Exonic
1048970934 8:139644716-139644738 GTGGGAGGCTCTGGGGGGGGGGG - Intronic
1048991684 8:139764179-139764201 GTGGGAGCTGCAGCCTGGGGTGG + Intronic
1049289002 8:141791714-141791736 GTGGGTGGCATGGCCTGGGCAGG + Intergenic
1049325217 8:142018040-142018062 GAGGCAGGCAGGGCCTGGGGTGG - Intergenic
1049428631 8:142549149-142549171 CTGGGAAGCAGGGCCTGGGGAGG - Intergenic
1049450759 8:142660261-142660283 CTGGGAGGCAGGGCCTGGGCAGG - Intronic
1049488009 8:142876523-142876545 GTGCGAGGCTGGGGCTGGGCTGG - Intronic
1049492897 8:142914546-142914568 GTGCGAGGCTGGGGCTGGGCTGG - Intronic
1049587960 8:143440653-143440675 GTGGGAGGCCCAGCCCCGGGAGG - Intronic
1049614221 8:143569183-143569205 CTGGGAGGCGGGGCCTGGGAGGG + Intronic
1049792332 8:144477903-144477925 GTCGGGGGCGGGGCCTGGGGAGG - Intergenic
1049867858 8:144950601-144950623 GGGGGCAGCTCGGCCTGGGCTGG - Intronic
1050797828 9:9567255-9567277 GTGGGAGGTTCTGCTAGGGGTGG + Intronic
1051374601 9:16390312-16390334 ATGGGAGGCTAGGCTGGGGGTGG - Intergenic
1051629371 9:19127730-19127752 GGCGGGGGCCCGGCCTGGGGAGG + Intronic
1051896856 9:21996117-21996139 GTGGGTGGCTCGGCCAGTGCAGG - Intronic
1053289803 9:36872452-36872474 GCAGGAGGCAGGGCCTGGGGAGG - Intronic
1053907110 9:42852881-42852903 GCGGGGGGCTCAGCCTGGGGTGG + Intergenic
1059498394 9:114729538-114729560 CTGGGAGGCTCTGAGTGGGGAGG + Intergenic
1060849177 9:126860630-126860652 GCGGGGGGCGCGGGCTGGGGCGG + Intergenic
1060890175 9:127183164-127183186 GTTGGAGGCGAGGCCTGGTGGGG - Intronic
1060918519 9:127405004-127405026 GTGGGAGGCTGGGCGAGGAGTGG + Intronic
1061503896 9:131019879-131019901 GTGCGGGGCCCGGCCGGGGGAGG - Intronic
1062262811 9:135671341-135671363 GTGACATGCTCGGCCTGGAGCGG + Intergenic
1062391531 9:136335885-136335907 GGGGGAGGCTGAGCATGGGGTGG - Intronic
1062405866 9:136395995-136396017 GTTGGAGGCTCTGCCTGCCGTGG - Intronic
1062465573 9:136679460-136679482 GTGGCCGGCGCGGCCTGGAGAGG - Intronic
1062579570 9:137223321-137223343 GAGGCAGCCTGGGCCTGGGGAGG + Intergenic
1062689078 9:137832257-137832279 GTGGGAAGCGGGGCCTGAGGAGG - Intronic
1062689096 9:137832323-137832345 GTGGAAGGCGGGGCCTGTGGAGG - Intronic
1062689114 9:137832389-137832411 GTGGGAGGCGGGGCCTGTGGAGG - Intronic
1203488611 Un_GL000224v1:82559-82581 GTTGGAGGTGGGGCCTGGGGAGG + Intergenic
1203501232 Un_KI270741v1:24454-24476 GTTGGAGGTGGGGCCTGGGGAGG + Intergenic
1185445395 X:255159-255181 GTGGGAAGCTCGGGCAGGGTGGG + Intergenic
1185999707 X:4995131-4995153 GTTGGAGGCGGGGCCTGGTGGGG + Intergenic
1186262661 X:7796369-7796391 GTGTGAGGCTCAGTCAGGGGTGG - Intergenic
1188482969 X:30653343-30653365 GTGGGGGGCGGGGCCTGGGCCGG + Exonic
1188771672 X:34161252-34161274 GTGGGTGGGTCTTCCTGGGGAGG - Intergenic
1189145988 X:38655229-38655251 GATGGAGGCTTGGCCTAGGGTGG + Intronic
1189209782 X:39275550-39275572 GTGGGAGCCTCTTCCTGGGCTGG + Intergenic
1190413938 X:50163430-50163452 GTGGGAGGCTCAGCCATGGCGGG + Intergenic
1190787501 X:53665901-53665923 GTGGGAGGATAAGCCTGAGGTGG + Intronic
1192212704 X:69137712-69137734 GTGGGAGAGGCAGCCTGGGGTGG - Intergenic
1192237645 X:69306094-69306116 CTGGGAGGCTCCGCCCGGGGTGG - Intergenic
1192326224 X:70134426-70134448 GTGGGAGGCTGGGCTGGGAGTGG - Intronic
1193897272 X:87128896-87128918 CTGGGATGCTCGACCTGGGTGGG + Intergenic
1195073794 X:101306671-101306693 TTGGGAGGCTGGGGCTGGTGAGG + Intergenic
1195197896 X:102516931-102516953 CTGGGAGGTGGGGCCTGGGGAGG - Intergenic
1195347147 X:103962454-103962476 CTGGGAGGTGGGGCCTGGGGAGG + Intronic
1195360295 X:104076387-104076409 CTGGGAGGTGGGGCCTGGGGAGG - Intergenic
1197870455 X:131058472-131058494 CTGGGGTGCTCGGCCGGGGGCGG + Intronic
1199484233 X:148331105-148331127 GTGGGAAGCTCGAACTGGGTTGG - Intergenic
1202379204 Y:24261226-24261248 GTGGGAGGTTCGGGGTTGGGGGG + Intergenic
1202491578 Y:25408895-25408917 GTGGGAGGTTCGGGGTTGGGGGG - Intergenic