ID: 1131228224

View in Genome Browser
Species Human (GRCh38)
Location 15:90642547-90642569
Sequence GGAGGCTCGGCCTGGGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1270
Summary {0: 1, 1: 0, 2: 8, 3: 101, 4: 1160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228215_1131228224 -3 Left 1131228215 15:90642527-90642549 CCGAAGGCGGGCCCGGAGTGGGA 0: 1
1: 0
2: 1
3: 4
4: 88
Right 1131228224 15:90642547-90642569 GGAGGCTCGGCCTGGGGCGGCGG 0: 1
1: 0
2: 8
3: 101
4: 1160
1131228210_1131228224 6 Left 1131228210 15:90642518-90642540 CCGTCCGCACCGAAGGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1131228224 15:90642547-90642569 GGAGGCTCGGCCTGGGGCGGCGG 0: 1
1: 0
2: 8
3: 101
4: 1160
1131228212_1131228224 2 Left 1131228212 15:90642522-90642544 CCGCACCGAAGGCGGGCCCGGAG 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1131228224 15:90642547-90642569 GGAGGCTCGGCCTGGGGCGGCGG 0: 1
1: 0
2: 8
3: 101
4: 1160
1131228206_1131228224 16 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228224 15:90642547-90642569 GGAGGCTCGGCCTGGGGCGGCGG 0: 1
1: 0
2: 8
3: 101
4: 1160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228224 Original CRISPR GGAGGCTCGGCCTGGGGCGG CGG Exonic
900087136 1:904111-904133 GGATGGGAGGCCTGGGGCGGAGG + Intergenic
900158816 1:1213887-1213909 GGAGGCTGGTCCTGGGGAGGGGG - Intronic
900284222 1:1891406-1891428 GGGGGCTCCTCCAGGGGCGGGGG + Intergenic
900342172 1:2194493-2194515 GGAAGCTCGGCGTGGGGTGGGGG + Intronic
900369757 1:2326448-2326470 GGAGTCTCGGCCTAGGGAGGAGG + Intronic
900372413 1:2337822-2337844 GGAGGCAGGGGCTGGGGCGGTGG + Intronic
900422183 1:2560447-2560469 GGAGGTGGGGCCTGGGGTGGTGG - Intronic
900423817 1:2567253-2567275 GGAGGCCCAGCCTGGGGGTGAGG - Intergenic
900565434 1:3329637-3329659 GAAGGCTCGCCCTGGGCTGGAGG - Intronic
900580766 1:3407509-3407531 GGAGTCAGGGGCTGGGGCGGGGG + Intronic
900926816 1:5711213-5711235 GGACTCTAGGCCTGGGGTGGAGG - Intergenic
901019756 1:6249694-6249716 GGGGGCCGGGCCCGGGGCGGCGG + Exonic
901058359 1:6460189-6460211 GCTGGCTGGGGCTGGGGCGGAGG - Exonic
901084578 1:6602786-6602808 GGAAGCACGGCCAGGGGCGCCGG + Exonic
901109781 1:6785462-6785484 GGTGGCTGGGCCGGCGGCGGCGG + Exonic
901236406 1:7669796-7669818 GGAGGCTCTCCCTGGGGATGAGG - Intronic
901627003 1:10630200-10630222 GGCAGCTGGGCCTGGGGCTGGGG - Exonic
901647722 1:10725671-10725693 GGAGGCCAGGCTTGGGGAGGAGG + Intronic
901812324 1:11774995-11775017 GGAGGCTTGGCCAGACGCGGTGG + Intronic
902041068 1:13492911-13492933 GGAGGTTAGGCCTGGGTCAGGGG - Intronic
902067248 1:13698927-13698949 TGAGGCTAGGCCGGGCGCGGTGG - Intergenic
902304110 1:15524280-15524302 GGGGGCAGGCCCTGGGGCGGGGG - Exonic
902385487 1:16073394-16073416 GGGGGCCCGGCCGGGGGCGGGGG - Intronic
902427756 1:16337970-16337992 GGAGGATTGGCCGGGCGCGGTGG + Intronic
902451488 1:16499324-16499346 AGAGGCTCAGGCCGGGGCGGAGG + Intergenic
902461437 1:16580333-16580355 GAAGTCTCGGCCGGGCGCGGTGG - Intronic
902462222 1:16586632-16586654 GAAGTCTCGGCCGGGCGCGGTGG - Intronic
902491715 1:16787102-16787124 GGATGTTCGGCCGGGCGCGGTGG - Intronic
903373642 1:22852567-22852589 GGAGGCCAGACCTGGGGCTGGGG + Intronic
903695000 1:25200131-25200153 GAGGGCTCGGGCTGGAGCGGGGG - Intergenic
904170974 1:28592139-28592161 GGAGGCGGGGGGTGGGGCGGGGG + Intronic
904202650 1:28831222-28831244 GAGGGCTCGGCCTGGTGTGGTGG + Intronic
904500902 1:30912362-30912384 GAAGGCTCTGACTGGGGTGGGGG - Intergenic
904590012 1:31608105-31608127 AGGAGCTCGGCCTGGCGCGGTGG + Intergenic
904682612 1:32239981-32240003 GGGGGCTCGTCCTTGGGCGCGGG - Intergenic
904720003 1:32500655-32500677 GGAGGCGCGGGCGGCGGCGGTGG + Intronic
904882525 1:33711777-33711799 AGAGGCTCGTGCTGGGGCAGAGG - Intronic
905060609 1:35136372-35136394 CGTGGCTCGGCCTGGCGAGGAGG + Intergenic
905432052 1:37931622-37931644 GGGAGCTGGGCCGGGGGCGGCGG - Intronic
905720965 1:40201336-40201358 GAGGGCTCGGCCGGGTGCGGTGG + Intronic
905806357 1:40880385-40880407 GGAGGCTGGGGGTGGGGTGGGGG + Intergenic
906293098 1:44632407-44632429 GGAGGCCGGGGGTGGGGCGGAGG - Intronic
906308960 1:44739458-44739480 GGAGACTTGGCCGGGCGCGGTGG - Intergenic
906504047 1:46364387-46364409 TGAAGCTCGGCCAGGTGCGGTGG + Intronic
907404625 1:54246343-54246365 GGAGAATAGGCCTGGGGAGGTGG - Intronic
908328273 1:63044822-63044844 TGAGTCTCGGCCGGGCGCGGTGG + Intergenic
908738930 1:67307748-67307770 TGAGGATCGGGCCGGGGCGGGGG - Exonic
908796269 1:67833503-67833525 GGAGGCAGGGCCCGGCGCGGAGG - Intergenic
909391426 1:75125725-75125747 GGAGCCTGGGCCTGGGATGGGGG - Intergenic
909972410 1:82006625-82006647 GGAGGCTCGGCCAGGTGGGGTGG + Intergenic
910185081 1:84530165-84530187 TTAGGCTCGGCCAGGCGCGGTGG - Intergenic
910473148 1:87576963-87576985 GGTGGCTCGGCCGGGGGCAGTGG - Intergenic
910935517 1:92482955-92482977 GGAGGCTCTGTCTGGGGCTTCGG + Exonic
912499303 1:110111459-110111481 GCAGGTTCGGCCAGGTGCGGTGG + Intergenic
912821562 1:112871829-112871851 GGAGGCTCAGCTTGTGGTGGTGG - Intergenic
913186272 1:116373231-116373253 GGAGGCGCGGGCTGGAGCTGCGG + Intronic
913247330 1:116881599-116881621 GAAGTCTCGGCCAGGTGCGGTGG - Intergenic
913250787 1:116910478-116910500 CGAGGCTCGGCCTGGCGGAGCGG - Intronic
913267509 1:117059796-117059818 CGCGGCTCGGCCTGCAGCGGCGG + Intergenic
913452810 1:119003568-119003590 AGGGTCTGGGCCTGGGGCGGTGG + Intergenic
913603241 1:120441885-120441907 GAAGTCTCGGCCTGGCGCGGTGG + Intergenic
913603988 1:120448237-120448259 GAAGTCTCGGCCTGGCGCGGTGG + Intergenic
914246008 1:145886155-145886177 TGAGGCGGGGCTTGGGGCGGAGG - Intergenic
914437550 1:147673054-147673076 AGAGGCTGGGCCGGGCGCGGTGG + Intergenic
915050264 1:153062794-153062816 GGATGCTGGGCCAGGCGCGGTGG + Intergenic
915070454 1:153261523-153261545 GGCGGCTCTGGCTGCGGCGGAGG + Exonic
915193183 1:154169121-154169143 GGAGGCATGGCCGGGCGCGGTGG - Intronic
915326458 1:155083428-155083450 GGAGCCTCGGCCTGCGGCACTGG - Intronic
915437290 1:155917584-155917606 GGGGGCTGGGGCTGGGGCTGGGG + Exonic
916812765 1:168319895-168319917 GGAGGCTGGGCGTAGGGCGTGGG + Intergenic
916975667 1:170074744-170074766 GCAGGCTCAGTCTGAGGCGGTGG + Intronic
917223076 1:172752557-172752579 GCAGGCACGGCCAGGTGCGGTGG + Intergenic
917852660 1:179078707-179078729 CAAGTCTCGGCCTGGGACGGTGG - Intergenic
917871980 1:179250116-179250138 GGAGTCTAGGCCGGGCGCGGTGG - Intergenic
917904969 1:179579587-179579609 AGAGGATGGGCCTGGCGCGGTGG + Intergenic
919375604 1:196790437-196790459 GGAATGTCGGCCTGGGGTGGTGG + Intronic
919385303 1:196915348-196915370 GGAATGTCGGCCTGGGGTGGTGG + Intronic
920022680 1:202967336-202967358 GGAGGCGGGGCCTGGCGGGGGGG + Intergenic
920245325 1:204583463-204583485 GGATGCTAGGCCTGGCGTGGTGG - Intergenic
920331512 1:205211568-205211590 GGAGGCCGGGCCTGCGGCCGGGG - Intergenic
920366258 1:205449827-205449849 GGATGCTGGGCCAGGGGCTGGGG + Intronic
921029791 1:211327045-211327067 GGCGGCTGGGCCGGGGGAGGCGG + Intronic
921065092 1:211616974-211616996 GGTGGGTCGGGCTGGGGCTGAGG - Intergenic
921093180 1:211862800-211862822 GGAGTCTCGGCCGGGCGCAGTGG + Intergenic
921644296 1:217595785-217595807 GAAGGATCGGCCGGGTGCGGTGG - Intronic
921739762 1:218670248-218670270 AGTGGCTCGGCCAGGCGCGGTGG - Intergenic
922513186 1:226186585-226186607 GGAGGAGCGGCCTGGGGCGGAGG - Exonic
922925372 1:229342919-229342941 AGAGGATCGGCCGGGCGCGGCGG - Exonic
923048458 1:230372873-230372895 GAAGGCTGGGCCAGGGGAGGAGG - Intronic
923126530 1:231039415-231039437 GGACGCGCGGCCTGGGGCGCCGG + Intronic
923473574 1:234313162-234313184 GGTGGCAAGGCCTGGCGCGGTGG - Intronic
923528732 1:234795437-234795459 GGATGTTCGGCCGGGCGCGGTGG + Intergenic
923611953 1:235504074-235504096 GGAGGCCCGGCTTGGTGCCGCGG - Intronic
923631156 1:235650104-235650126 GCGGGCCCGGGCTGGGGCGGGGG - Intronic
924267822 1:242300801-242300823 GGAGCCTCGGCGAAGGGCGGTGG + Intronic
924803450 1:247344492-247344514 GGAGGCTTGGCCAGGCGCGGTGG - Intergenic
1062843719 10:689462-689484 CGCGGCCCGGCCCGGGGCGGGGG + Intronic
1062899577 10:1132731-1132753 TGAGGCTGAGGCTGGGGCGGAGG + Intergenic
1063021818 10:2136594-2136616 GGAGGCTGGGCCTGGCTCAGAGG - Intergenic
1064365075 10:14700218-14700240 GGACGCCTGGCCTGGCGCGGTGG - Intronic
1064419659 10:15179890-15179912 GGAGGCTTGGCCGGGCGCAGTGG + Intergenic
1064764714 10:18659349-18659371 GGAGGCGGGGCTTGGGGCTGTGG + Intergenic
1064983788 10:21189752-21189774 GAAGGCTGGGCCAGGCGCGGTGG - Intergenic
1065175607 10:23072100-23072122 GAAGGCTAGGCCGGGCGCGGTGG - Intergenic
1065188660 10:23192181-23192203 GGAGGCGCGGCGGTGGGCGGGGG - Intergenic
1065393973 10:25214279-25214301 GGAGACTCGGCCAGGCGTGGTGG - Intronic
1065586933 10:27227998-27228020 GGAATCTCGGCCGGGCGCGGTGG - Intronic
1066309480 10:34182193-34182215 GTAGGCATGGCCTGGGGCAGGGG - Intronic
1067066025 10:43104826-43104848 GGAGGGGAGGCCTGGGGCCGCGG + Intronic
1067072747 10:43147260-43147282 AGATGCTCGGCCGGGCGCGGTGG - Intronic
1067077206 10:43194956-43194978 AAAGGCTGGGCCTGGGGAGGAGG - Exonic
1067096479 10:43304747-43304769 GGAGGCGGGTCCTGGGGCAGCGG + Intergenic
1067208696 10:44241082-44241104 TGAGACTCGGCATGGTGCGGTGG - Intergenic
1067317239 10:45180317-45180339 GGGGGCTGGGGCTGGGGCTGGGG + Intergenic
1067422131 10:46161081-46161103 AGAGTCTCGGCCGGGCGCGGTGG - Intergenic
1067507437 10:46867178-46867200 AGAGTCTCGGCCGGGCGCGGTGG - Intergenic
1069239130 10:66116936-66116958 GGAGGAGGGGCCTGGGGGGGTGG - Intronic
1069510040 10:69035371-69035393 GAAGGCCCGGCTTGGTGCGGTGG + Intergenic
1069706173 10:70460180-70460202 GGAGGGGAGGCCTGGGGCAGGGG - Intergenic
1069828143 10:71266648-71266670 GGAGGCTGGGGCAGGGGTGGAGG + Intronic
1069927691 10:71862466-71862488 GGAGGCTTGGCCAGGCACGGTGG - Intergenic
1069956308 10:72053970-72053992 GGAGGCTGGGGCTGCGGAGGAGG + Intergenic
1070235648 10:74622718-74622740 CCAGCCTCGGCCTGGTGCGGTGG + Intronic
1070281257 10:75050678-75050700 GCAGGCTCAGCGTGGAGCGGAGG - Intronic
1070757900 10:79004959-79004981 GGAAGCCCAGGCTGGGGCGGTGG - Intergenic
1070820455 10:79351057-79351079 GGGGACTCGGCCTGGGGAGCTGG + Intronic
1072878656 10:99203018-99203040 GGAGGCTCGTTCTGGGGCCATGG - Intronic
1073047116 10:100646109-100646131 GGAGGCTAGGACTGGGACTGAGG + Intergenic
1073105606 10:101030761-101030783 GGTGGCCCGGGGTGGGGCGGGGG + Intronic
1073122626 10:101131788-101131810 GGAGGCCCGGCAGGCGGCGGCGG + Exonic
1073428427 10:103470637-103470659 GGAGGCTCTCAGTGGGGCGGGGG - Intergenic
1073441971 10:103557528-103557550 GGAGGCCCCGCCTGGGAGGGCGG - Intronic
1073481521 10:103788952-103788974 TGAGGTCCAGCCTGGGGCGGGGG + Intronic
1073795137 10:106979073-106979095 GGAGGCTTGGCCCAGGGTGGTGG + Intronic
1074507623 10:114085612-114085634 GAAGGCTTGGCCTGGCACGGTGG + Intergenic
1075032043 10:119030068-119030090 GGGGGCCGGGCCTGGGGCGCTGG + Exonic
1075080803 10:119382210-119382232 GGAGGCTCTGCCTTGGGCTTAGG + Intronic
1075080810 10:119382233-119382255 GGAGGCTCTGCCTTGGGCTTCGG + Intronic
1075382660 10:122031688-122031710 GGAGGCTGGGCCAGGCGTGGTGG - Intronic
1075440802 10:122477933-122477955 GGAGGCTGGGACAGGGGAGGCGG + Intronic
1075908124 10:126100414-126100436 GGCTCCTCGGCCTGGCGCGGTGG + Intronic
1076127190 10:127984366-127984388 GGAGGCAGGGCCAGGCGCGGTGG - Intronic
1076249300 10:128972606-128972628 GGAGGTTGGGGCTGGGGTGGGGG + Intergenic
1076947941 10:133664831-133664853 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076948931 10:133668141-133668163 GGGGGCGCGGGCTGGGGAGGTGG - Exonic
1076949915 10:133671440-133671462 GGGGGCGCGGGCTGGGGAGGTGG - Intronic
1076950899 10:133674739-133674761 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076951889 10:133678049-133678071 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076952878 10:133681359-133681381 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076953862 10:133684658-133684680 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076954846 10:133741010-133741032 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076955835 10:133744320-133744342 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076956825 10:133747630-133747652 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076957812 10:133750939-133750961 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076958797 10:133754238-133754260 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076959786 10:133757548-133757570 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1076960770 10:133760847-133760869 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
1077097175 11:803983-804005 GGAGGGGCGGCCTGGAGCTGGGG + Intronic
1077103345 11:831757-831779 GGAGGCTTGTCATGGGTCGGGGG + Exonic
1077182905 11:1224455-1224477 GGAGGGGCTGCCTGGGGGGGAGG + Intronic
1077182931 11:1224514-1224536 GGAGGAGCTGCCTGGGGCGGGGG + Intronic
1077182949 11:1224554-1224576 GGAGGGGCTGCCTGGGGCTGGGG + Intronic
1077194352 11:1272005-1272027 GGAGGCTCAGCCCTGCGCGGTGG - Intergenic
1077210875 11:1370450-1370472 GGGAGCTCGGCCTGGGGCCTTGG + Intergenic
1077254417 11:1573910-1573932 GGAGGCTTGGCCCTGGGAGGGGG + Intergenic
1077265561 11:1647607-1647629 GAAGGCACGGCCGGGCGCGGTGG + Intergenic
1077282983 11:1753962-1753984 GGGGGCTGGGGCTGGGGCTGGGG - Intronic
1077293950 11:1815340-1815362 GGAGGCTGGGCCTGGGGCATGGG + Intergenic
1077308489 11:1878284-1878306 GGAGGCAGAGCCTGGGGCGCAGG - Intronic
1077347722 11:2071829-2071851 GGTGGCTTGGACTGGGGTGGGGG - Intergenic
1077413603 11:2414544-2414566 GACGGCTCTGCCTGGGGTGGAGG - Intronic
1077514197 11:2992031-2992053 GGAGCCCGGGCCTGGGGCGCTGG - Intronic
1077528697 11:3084729-3084751 GGGGGCTTGGCCAGGGGTGGTGG + Intergenic
1077580389 11:3413686-3413708 GCAGGGTGGGCCTGGGGCGTGGG - Intergenic
1078090769 11:8263184-8263206 GGGGGCCGGGGCTGGGGCGGGGG - Intronic
1078659800 11:13277741-13277763 GGGGGCCGGGCCTGGGCCGGCGG + Intronic
1078755507 11:14204972-14204994 GGAGGATCGGCCAGGCGCGGTGG - Intronic
1079035205 11:17014445-17014467 GGGGGCGCGGGCAGGGGCGGAGG + Intergenic
1080045210 11:27800857-27800879 TGGGGCTCGGCCGGGCGCGGTGG - Intergenic
1080685767 11:34513601-34513623 AGAGGCTCGGCCTGGGGCCTGGG - Intronic
1080886853 11:36376007-36376029 GGCAGCTGGGCCGGGGGCGGGGG + Exonic
1081369728 11:42284863-42284885 GATGGCTCGGCCAGGCGCGGTGG + Intergenic
1081545593 11:44069502-44069524 GGTGGCTTGGCCAGGCGCGGTGG - Intronic
1081575451 11:44316319-44316341 GGAGGCTCGGGTTGGCGCGGCGG - Intergenic
1081710473 11:45212636-45212658 GCAGCCTGGGCCTGGGGCGAGGG - Intronic
1081728633 11:45352642-45352664 GGAGGCTGGGCCGGGCGCAGTGG + Intergenic
1081773615 11:45664231-45664253 GGAGGCTGGGGCAGGGGAGGTGG - Intronic
1081812776 11:45922776-45922798 GGAGACTCAGCCCTGGGCGGCGG - Intronic
1081870722 11:46381541-46381563 GGGGGCGCGGGCTGGAGCGGGGG + Intronic
1082002365 11:47400250-47400272 GGGGGCCGGGCCTGCGGCGGGGG - Intergenic
1082011862 11:47455291-47455313 GGAAGCTTGGCCTGGTGCAGGGG + Intergenic
1083258719 11:61511644-61511666 GGAGGCTGGGCATGGGTCTGGGG + Intergenic
1083599391 11:63937487-63937509 ACAGGCTCGGCCGGGCGCGGTGG - Intergenic
1083757837 11:64801087-64801109 TGAGGCTGCGCCTGGGGCGGAGG - Intronic
1083760739 11:64815786-64815808 GGATGCTTGGCCAGGGGCAGTGG + Intergenic
1083951048 11:65956422-65956444 TGAGCCTCGGCCGGGCGCGGTGG - Intronic
1083955017 11:65978310-65978332 GGACGCTGGGGCTGGGGCTGGGG - Intronic
1084053616 11:66617065-66617087 GGAGGCGCGCTCGGGGGCGGGGG + Intronic
1084148087 11:67275555-67275577 GGAGGCTTGGTCCAGGGCGGTGG - Intronic
1084161717 11:67353717-67353739 GGAGGGGCAGGCTGGGGCGGGGG + Intronic
1084270502 11:68026923-68026945 GGAGGCTGGGGCTGGGGCTGGGG - Intronic
1084372060 11:68751051-68751073 GGAGGGGCGGCCAGGGGAGGGGG + Intronic
1084421637 11:69063451-69063473 GGAGGCTGGGCCTGGGGCGCAGG - Intronic
1084438407 11:69157226-69157248 GCAGGCCCGGGATGGGGCGGGGG - Intergenic
1084438823 11:69159062-69159084 GGAGGCTGGGCCTGGTGATGTGG + Intergenic
1084464162 11:69312596-69312618 GCAGGCTGGGCCTGGGGGAGTGG + Intronic
1084482896 11:69432344-69432366 GGATGCCCGTCCTGGGGCTGAGG + Intergenic
1084488523 11:69464806-69464828 GGAGGCCCAGCCAGGGGCTGTGG + Intergenic
1084628045 11:70323983-70324005 GGAGGCTAGGACAGGGGTGGTGG + Intronic
1084662154 11:70552305-70552327 CGAGGCTTGGCCTGGGCTGGAGG - Intronic
1084755245 11:71234523-71234545 GGAGGACCAGTCTGGGGCGGGGG - Intronic
1084773197 11:71357518-71357540 TGATGCTGGGCCTGTGGCGGGGG - Intergenic
1085266458 11:75240710-75240732 GGAGACTCCGCTGGGGGCGGAGG + Intergenic
1085272507 11:75278583-75278605 GGAGGCTCGGACTTGGCAGGGGG - Intronic
1085341386 11:75733708-75733730 CCAGGCTGGGGCTGGGGCGGGGG + Intergenic
1085461745 11:76698223-76698245 GCAGGCTTGGCCTGTGGCAGGGG - Intergenic
1085706335 11:78789515-78789537 GGAGGCTGGGCCTGGGGTCAGGG + Intronic
1086038518 11:82445654-82445676 AGAAGCTCGGCCAGGTGCGGTGG - Intergenic
1086113056 11:83219361-83219383 GGTGGCAAGGCCTGGGTCGGGGG + Intronic
1086133066 11:83420759-83420781 GGAGGAGCAGCCTGGGGAGGAGG - Intergenic
1086396531 11:86421595-86421617 GGATGATCGGCCGGGCGCGGTGG - Intronic
1087099012 11:94347351-94347373 TGAGGCGCAGCCTGGGGAGGAGG - Intergenic
1088674776 11:112181466-112181488 GAAAGCTCGGCCGGGCGCGGTGG - Intronic
1088918216 11:114242976-114242998 GGAGGCTGGGCCAGGTGCTGAGG + Intronic
1089241441 11:117084551-117084573 GGAGGCTGGGCCCGGCGCGGTGG - Intronic
1089359549 11:117876735-117876757 GGAGGCGCGTCCTGCGGGGGCGG + Exonic
1089472178 11:118730210-118730232 GGAGGAGCAGCCTGGGGAGGAGG + Intergenic
1090194070 11:124800168-124800190 GGGGTCTCGGGCTGGGGCTGGGG - Exonic
1091069330 11:132548424-132548446 GGAGGATGGGCCTAGGGCAGGGG + Intronic
1091390944 12:125756-125778 GGAGGAGCGGCCGGGGGCAGGGG + Exonic
1091866185 12:3839192-3839214 GGCGGCTCGGGCTGGGGCTCGGG - Intronic
1092062593 12:5563603-5563625 AGAGGCCCGGCCTGGGGAGGTGG + Intronic
1092644090 12:10550895-10550917 TGAGCCTCGGCCGGGCGCGGTGG + Intergenic
1093051160 12:14506449-14506471 GCAGGCTGGGCCTGGGGCCAAGG - Intronic
1094130430 12:27068927-27068949 GAAGTCTCGGCCGGGCGCGGCGG - Intergenic
1094510504 12:31093426-31093448 GAAGGGTCGGCCGGGTGCGGTGG + Intronic
1095221931 12:39626181-39626203 GGAGGTTGGGCCTCAGGCGGTGG + Exonic
1095752436 12:45727809-45727831 GGAGACCCGGCCCGGGGAGGTGG - Intergenic
1096073793 12:48789573-48789595 GGGGGCTGGGGCTGGGGCAGGGG - Intergenic
1096121437 12:49091775-49091797 GGAGCCGGTGCCTGGGGCGGGGG - Intronic
1096150304 12:49305708-49305730 GAAGGCTGGGCCGGGCGCGGTGG - Intergenic
1096191833 12:49624338-49624360 GGAGGCGAGGCCTTGGGCTGGGG + Intronic
1096264983 12:50115500-50115522 AGATGCTCGGCCGGGCGCGGTGG - Intronic
1096634328 12:52948989-52949011 GGCGGAGCGGCCCGGGGCGGAGG + Exonic
1096650225 12:53058907-53058929 GTGGGCTCTGCCTGGGGAGGAGG - Intronic
1096704233 12:53408617-53408639 GAAGGCTTGGCCGGGTGCGGTGG + Intronic
1096799638 12:54101598-54101620 GGTGGCTGTGCCTGGGGCAGGGG + Intergenic
1097060262 12:56277914-56277936 GAAGCCTCGGCCGGGTGCGGTGG - Intronic
1097196176 12:57243521-57243543 GGAGCCAGGGACTGGGGCGGGGG - Exonic
1097694090 12:62760399-62760421 GGAGGAGCAGCCTGGGGAGGAGG - Intronic
1097929423 12:65168208-65168230 GGAGGCGGGGCGGGGGGCGGGGG - Intergenic
1097990095 12:65825018-65825040 GGAGGCGCTGCCGGTGGCGGCGG - Exonic
1098161041 12:67648651-67648673 GGGGGCGGGGCCTGCGGCGGCGG + Intronic
1098306516 12:69108142-69108164 GGAGGCTGGGCCTTGAGAGGGGG - Intergenic
1099954281 12:89337662-89337684 GGAGACTAGGCCGGGCGCGGTGG + Intergenic
1099960824 12:89395359-89395381 GGAGGGTAGGCCGGGCGCGGTGG + Intergenic
1100089794 12:90955078-90955100 TGAGGCACGGGCTGGGGCCGGGG + Exonic
1101976406 12:109363424-109363446 GGAGCGTCGGCCGGGCGCGGTGG + Intronic
1102049290 12:109850670-109850692 GGAGGCCAGGCCTGGTGCAGTGG + Intergenic
1102278184 12:111598780-111598802 GGAGGCCCGGCCTGGGCAGGTGG - Exonic
1102322732 12:111951940-111951962 GGTGGCTTGGCCGGGTGCGGTGG + Intronic
1102525907 12:113512240-113512262 GGGGACTCTGCCTGGGGAGGAGG + Intergenic
1102644624 12:114396140-114396162 CGAGCCGCGGCCGGGGGCGGGGG + Intronic
1102963223 12:117107164-117107186 GGAGGCTGGGCAGGGGCCGGGGG + Intergenic
1103096452 12:118136419-118136441 GGAGACAGGGCCAGGGGCGGTGG + Intronic
1103188526 12:118981398-118981420 GGAGGCTGAGCCTGAGGAGGAGG + Intergenic
1103450205 12:121023575-121023597 CGACGCTCGGCCAGGTGCGGTGG - Intronic
1103800594 12:123534422-123534444 GGAGGCGCGCCCTGGGGCTCCGG - Intergenic
1103873591 12:124109687-124109709 GATGGCTCGGCCGGGCGCGGTGG - Intronic
1103946771 12:124531555-124531577 GGATGCTCAGCCCTGGGCGGGGG - Intronic
1103999887 12:124853816-124853838 GGCAGCTCGGTCTGGGGCGACGG + Intronic
1104290672 12:127463875-127463897 GGGGGCTGGGCCAGGGGAGGAGG + Intergenic
1104429649 12:128705930-128705952 GTGTGCTCGTCCTGGGGCGGCGG - Exonic
1104710443 12:130982086-130982108 GGAGGCTCTGCCTGGAGGAGTGG + Intronic
1104757804 12:131279691-131279713 GGAGTCTCTGCCTGGGGTCGGGG + Intergenic
1104815165 12:131641456-131641478 TGACCCACGGCCTGGGGCGGTGG - Intergenic
1104874113 12:132021225-132021247 GGGGCCTGGGGCTGGGGCGGGGG - Exonic
1104878517 12:132053391-132053413 GGGGGCTGCGGCTGGGGCGGGGG - Exonic
1104880078 12:132064719-132064741 GCAGACTGGGCCTGTGGCGGTGG - Exonic
1104884750 12:132100257-132100279 GGAGGCTCTGACTAGGGCTGTGG + Intronic
1104913220 12:132250268-132250290 GGATGCAGGGGCTGGGGCGGGGG + Intronic
1104946680 12:132417749-132417771 GGAGGCTGGGCCGTGGGAGGAGG - Intergenic
1104953789 12:132454150-132454172 GGAGGCCCGGGCTGGGGGTGGGG - Intergenic
1104968880 12:132522259-132522281 GGAGGCTCGGGCTCAGTCGGGGG - Intronic
1105206657 13:18231350-18231372 GGAGGCTTGGCTTGAGGCTGAGG - Intergenic
1105722605 13:23131848-23131870 CTAGTCTCGGCCTGGCGCGGTGG + Intergenic
1105859422 13:24395610-24395632 TGAGCCTGGGCCTGGGGCAGGGG - Intergenic
1105943375 13:25170570-25170592 AGAGGCAGGGTCTGGGGCGGCGG + Exonic
1105964524 13:25372313-25372335 GGAGGGTGGGCCCGGGGCGGGGG + Intronic
1106267769 13:28125343-28125365 GGAGGCTAGGCCAGGCGCGGTGG + Intergenic
1106340111 13:28819786-28819808 GGGGGCTGGGGCTGGGGCTGGGG + Intergenic
1107661374 13:42643073-42643095 GGAGGCCCTGCCTGGTGAGGAGG + Intergenic
1107865203 13:44696417-44696439 GTGGGCTGGGCCGGGGGCGGTGG + Intergenic
1108615569 13:52128924-52128946 GGAGTTTCGGCCTGGGGCGGCGG - Intronic
1108688992 13:52846051-52846073 GGAAGAGCGGCCCGGGGCGGCGG - Exonic
1108794534 13:54015313-54015335 GAATGTTCGGCCTGGTGCGGTGG + Intergenic
1109376637 13:61503622-61503644 GGAGCATAGGCCTGGTGCGGTGG + Intergenic
1109805832 13:67441769-67441791 AGAGACTCGGCCGGGTGCGGTGG + Intergenic
1110697167 13:78504478-78504500 GGAGTCTCGTCCTGTCGCGGTGG - Intergenic
1110821829 13:79925944-79925966 GGAGGCCCTGCCTGGTGAGGAGG + Intergenic
1111362213 13:87190522-87190544 GGAGGAGCAGCCTGGGGAGGAGG + Intergenic
1112035779 13:95495455-95495477 TGAAGCTCGGCCAGGCGCGGTGG + Intronic
1112277666 13:98036205-98036227 GGAATCTCGGCCAGGTGCGGTGG - Intergenic
1112385925 13:98939572-98939594 TTAGGGTGGGCCTGGGGCGGGGG + Intronic
1112402252 13:99086868-99086890 GGACGTGCGGCCCGGGGCGGAGG - Intergenic
1112461407 13:99606592-99606614 CGAGGCGGGGCCTGGGACGGGGG + Intergenic
1112508358 13:99988911-99988933 GGAGCCTGGGCCTGGGCCTGGGG + Intergenic
1113312040 13:109141004-109141026 GGCGGCCCGGGCGGGGGCGGGGG - Exonic
1113627752 13:111858838-111858860 GGGGACTGGGCCTGGTGCGGGGG + Intergenic
1113722989 13:112574901-112574923 GGAGACTGGGCCTGGCTCGGAGG - Intronic
1113775710 13:112943734-112943756 GGTGGCTCGGCTCGGGCCGGCGG + Intronic
1114270710 14:21098431-21098453 GGGGGCCGGGCCGGGGGCGGGGG - Exonic
1114290807 14:21286871-21286893 GGAGACTGGGCCTGGCACGGTGG + Intergenic
1114620599 14:24094146-24094168 GGAGGCAGGGGTTGGGGCGGCGG + Exonic
1116605009 14:46981114-46981136 AGAGTCTGGGCCTGGCGCGGTGG + Intronic
1116835742 14:49767989-49768011 GGAGGCGCGGGCAGAGGCGGCGG + Exonic
1117548166 14:56809615-56809637 TGCGGGTCGGCCTGGGCCGGGGG - Intronic
1117548548 14:56812045-56812067 TCGGGCTCGGCCTGGGGCTGGGG + Intergenic
1118356834 14:65021015-65021037 GGAAGCTAGGCCGGGTGCGGTGG - Intronic
1118393717 14:65317844-65317866 CCAGGCTCGGCCGGGCGCGGTGG - Intergenic
1118925771 14:70188735-70188757 GGAGTCCCGGCCGCGGGCGGCGG + Exonic
1119090705 14:71778427-71778449 GGAGGCTTGGCCGGGCGCGGTGG - Intergenic
1119234026 14:73004708-73004730 GGAGGCTAGGCCAGGTGCAGTGG + Intronic
1119271370 14:73308018-73308040 AGAGGCCCGGCCGGGCGCGGTGG - Intronic
1121200612 14:92114102-92114124 GGAGGCTGGGCCAGGCGCAGTGG - Intergenic
1121473438 14:94174231-94174253 GGGGGCGGGGCCAGGGGCGGGGG - Intronic
1121645810 14:95516555-95516577 GGAGGCCAGGCCTGGGGCCGGGG - Intronic
1122220952 14:100238956-100238978 GGAGGCGCGGCCAGGGCGGGCGG + Intronic
1122293531 14:100692609-100692631 GGGGACTCAGCCTGGGGCAGGGG - Intergenic
1122599446 14:102914003-102914025 GAAAGCAAGGCCTGGGGCGGAGG + Intergenic
1122620826 14:103056934-103056956 GGATGCGCGGGCTGGGGCGCGGG + Intronic
1122633845 14:103121290-103121312 GGGGGCTCTGCCTGGTGGGGAGG - Intergenic
1122785901 14:104163114-104163136 GGAGGCTGAGGCTGGGGTGGTGG + Intronic
1122798961 14:104220457-104220479 GGAGGCCCAGCCTGCGGCGGTGG + Intergenic
1122898089 14:104770333-104770355 AGCGGCACGGCCTGAGGCGGCGG - Exonic
1122917273 14:104865048-104865070 GGAAGGTGGGCCTGGGGCAGGGG + Intergenic
1123001972 14:105300704-105300726 GGCGGCTGGGCCTGGGCGGGCGG - Exonic
1123012495 14:105356163-105356185 GCAGGCTGGGCCTGGGGGTGTGG - Intronic
1123024857 14:105419805-105419827 GGAGGAGCGGCCGCGGGCGGCGG - Exonic
1123031883 14:105455848-105455870 GAGGGCTGGGCCTGGGGAGGAGG + Intronic
1123470865 15:20551122-20551144 GAAGGATCGGCCTGGCGTGGTGG + Intergenic
1123647195 15:22449588-22449610 GAAGGATCGGCCTGGCGTGGTGG - Intergenic
1123731167 15:23146109-23146131 GAAGGATCGGCCTGGCGTGGTGG + Intergenic
1123749305 15:23343527-23343549 GAAGGATCGGCCTGGCGTGGTGG + Intergenic
1124281676 15:28367411-28367433 GAAGGATCGGCCTGGCGTGGTGG + Intergenic
1124301027 15:28544203-28544225 GAAGGATCGGCCTGGCGTGGTGG - Intergenic
1124612143 15:31215996-31216018 GGATTCTCGGCCTCGGGCTGAGG - Intergenic
1125485598 15:40108792-40108814 GGAGGCGCAGGCAGGGGCGGCGG + Exonic
1125539920 15:40464322-40464344 GAATGCTTGGCCTGGGGCAGGGG + Intronic
1125691709 15:41601185-41601207 GGAGACAGGGCCTGGTGCGGTGG + Intergenic
1125699023 15:41663756-41663778 GTAGGCTAGGCCGGGAGCGGTGG - Intronic
1125999309 15:44194731-44194753 GGAGACTCGCCCCGCGGCGGCGG + Intronic
1127103170 15:55588000-55588022 CGAGGCACGGCCGAGGGCGGTGG + Intronic
1127225084 15:56919256-56919278 GGAGGCCGAGCCTGGGGAGGAGG + Intronic
1127562830 15:60157625-60157647 GGAGGCCCGGCCAGGGGCAGTGG + Intergenic
1127877242 15:63121996-63122018 GGGGCCTCGGGCTGGGGCTGGGG + Exonic
1127995747 15:64152346-64152368 AGAGGCTGGGCCGGGGCCGGTGG - Intronic
1128462934 15:67884831-67884853 TGGGGCTCGGCCTGGGGCCGTGG - Intergenic
1128522414 15:68384571-68384593 GGTGGCTTGGCCTGGGGCCCTGG + Intronic
1128739834 15:70075995-70076017 TGAGGCTGGGGCTGGGGCTGGGG + Intronic
1129052386 15:72793292-72793314 GAAGGGTAGGCCTGGTGCGGTGG - Intergenic
1129296588 15:74603433-74603455 GAAGGCAGGGCCTGGGCCGGGGG - Intronic
1129341075 15:74887114-74887136 GGAGGTTTGGCCTGACGCGGTGG + Intergenic
1129387217 15:75202577-75202599 GCAGGATCGCCCTGAGGCGGAGG + Intronic
1129410573 15:75348297-75348319 CGAAGCTCGGCCTGGCGCGGGGG - Intronic
1129424792 15:75455309-75455331 GCGGGCTCGGCAGGGGGCGGCGG - Intronic
1130512338 15:84600358-84600380 GGTGTCTCTGCCTGGGGAGGTGG + Intergenic
1130649935 15:85756682-85756704 CGGGGCTGGGCCTGGGGCCGGGG + Intergenic
1131144313 15:90001633-90001655 TGGGGCTGGGGCTGGGGCGGGGG - Intronic
1131145823 15:90011215-90011237 GGAGGCTAGGCCGGGCGCAGTGG - Intronic
1131184935 15:90265924-90265946 GGGGGCGCGGCCTGGAGCGCCGG - Intronic
1131228224 15:90642547-90642569 GGAGGCTCGGCCTGGGGCGGCGG + Exonic
1131292519 15:91118947-91118969 GGAGGCAGGGCCTGTGGGGGTGG + Intronic
1131368893 15:91863316-91863338 GGAGGCTTGTCCTGGGTCTGTGG + Intronic
1131630608 15:94173323-94173345 GGAGGCGTGGCCGGGCGCGGTGG + Intergenic
1132059085 15:98676421-98676443 AGAGTCTCGGCCAGGAGCGGTGG - Intronic
1132208903 15:100005960-100005982 GCAGGCTGGGGCTGGGGCTGGGG - Intronic
1132555124 16:568890-568912 GGCGGGGCGGCCTGGGGCAGGGG + Exonic
1132724119 16:1331482-1331504 GGAGGGTCGCCCTGGGGCAGGGG + Intergenic
1132728227 16:1348032-1348054 GGAGCCTGGGGCTGGGGCTGGGG - Intronic
1132886155 16:2183072-2183094 GGAGGTGCGGCCGGGCGCGGTGG - Intronic
1132964939 16:2647703-2647725 GGGGGCTCGGGCTCGGGCTGGGG - Intergenic
1132979518 16:2729325-2729347 GGAGGCTAGGCCAGGCGCAGTGG + Intergenic
1133031628 16:3013918-3013940 GGCCGCTCGACCTGGGGCGGGGG - Exonic
1133135188 16:3706239-3706261 GGAAGCTGGGCCTGGTGCAGTGG - Intronic
1133138360 16:3727971-3727993 GGAGGCTGGGACTGGGGCCGTGG + Exonic
1133138639 16:3729192-3729214 GGGGGCTGGGCCGGGGGTGGGGG + Exonic
1133203770 16:4220578-4220600 GGAGGCCCGGCCTGAGGGGCGGG - Intronic
1133282482 16:4674925-4674947 GGTGGCTCGGCCAGGCGCGGTGG - Intronic
1133284232 16:4683156-4683178 GGCGGCTTGTCCTGGAGCGGTGG + Intronic
1133303215 16:4795555-4795577 AGAAGCTGGGCCTGGGGCCGAGG + Intronic
1133801970 16:9091825-9091847 GGTGGGAAGGCCTGGGGCGGGGG + Exonic
1134091224 16:11392582-11392604 TGAGGCTTGGCCTGGGGCAGTGG - Intronic
1134364439 16:13563725-13563747 AGAGGCTCAGCCGGGCGCGGTGG - Intergenic
1134414237 16:14029984-14030006 GGATGCTGGGCATGGGGAGGGGG + Intergenic
1134529614 16:14972967-14972989 AGAGGCTGGGCCGGGCGCGGTGG - Intergenic
1134839540 16:17390746-17390768 GGAGCCTTGGCCAGGGGCAGTGG + Intronic
1135126051 16:19810207-19810229 GGATGTTCGGCCAGGCGCGGTGG + Intronic
1135521631 16:23182665-23182687 GGGGGCGGGGCCTGGGGAGGCGG + Intergenic
1136080419 16:27848906-27848928 GTAGGATGGGCCTGGTGCGGTGG + Intronic
1136178246 16:28533322-28533344 GGAGGGTCGGCCTGGGGTGGAGG + Intronic
1136188401 16:28601246-28601268 GGAGGAGCTGGCTGGGGCGGAGG - Intergenic
1136190870 16:28614240-28614262 GGAGGAGCTGGCTGGGGCGGAGG - Intronic
1136316190 16:29455769-29455791 GGGGCCGGGGCCTGGGGCGGTGG - Exonic
1136347170 16:29683644-29683666 CAATGCTCGGCCAGGGGCGGTGG - Intronic
1136430767 16:30195111-30195133 GGGGCCGGGGCCTGGGGCGGTGG - Exonic
1136478358 16:30526717-30526739 GGGGGCTCGGGCGGGAGCGGGGG - Intronic
1136584219 16:31173562-31173584 GGAGGCTGAGTCTGGGGCAGGGG - Intergenic
1136617515 16:31407685-31407707 GCAGGCTGAGCCTGGGGCAGGGG - Intronic
1136923375 16:34350250-34350272 GGGAGCGCGGCCTGGTGCGGGGG - Intergenic
1136981198 16:35061556-35061578 GGGAGCGCGGCCTGGTGCGGGGG + Intergenic
1137288082 16:47032852-47032874 AGAGGCTGGGCCTGGCACGGTGG + Intergenic
1137707936 16:50548346-50548368 GGAGGCGCGGGCCGCGGCGGCGG + Exonic
1137768625 16:50996799-50996821 GGAGGGTGGGCCTGGGGGAGGGG - Intergenic
1138101474 16:54255331-54255353 AGAGGTTCTGCCTAGGGCGGAGG + Intronic
1138594544 16:58022801-58022823 GCAGGCTGGGCCTGAGGAGGAGG + Intergenic
1139597861 16:67968618-67968640 GGCGTGTCGGCCCGGGGCGGCGG - Exonic
1139716589 16:68818559-68818581 GGAGTTTCGGCCGGGCGCGGTGG + Intronic
1139879549 16:70172596-70172618 GGTGGCTCGGCCAGGTGTGGTGG + Intergenic
1139916733 16:70432971-70432993 GGAGCCTTGCCCTGAGGCGGTGG - Intronic
1140372975 16:74422952-74422974 GGTGGCTCGGCCAGGTGTGGTGG - Intergenic
1140442284 16:74997629-74997651 GGAGGCTGGGGGTGGGGGGGTGG - Intronic
1140473357 16:75226868-75226890 GGCGGCTCTGCCTGTGGCCGGGG - Intergenic
1140858420 16:78998162-78998184 GGAGGCTAGGCCGGGCGCGATGG - Intronic
1141452546 16:84115211-84115233 GAAGGCTGGGCCGGGCGCGGTGG - Intronic
1141586182 16:85035033-85035055 GACGGCTCGGCCTGGGGAAGGGG - Intronic
1141610194 16:85176905-85176927 AGAGCCTGGGCCTGGGGAGGAGG - Intronic
1141620897 16:85236003-85236025 TGAGGCTGGGCCTGGGGCTGCGG + Intergenic
1141632036 16:85293256-85293278 GGTGGCTTGGCCTGGCACGGTGG + Intergenic
1141934236 16:87226681-87226703 TGAGGCTAGGCCGGGCGCGGTGG + Intronic
1141989605 16:87602552-87602574 GGCGGCTCGGGCGGCGGCGGCGG - Intronic
1142002230 16:87670514-87670536 GGAGGCTGGGCCTGGGGAGAGGG - Intronic
1142055013 16:87988550-87988572 TGAGTCCCGGCCGGGGGCGGTGG - Intronic
1142126290 16:88412169-88412191 GCAGGGTGGGCCTGGGACGGTGG - Intergenic
1142163321 16:88570592-88570614 GGAGGCCGGGCCGGCGGCGGCGG + Intronic
1142185672 16:88693690-88693712 GGGGGCCCGGCCTGGGGCCAGGG + Intergenic
1142656692 17:1399527-1399549 GGAGGCCCCGTGTGGGGCGGCGG - Intronic
1142750864 17:1986827-1986849 AGAGCCTGGGCCTGGGTCGGGGG - Intronic
1142807839 17:2380713-2380735 GGAGGCCCTGCCCGGGGCTGGGG + Exonic
1142848191 17:2692104-2692126 GGAGGCGCGGCGCGGGGCGAGGG + Intronic
1142903135 17:3025927-3025949 AGAGGCTCTGCCTGGGGCCGTGG + Intronic
1142983818 17:3686040-3686062 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142983844 17:3686108-3686130 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142983891 17:3686237-3686259 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142983938 17:3686366-3686388 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142983964 17:3686434-3686456 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142983990 17:3686502-3686524 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984016 17:3686570-3686592 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984042 17:3686638-3686660 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984087 17:3686767-3686789 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984113 17:3686835-3686857 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984139 17:3686903-3686925 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984165 17:3686971-3686993 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984210 17:3687100-3687122 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984255 17:3687229-3687251 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984280 17:3687297-3687319 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984325 17:3687426-3687448 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984350 17:3687494-3687516 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984395 17:3687623-3687645 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984420 17:3687691-3687713 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984465 17:3687820-3687842 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984490 17:3687888-3687910 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1142984521 17:3687967-3687989 TGAGGCTGGGCGGGGGGCGGGGG - Intronic
1143244757 17:5474703-5474725 GGAGGCTTCGCCTGGGGTGAGGG - Exonic
1143482517 17:7235904-7235926 AGAGGTTCGGGCTGGGGCGAGGG - Intronic
1143607168 17:7994131-7994153 GCAGGCTCGGCCGGGCGGGGAGG - Intergenic
1143727641 17:8860437-8860459 GGGGGCTGGGGCTGGGGCTGGGG - Intronic
1143747163 17:9003211-9003233 GGAAGCTCTGGCTGGGGCTGCGG + Intergenic
1143994692 17:10996535-10996557 GGAGGCTCGGCCTGGACCTAGGG + Intergenic
1144237060 17:13271894-13271916 TGAGTCTTGGCCGGGGGCGGTGG - Intergenic
1144380211 17:14687502-14687524 GGAGGCTCAGCCTGGAGCACCGG - Intergenic
1144628522 17:16857795-16857817 GGAGGCTGGGCCAGGGCCTGGGG + Intergenic
1144726287 17:17504223-17504245 GGGGGCTGGGGCTGGGGCTGGGG + Intergenic
1144728697 17:17514630-17514652 AGAGGCTCGGCCTGGAGCTGCGG - Intronic
1144828946 17:18121268-18121290 AGCGGCTCGGCGTGGGGCTGGGG - Exonic
1144950832 17:18992586-18992608 GGGGGCTCTGGCTGGGGCTGAGG - Intronic
1144957391 17:19025899-19025921 GCAGGCTCGGCTGGGTGCGGTGG - Intronic
1144977765 17:19148617-19148639 GCAGGCTCGGCTGGGTGCGGTGG + Intronic
1145038833 17:19561354-19561376 AGAGGCTCGGCCGGGCGCGGTGG + Intronic
1145160108 17:20568366-20568388 GGAGGCTGGGCCAGGGCCTGTGG + Intergenic
1146122631 17:30208987-30209009 AGAGTCTCGGCCAGGCGCGGTGG - Intronic
1146257681 17:31400979-31401001 TGAGGCTTGGCCGGGAGCGGTGG + Intronic
1146627274 17:34444135-34444157 GGAGCCCCGGCTTGGGGAGGTGG + Intergenic
1146681740 17:34813299-34813321 GGGGGCTGGGCCTGGGGAAGTGG + Intergenic
1146799853 17:35809684-35809706 GGAGGCTTGGGGTGGGGGGGCGG + Intronic
1146846439 17:36184123-36184145 GGAGGCTGGGGCTGGGTCGTGGG + Intronic
1147158594 17:38558203-38558225 TGAGGCTGGGCCCGCGGCGGAGG - Intronic
1147172080 17:38627491-38627513 GAATGCTAGGCCGGGGGCGGTGG + Intergenic
1147306369 17:39567037-39567059 GGAGGCTCTGCTTTGGGAGGGGG + Intergenic
1147394544 17:40131605-40131627 GCTGGCTGGGCCTGGGGTGGGGG + Intronic
1147407684 17:40224531-40224553 GCAGGCTGGGCCGGGCGCGGTGG - Intronic
1147724554 17:42558513-42558535 TGAGACTCGGCCGGGTGCGGTGG + Intergenic
1147745715 17:42693244-42693266 GGAGGCAGGGCCAGGCGCGGTGG - Intronic
1147854260 17:43466842-43466864 ACAGGCTCGGCCGGGCGCGGTGG - Intergenic
1147884133 17:43673328-43673350 GAAGGCTCGGCCGGGTGCGGTGG - Intergenic
1147907655 17:43833231-43833253 GGAGGCGCGGCGCGGGGAGGAGG + Intergenic
1147907661 17:43833249-43833271 GGAGGCGCGGCGCGGGGAGGAGG + Intergenic
1147953443 17:44119671-44119693 GGAGGCTCAGCCTGTGGCTCTGG - Intronic
1147977140 17:44254459-44254481 GGGGGCTGGGCCTGGGAGGGTGG - Intronic
1148071526 17:44911523-44911545 AGAGGCGGGGCCTGGGGCCGGGG - Intronic
1148326751 17:46787664-46787686 GTAGCCTCGGCCGGGCGCGGTGG + Intronic
1148342960 17:46884367-46884389 GGGGGCTGGGTGTGGGGCGGGGG - Intronic
1148523874 17:48311027-48311049 CGTGGCTCAGCCTGGGGGGGCGG - Intronic
1148612745 17:48975309-48975331 CCAGGCTGGGCCTGGTGCGGTGG + Intergenic
1148629980 17:49099977-49099999 GTAGACTCGGCCGGGCGCGGTGG + Intergenic
1148740299 17:49889065-49889087 GGAGGGTAGGCCGGGTGCGGTGG + Intergenic
1148753600 17:49960330-49960352 GGAGACTGGGCCGGGCGCGGTGG - Intergenic
1149768260 17:59298435-59298457 GGAGTATCGGCCGGGCGCGGTGG - Intergenic
1149834610 17:59901434-59901456 GGAGTCTCGGCCAGGCGCGGTGG - Intronic
1149849248 17:60025772-60025794 GCAGGCCCGGCATGGCGCGGCGG - Intergenic
1149860920 17:60120752-60120774 GCAGGCCCGGCATGGCGCGGCGG + Intergenic
1150675810 17:67245271-67245293 GGAGGCGCGGCCGGAGGGGGCGG - Intronic
1150687537 17:67332571-67332593 GGAGTCTCGGCTGGGCGCGGTGG + Intergenic
1150812969 17:68371031-68371053 AGAGGCTAGGCCGGGCGCGGTGG + Intronic
1151506803 17:74533326-74533348 TCAGGCTCGGCCAGGCGCGGTGG + Intergenic
1151652428 17:75478302-75478324 GGAGTCTCGGCCGGGCGCGGTGG - Intronic
1151716001 17:75831344-75831366 GGAGGCTGGGGCGGGGCCGGAGG + Exonic
1151718306 17:75842681-75842703 GGAGGCTCAGCCCCGGGCGGGGG - Intronic
1151882386 17:76903373-76903395 GGAGGTGAGGCCTGGGGCTGAGG + Exonic
1151946146 17:77321020-77321042 GGAGGCTGGGCCTGGGAGGGAGG - Intronic
1152036083 17:77874079-77874101 GCAGGCTTGGCCTGGGGCAAGGG - Intergenic
1152126769 17:78451752-78451774 GGCGGCCTGGCCTGGGGCTGGGG - Intronic
1152350150 17:79779511-79779533 GGAGGCTGGAGCTGGGGCTGTGG + Intronic
1152350401 17:79781044-79781066 GGAGGCTCTTCTGGGGGCGGGGG + Intronic
1152453804 17:80401190-80401212 GGAGGAGCAGCCTGGGGAGGAGG - Intergenic
1152581124 17:81166045-81166067 GGCGGCTCGGGCCGGGGCCGCGG - Intronic
1152636528 17:81432695-81432717 GGAGGGTGGGCCTGGGGATGCGG - Intronic
1152636576 17:81432792-81432814 GGAGGGTGGGCCTGGGGATGTGG - Intronic
1152636586 17:81432816-81432838 GGAGGGTGGGCCTGGGGATGGGG - Intronic
1152636614 17:81432865-81432887 GGAGGTTGGGCCTGGGGATGGGG - Intronic
1152697571 17:81804503-81804525 GGGGGCGCGGCTGGGGGCGGGGG + Intronic
1152699133 17:81810609-81810631 GGAGGCTGGTCCAGGGGAGGTGG + Intronic
1152710502 17:81868674-81868696 GGAGGCTGGGCCTGTGGGTGGGG + Exonic
1152818119 17:82420851-82420873 GGTGGCTTGGCCGGGTGCGGTGG - Intronic
1152834401 17:82519937-82519959 GGCGGCGGGGCCGGGGGCGGCGG + Exonic
1152834410 17:82519952-82519974 GGCGGCGGGGCCGGGGGCGGCGG + Exonic
1152890516 17:82879144-82879166 GGATGCTAGGGCTGGGGCAGGGG - Intronic
1152924541 17:83081038-83081060 GGAGGCTCCGCCGGGGGCGCTGG - Intronic
1152967834 18:132828-132850 CCAGGCTCGGCCAGGCGCGGGGG + Intergenic
1153833603 18:8944618-8944640 GAAGGCTCGGCCAGGCGCAGTGG - Intergenic
1153882834 18:9435658-9435680 GAAGGCTCGGCTGGGCGCGGTGG + Intergenic
1154393977 18:13970425-13970447 AGAGCCTCGGCCTGGCGCGGTGG + Intergenic
1155152785 18:23135853-23135875 TGAGGCTGGGGCTGCGGCGGCGG - Exonic
1155642105 18:28030694-28030716 TGGGGCTCGGGCTGGGGCTGAGG + Intronic
1156556969 18:38078653-38078675 GAAGGCTGGGCCGGGCGCGGTGG + Intergenic
1156696916 18:39778575-39778597 GGAGGCACAGCCTGGGGAGAAGG + Intergenic
1157063092 18:44316087-44316109 GGAGTCTAGGCCGGGTGCGGTGG - Intergenic
1157221122 18:45829055-45829077 GGAGGCTGGGCAGGGGGTGGGGG + Intronic
1157376987 18:47176151-47176173 CGGGGCGCGGGCTGGGGCGGCGG - Intronic
1157473692 18:48008323-48008345 GGGCGCTGGGCCGGGGGCGGGGG + Intergenic
1157604067 18:48914761-48914783 GGACGCGCTGCCTGGGTCGGGGG - Intergenic
1157718983 18:49908987-49909009 GGAGGGGCAGCCTGGGGCTGGGG - Intronic
1158466976 18:57699447-57699469 GGAGTCTCGGCCGGGCCCGGTGG + Intronic
1159308537 18:66677648-66677670 GGAGAGTCGGCCGGGCGCGGTGG - Intergenic
1159320385 18:66839989-66840011 CTAGGCCAGGCCTGGGGCGGTGG + Intergenic
1159646179 18:70921104-70921126 GGAGGCCCAGCCTGGTGAGGAGG - Intergenic
1159810415 18:73012358-73012380 GAAGGCTGGGCCAGGCGCGGTGG + Intergenic
1160221286 18:76979787-76979809 GCAGCCACGGCCTGGGGAGGTGG + Intronic
1160225121 18:77006333-77006355 CCAGGCTCGGCCTGGGGCCCAGG - Intronic
1160357289 18:78239056-78239078 GAAGGGTGGGCCTGGGGCGGAGG + Intergenic
1160443500 18:78911331-78911353 GGGGCTTCGGCCTGGGGTGGAGG - Intergenic
1160507961 18:79437707-79437729 GCAGGCTCTGCCTGAGGGGGAGG + Intronic
1160543416 18:79637946-79637968 CGAGGCACGGCCTGGGCCCGGGG + Intergenic
1160630957 18:80246566-80246588 GTGGGCTGGGTCTGGGGCGGGGG + Intronic
1160736088 19:663023-663045 TGAGGCCCGGGCCGGGGCGGCGG - Intronic
1160756535 19:760148-760170 TGAGGCACGGCCAGGGGTGGGGG - Intronic
1160823022 19:1067115-1067137 GGGGGCGCGGCCCGGGGCTGGGG + Intronic
1160835446 19:1122634-1122656 TGAGGCCCTGCCTGGGGCAGGGG - Intronic
1160869647 19:1271401-1271423 GGTGGCTCTGCCGGGGGCCGGGG + Exonic
1160887126 19:1355187-1355209 GGAGGCCGGGCCTGGGGGGAGGG + Intronic
1160914266 19:1489419-1489441 GGAGGCTTGGCCCGGCGCGGTGG - Intronic
1160973473 19:1780589-1780611 GAGGGCTGGGCCTGGGGCTGAGG + Exonic
1161018655 19:1997295-1997317 GGGAGCTGGGCCTGGGGAGGGGG - Intronic
1161041223 19:2111638-2111660 GGAACCCCGGCGTGGGGCGGGGG + Intronic
1161047452 19:2143525-2143547 GCAGGCTTGGCCTGGCACGGTGG - Intronic
1161087987 19:2343917-2343939 GGAGGCACGGGCCGGGGTGGGGG + Intronic
1161101552 19:2424380-2424402 GGAGGAGTGGCCTGGGGCAGTGG - Intronic
1161189038 19:2943067-2943089 GTTGGCTAGGCCTGGCGCGGTGG - Intronic
1161265025 19:3359979-3360001 GGGGGCCCGGCCTGGGGTTGCGG - Intronic
1161337473 19:3722139-3722161 GGAGGCCGGTCCTGGGGCAGAGG - Intronic
1161429932 19:4225643-4225665 GCAGGCTTGGCCGGGTGCGGTGG + Intergenic
1161441219 19:4292685-4292707 GGTGGCCGGGCCTGGGGCTGGGG + Exonic
1161489868 19:4555949-4555971 GGAGGTTGGACCTGGGGCGCAGG + Intronic
1161620141 19:5293268-5293290 GGGAGCTCGGCCTGGGGGCGGGG + Intronic
1161793202 19:6373066-6373088 GGGGGCGCGGCCTGGGGACGTGG + Intronic
1161809959 19:6465911-6465933 GGAGTCCCGGCCGGGCGCGGTGG + Intronic
1161977186 19:7613189-7613211 GGGTCCTGGGCCTGGGGCGGGGG + Intronic
1162015397 19:7844063-7844085 TGAGGCTCGGCTGGGCGCGGTGG + Intronic
1162019608 19:7862664-7862686 GGAGGCGGGGCCGCGGGCGGGGG - Intronic
1162019651 19:7862771-7862793 GGAGGCGTGGCCGCGGGCGGGGG - Intronic
1162019688 19:7862864-7862886 GGAGGCGGGGCCGCGGGCGGAGG - Intronic
1162075308 19:8182811-8182833 GGAGGCTGGGCTTGGGGAGCAGG + Intronic
1162081511 19:8220590-8220612 GGAGGCTCAGCCGGACGCGGTGG - Intronic
1162205822 19:9055200-9055222 GGAGGGGAGGCCTGGCGCGGTGG + Intergenic
1162312112 19:9913844-9913866 GGAGGCGCGGGAGGGGGCGGGGG - Intronic
1162384501 19:10353135-10353157 CGGGGTTCGGCCGGGGGCGGCGG + Intronic
1162391699 19:10393802-10393824 AGAGGCTAGGCCGGGCGCGGTGG + Intronic
1162461376 19:10816116-10816138 GGAGGGTCCCCCTGGGGTGGAGG + Intronic
1162472194 19:10879086-10879108 GGAGGATCAGCCTGGGGCAGTGG - Intronic
1162482634 19:10937394-10937416 GGAGTCTGGGCCAGGCGCGGTGG - Intergenic
1162523018 19:11193121-11193143 GGTGGCCAGGCCTGGGGCTGGGG + Exonic
1162539273 19:11284354-11284376 TGAGGCTTGGCCGGGTGCGGTGG - Intergenic
1162547639 19:11340048-11340070 GTAGGCTAGGCCAGGCGCGGTGG + Intronic
1162596808 19:11635751-11635773 GGAGTCTCGGCCGGGCGTGGTGG + Intergenic
1162729846 19:12711668-12711690 GGAGGCACAGCTTGGGGAGGAGG + Intronic
1162809673 19:13156168-13156190 AGAGGCCCGGGCGGGGGCGGGGG - Intergenic
1162899385 19:13785502-13785524 TGAGTCTCAGCCTGGGGCCGTGG + Intergenic
1162909837 19:13842817-13842839 GCCGGCCCGGCCCGGGGCGGCGG - Intergenic
1162938408 19:13993641-13993663 GGTGGCTGTGCCTGGGGCTGGGG + Exonic
1162957601 19:14107792-14107814 GGAGGCCGGGCCTGGGATGGAGG + Intronic
1163000440 19:14363528-14363550 GGAGGCTGGGGGTGGGGAGGGGG + Intergenic
1163118367 19:15201064-15201086 GGAGGCCGGGCGGGGGGCGGGGG - Intergenic
1163125685 19:15243115-15243137 GGAGGCTGGGGCTGGGGTGGTGG + Exonic
1163265005 19:16215183-16215205 GGAGGCTAAGGCGGGGGCGGGGG + Intronic
1163340710 19:16705005-16705027 GGAGGCTTGGAGTGGGGGGGGGG + Intergenic
1163429271 19:17257316-17257338 GGATTCTCGGCCAGGCGCGGTGG - Intronic
1163438391 19:17309220-17309242 CGAGGTTCGGCCGGGTGCGGTGG - Intronic
1163443739 19:17334588-17334610 GCAGGCTCGCCCTCCGGCGGGGG + Exonic
1163479682 19:17547638-17547660 GGAGTCTTGGCCGGGTGCGGTGG - Intronic
1163508140 19:17720046-17720068 GGAGGCTGGGCCTGGAGCCCCGG + Intronic
1163551173 19:17967162-17967184 GGCGGCGGGGCCGGGGGCGGCGG - Intronic
1163584000 19:18154255-18154277 GGAGTCCCAGCCTGGGGAGGCGG - Intronic
1163655738 19:18543721-18543743 GGCTGCTGGGGCTGGGGCGGGGG + Intronic
1163655763 19:18543763-18543785 GGGGGCTGGGGCGGGGGCGGGGG + Intronic
1163696845 19:18768560-18768582 GGGGGCTGGGGCTGCGGCGGTGG - Exonic
1163758425 19:19120407-19120429 GGAGGCGGGGCCTGGGGAGGGGG - Intronic
1163758463 19:19120526-19120548 GGAGGCGGGGCCTGGGTAGGGGG - Intronic
1163768297 19:19175795-19175817 GGAGTCTAGGCCGGGTGCGGTGG - Intronic
1163851123 19:19664078-19664100 GGAGGCGGGGCCCGGTGCGGGGG + Intergenic
1163897199 19:20069625-20069647 AGAGACTCGGCCGGGCGCGGTGG + Intergenic
1164004178 19:21133844-21133866 GGAGGAGCAGCCTGGGGAGGAGG + Intergenic
1164077723 19:21835640-21835662 GGAGAGTCGGCCGGGCGCGGTGG - Intronic
1164080705 19:21859415-21859437 TGAGGAGCGGCCTGGGGTGGAGG - Intergenic
1164498701 19:28793663-28793685 CGGGGCTCGGCCGGGCGCGGCGG - Intergenic
1164557983 19:29268335-29268357 GGAGGCTAGGCCCGCGGGGGAGG + Intergenic
1164575846 19:29404879-29404901 GCAGGTCCGGCCTGGGGAGGGGG + Intergenic
1164595080 19:29526939-29526961 GGCGGTGCGGCCAGGGGCGGGGG + Intronic
1165071302 19:33256325-33256347 GGAGGGTGGTCCTGGGGCAGTGG + Intergenic
1165328192 19:35126246-35126268 TGAGGCTGGGCCTGGGGGCGGGG - Intronic
1165429922 19:35766801-35766823 GGAGGCTGGGGCTGGAGCAGGGG - Exonic
1165500843 19:36187923-36187945 GGAGGCTGGGCCAGGCGCGGTGG - Intronic
1165511487 19:36268975-36268997 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165512035 19:36271498-36271520 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165512583 19:36273997-36274019 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165513134 19:36276540-36276562 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165513689 19:36279093-36279115 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165514238 19:36281627-36281649 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165514792 19:36284166-36284188 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165515344 19:36286697-36286719 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165515894 19:36289235-36289257 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165516445 19:36291770-36291792 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165516997 19:36294298-36294320 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165517550 19:36296821-36296843 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165518102 19:36299356-36299378 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165518653 19:36301891-36301913 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165519201 19:36304421-36304443 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165519750 19:36306936-36306958 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165520301 19:36309466-36309488 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165623769 19:37269116-37269138 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165624312 19:37271656-37271678 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165624859 19:37274183-37274205 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165625396 19:37276721-37276743 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165625929 19:37279246-37279268 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165626473 19:37281773-37281795 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165627012 19:37284298-37284320 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165627555 19:37286822-37286844 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165628090 19:37289346-37289368 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165628632 19:37291872-37291894 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165629172 19:37294397-37294419 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165629715 19:37296923-37296945 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165630257 19:37299450-37299472 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165630796 19:37301988-37302010 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165943107 19:39425088-39425110 GGTGGCTGGGGCTGGGGGGGCGG - Exonic
1166054667 19:40281149-40281171 GAAGGCTGGGCCTGGGCAGGGGG - Intronic
1166108118 19:40607478-40607500 GTAGGCAAGGCCTGGGGCCGGGG + Exonic
1166141288 19:40806706-40806728 TGGGGCTAGGGCTGGGGCGGGGG + Intronic
1166358614 19:42242335-42242357 GGAGGCTCGGCCTCCGGCCCAGG - Exonic
1166373465 19:42314702-42314724 GCAGGCTCAGCCTGGGGGAGTGG + Intronic
1166393690 19:42423992-42424014 TGAGCCTCTGCCTGGGGTGGGGG + Intronic
1166409168 19:42544854-42544876 GGAGGCTGGGGGGGGGGCGGGGG + Intronic
1166511992 19:43415220-43415242 TGAGGCTGGGGCTGGGGCTGGGG + Intronic
1166789599 19:45390869-45390891 TGAGTCTCGGCCGGGCGCGGTGG - Intronic
1166888052 19:45973440-45973462 GGAGGCTGGGGTTGCGGCGGCGG + Exonic
1167018120 19:46855065-46855087 GGAGGCTTGCCCTGTCGCGGAGG - Intergenic
1167068439 19:47204781-47204803 GGGGGCTTGGCCGGGTGCGGTGG - Intronic
1167151076 19:47710176-47710198 GGAGGATCGGCTGGGCGCGGTGG - Intergenic
1167163014 19:47779867-47779889 TGAGGCTGGGACTGGGGTGGGGG + Intronic
1167288583 19:48612687-48612709 GGGGGCCCGGCCGGGCGCGGTGG - Intronic
1167605786 19:50480750-50480772 AGAGGCTCACCCTGGGGCTGTGG - Exonic
1167632325 19:50632679-50632701 GGAGGCTCGGCAGTGGGCGGTGG - Exonic
1167634639 19:50647396-50647418 GGAGGCTGGGCCAGGTGTGGTGG + Intronic
1167686125 19:50957934-50957956 GGAGGCTGGGGCTGGGGAGGAGG - Intergenic
1167690012 19:50979663-50979685 GGAGGCCAGGCCTGGGGGGAGGG + Intronic
1167703622 19:51065615-51065637 GTAGGGTCTGCCTGGGGCGGGGG - Intergenic
1168059244 19:53882227-53882249 GGAGGCACGGGCGGCGGCGGTGG - Exonic
1168076338 19:53982580-53982602 GGCGGCGCGGCCGGGGGCGCCGG + Exonic
1168078127 19:53991630-53991652 GGAGGCCAGGCCGGTGGCGGTGG + Intergenic
1168247009 19:55117501-55117523 GGCGGCTGGCCCGGGGGCGGCGG - Exonic
1168297307 19:55383746-55383768 CGAGGCCGGGCCCGGGGCGGCGG - Exonic
1168341061 19:55623319-55623341 GGAGGATGGGCCGGGCGCGGCGG - Intronic
1168502633 19:56906185-56906207 GGCGGCTGGGCCTGTGGCTGTGG + Intergenic
1168664259 19:58191422-58191444 GGAGGCTGGGCCGGGGGCAGTGG - Intronic
1202677875 1_KI270711v1_random:24080-24102 GAAGTCTCGGCCGGGCGCGGTGG - Intergenic
925221257 2:2143373-2143395 GGAGGCTGTGCCTGGGGCCGAGG + Intronic
925342366 2:3146379-3146401 GGGAGCTCGCCCTGGGGAGGTGG + Intergenic
925376371 2:3388686-3388708 GGAGGCACGGGCTGCGGAGGTGG - Intronic
925858227 2:8150861-8150883 AGAGGCTCAGGCTGGGGCGCCGG + Intergenic
926217819 2:10915946-10915968 GGAGGCAGGGGCTGGGGCAGCGG + Intergenic
926573893 2:14559357-14559379 GGAGTCACGGCCGGGTGCGGTGG + Intergenic
927708434 2:25311111-25311133 GGAGGCGGGGCTGGGGGCGGGGG + Intronic
927830280 2:26344429-26344451 AGAGTCTCGGCCAGGCGCGGTGG - Intronic
927843058 2:26457420-26457442 GGAGGCGCTGGCTGGGGCAGAGG + Exonic
927953685 2:27192365-27192387 GGTGGCTGGGCCAGGGACGGTGG + Intergenic
927974528 2:27327911-27327933 GGAGCCTCGGCCAGGTGCAGTGG - Intronic
928285369 2:29985820-29985842 GGAGGCTGGACCTGGGGCTCTGG - Intergenic
928549433 2:32357004-32357026 GGAGGCGGGGCCCGGGGCGCGGG - Intergenic
928606325 2:32947530-32947552 GGAGGCACGGCTGGGGGCGCCGG - Exonic
928910743 2:36418388-36418410 GGAAGCTGAGCCTGGGGAGGTGG - Intronic
929010572 2:37439547-37439569 GGAGGCTGGGTCTGAGGTGGAGG + Intergenic
929126419 2:38526608-38526630 GGAGGAGGGGCCTGGCGCGGTGG + Intergenic
929133726 2:38602977-38602999 GGAGGCTCGGCCTGCGCGGCTGG - Intronic
929536264 2:42786251-42786273 GCAGGCCTGGCCTGGGGCAGAGG + Intronic
929825770 2:45308632-45308654 GGATGCTGGGCCAGGTGCGGTGG + Intergenic
929880194 2:45829784-45829806 GAAGGCTCGGCCGGGCGCGGTGG + Intronic
930040599 2:47120041-47120063 GGGGGCCAGGCCAGGGGCGGTGG + Intronic
930529363 2:52571694-52571716 GGAGGCTGGGGCTGCGGCAGCGG - Intergenic
931300800 2:60976047-60976069 GGAGGCTGGGCCAGGAGAGGTGG - Intronic
931463505 2:62467820-62467842 GGTGGCAGGGCCTGGGGTGGTGG + Intergenic
931513319 2:63024056-63024078 GGAGGATCAGCCAGGCGCGGTGG + Intronic
931779565 2:65567499-65567521 GGAGCCTCGGCCGGGCGCGGTGG + Intergenic
932023946 2:68115081-68115103 GAAGACTTGGCCTGGGGTGGAGG - Intergenic
932691204 2:73915230-73915252 GGAGGCTTGGCCAGGCGCGGTGG + Intronic
932750650 2:74369527-74369549 GCAGGGTCGGCCAGCGGCGGTGG + Intronic
933233775 2:79841054-79841076 GGAGTCTCGGCAGGGCGCGGTGG - Intronic
933772604 2:85753826-85753848 GGCGGCCCGGGCTGGGGAGGCGG + Intronic
934022881 2:87973227-87973249 GGAGGGTGAGCCTGGGGCAGGGG + Intergenic
934105557 2:88691765-88691787 GGGGGCGCGGCCTCCGGCGGAGG + Exonic
934548407 2:95238849-95238871 GGAGCCTGGGCCAGGCGCGGTGG + Intronic
934923675 2:98366604-98366626 GGAGGCCCTGCCTGGTGAGGAGG + Intronic
934962972 2:98694072-98694094 GGTGGCTGGGGCTGGGGCTGGGG - Intronic
935202494 2:100870184-100870206 GGAGTCTGGGCCAGGTGCGGTGG - Intronic
935233963 2:101122356-101122378 GGAGTCTTGGCCGGGCGCGGTGG - Intronic
935714050 2:105924450-105924472 GGAGCCGCTGCCTGGGGCGTGGG + Intergenic
935845480 2:107161823-107161845 AGGGGCTAGGCCTGGGGCTGGGG - Intergenic
936048683 2:109206201-109206223 GGAGGCTGGGCCGGGCACGGTGG + Intronic
936065892 2:109331929-109331951 GGAGGATCGGCCAGGTGCTGAGG - Intronic
937330693 2:121026466-121026488 GGAGGGTGGGCCGGGCGCGGTGG - Intergenic
937694939 2:124798347-124798369 GGAGTCTCAGCCTGGGCTGGAGG + Intronic
937918973 2:127117053-127117075 GAAGTCTCGGCCGGGCGCGGTGG - Intergenic
937962043 2:127467561-127467583 GGAGGCTAGGCCTGGGTGAGTGG - Intronic
938262160 2:129903871-129903893 GGAGGCAGTGCCTGGGGCCGGGG - Intergenic
938291407 2:130152725-130152747 GCAGGCTGAGCCTGGGGCCGCGG + Exonic
938397861 2:130963988-130964010 GAAGGCTGGGCCGGGGGCGGCGG - Intronic
938465136 2:131520234-131520256 GCAGGCTGAGCCTGGGGCCGCGG - Intergenic
939290744 2:140192004-140192026 GAATGCTAGGCCGGGGGCGGTGG + Intergenic
939629430 2:144516000-144516022 CGAGGCGCGGGCTGGGGCTGCGG + Intronic
941088616 2:161147428-161147450 GGAGGCTAGGCCTGGTGGTGTGG + Intronic
941119119 2:161507872-161507894 GGAGGCGCGGCCTGGGCCCGCGG - Intronic
942235641 2:173901973-173901995 GAAGGCTTGGCCGGGGGCAGTGG - Intergenic
943248928 2:185492611-185492633 GAAGGCTAGGCCAGGAGCGGTGG - Intergenic
943589865 2:189784269-189784291 GGCGGCCCGGAGTGGGGCGGCGG - Intronic
944622519 2:201531244-201531266 GCAGGGTCGGCCAGGCGCGGTGG - Intronic
946227826 2:218273783-218273805 GGAAACTGGGCCTGGTGCGGTGG - Intronic
946339183 2:219057396-219057418 GGGGGCTGGGCCCGGGGCCGGGG - Intronic
946362396 2:219227228-219227250 GGAGGCTCGGCTGGGTGTGGTGG + Intronic
946391458 2:219419087-219419109 GGAGGCTAGGCCTGGGGTCTGGG + Intronic
946432167 2:219631692-219631714 GGAGGGTCTGGCTGGGGCTGTGG + Intronic
946564338 2:220946509-220946531 TGAGGCTGGGCCGGGTGCGGTGG - Intergenic
947514073 2:230785875-230785897 GGAGTCTTGGCCGGGCGCGGTGG + Intronic
947542542 2:230988876-230988898 GGAGGCCCTACCTGGGGCTGGGG - Intergenic
947763358 2:232620099-232620121 AGAGTCTCGGCCGGGCGCGGTGG + Intronic
947765290 2:232633810-232633832 GGAGGCTCGGGCTCGGGCTTGGG - Exonic
947805039 2:232960589-232960611 TGAGTCTAGGCCTGGAGCGGTGG + Intronic
947963573 2:234260095-234260117 TGAGGCTGGGGCTGGGGCTGGGG - Intergenic
948196829 2:236103011-236103033 GGAGGCCAGGCCTGGGGGTGGGG - Intronic
948216647 2:236237577-236237599 GGAGGCGGGGGCTGGGACGGAGG + Intronic
948333940 2:237193386-237193408 GGAGGCTTGGGCTGTGGTGGAGG + Intergenic
948961738 2:241344265-241344287 GGTGGCTCAGCCTGGAGCAGTGG - Intronic
1168813589 20:721799-721821 GGAAGCTTGGCCTGGGGAAGTGG + Intergenic
1169849553 20:10034885-10034907 GGAGGCGGGGGCGGGGGCGGAGG + Intronic
1170567512 20:17615408-17615430 GCAGGCAGGGGCTGGGGCGGGGG - Intronic
1170585714 20:17732641-17732663 GGGGGCTCGGCCAGGTGTGGTGG - Intronic
1170756814 20:19212505-19212527 CCGCGCTCGGCCTGGGGCGGCGG - Intergenic
1170933867 20:20793161-20793183 CGAGTCCCGGCCGGGGGCGGTGG - Intergenic
1171010221 20:21505595-21505617 AGAGGCTGGGCGTGGGGCAGAGG - Intergenic
1171381032 20:24734383-24734405 GGCGGCTCAGCATGTGGCGGGGG - Intergenic
1171796796 20:29572750-29572772 GGTGGCTGTGCCTGGGGCAGGGG - Intergenic
1171846978 20:30283294-30283316 GGGGGCTGGGACTGGGGCTGGGG + Intergenic
1171851451 20:30311416-30311438 GGTGGCTGTGCCTGGGGCAGGGG + Intergenic
1172066453 20:32224102-32224124 GGAGTCTAGGCCAGGCGCGGTGG + Intronic
1172095246 20:32457241-32457263 GGAGGCCGGGGCTGGGGCTGGGG - Intronic
1172323956 20:34019772-34019794 GGAAGCTTGGCCGGGCGCGGTGG + Intronic
1172482237 20:35277853-35277875 GCAGGCTGGGGCTGGGGCTGGGG + Intergenic
1173017005 20:39234780-39234802 GGAGGCCTGGCCAGGGGTGGGGG + Intergenic
1173251343 20:41365763-41365785 GGAGGCTCTGCCTGGGGTGCTGG - Intronic
1173494339 20:43507874-43507896 GGGGGCGCGGGCTGGGGAGGAGG + Intronic
1173706228 20:45112124-45112146 AGAGGCTTGGCGTGGGGAGGGGG + Intronic
1173785690 20:45791582-45791604 ATATGCTCGGCCAGGGGCGGTGG - Intronic
1173843658 20:46174837-46174859 GGGGGCTCGGGCGGGGGCGCGGG - Exonic
1174174773 20:48637644-48637666 GGATGGTCGGCCTTGGGTGGTGG + Intronic
1174204337 20:48828008-48828030 GGCGGCTGGGCCGGGGGCGGAGG + Intergenic
1174351969 20:49974870-49974892 TGATGCTCGGCCAGGTGCGGTGG - Intergenic
1174426800 20:50437512-50437534 GGAGGCTGTGCCTGTGTCGGGGG + Intergenic
1174471093 20:50761371-50761393 GGATTCTCGGCCAGGAGCGGTGG - Intergenic
1174585549 20:51605329-51605351 GGAGTCGCGGCCAGGCGCGGGGG + Intronic
1174607602 20:51772355-51772377 GGAGTTTCGGCCTGGTGCAGTGG - Intergenic
1175141532 20:56864393-56864415 TGAAGCTCGGCCAGGTGCGGTGG + Intergenic
1175712535 20:61232578-61232600 GGAGGCTGGGCCTGGGGGGCAGG + Intergenic
1175791039 20:61739859-61739881 GGAGGCTGAGCCTGAGGCGTCGG - Intronic
1175846314 20:62060783-62060805 GGTGGGTCACCCTGGGGCGGTGG - Intronic
1175908037 20:62391483-62391505 GGGGGCTCTGGCTGGGGCTGAGG + Intronic
1175926695 20:62474891-62474913 GGAGGCTCGGACCGTGGGGGAGG + Intronic
1175935487 20:62511969-62511991 AGAGGCAGGGCTTGGGGCGGTGG + Intergenic
1175948274 20:62568824-62568846 GGAGGCTCTGACTGGGGTAGGGG - Intronic
1175950705 20:62581611-62581633 GCAGGCCCGGCATGGGGTGGGGG - Intergenic
1176016793 20:62938104-62938126 GGAGGCGGGGGCGGGGGCGGGGG - Exonic
1176141716 20:63547779-63547801 GGCAGCTTGGGCTGGGGCGGGGG + Intergenic
1176148016 20:63574078-63574100 GGTGGCGGGGCCGGGGGCGGAGG - Intronic
1176157667 20:63630135-63630157 GGAGTCTCGGCCGGGCGCGGTGG + Intergenic
1176163001 20:63658062-63658084 GGTGGCTCGGCCTAGAGAGGCGG + Intronic
1176184100 20:63768751-63768773 CGCGGCTCGGGCTGGGGCAGTGG + Intronic
1176184111 20:63768796-63768818 TGAGGCTCGGACTGGGGCAGTGG + Intronic
1176252069 20:64129957-64129979 GGAGCCTCAGCCGGGCGCGGTGG + Intergenic
1176268476 20:64223045-64223067 GCAGGCTCAGCCTGGGGGGCAGG + Intronic
1176374075 21:6078529-6078551 GGAGGCTCGGCCCAGGACGTTGG - Intergenic
1176413740 21:6463029-6463051 GCAGGCTGGGCCGGGCGCGGTGG + Intergenic
1177481606 21:21696870-21696892 AGAGGCTCGGCCGGGGGCGGTGG + Intergenic
1178372062 21:32034530-32034552 TGAGGCTCGGCTGGGCGCGGTGG - Intronic
1178534706 21:33402668-33402690 GCAGGCTCGGGCTGGGGAGCGGG + Intergenic
1178568733 21:33714115-33714137 TGAGGCTGGGCCAGGGGCGGTGG - Intronic
1178642368 21:34355406-34355428 AGAGGCTGGGCCGGGTGCGGTGG + Intergenic
1178863611 21:36309602-36309624 GGAGACCCGGCCGGGCGCGGTGG - Intergenic
1178877481 21:36423914-36423936 GGAAGCTAGGCCGGGTGCGGTGG - Intergenic
1179135581 21:38677516-38677538 CAAGGATCGGCCTGGCGCGGTGG + Intergenic
1179356497 21:40665195-40665217 GCAGGCTGGGCATGGGGAGGTGG + Intronic
1179558199 21:42194080-42194102 GCAGCCTCGGCCGGGGGCAGTGG + Intergenic
1179689238 21:43071351-43071373 GCAGGCTGGGCCGGGCGCGGTGG + Intronic
1179722290 21:43322628-43322650 GGAGGGCTGGCCTGGGGCGCAGG + Intergenic
1179723324 21:43328328-43328350 GGGGGCTGGGCCTGGGTTGGAGG + Intergenic
1179749402 21:43459714-43459736 GGAGGCTCGGCCCAGGACGTTGG + Intergenic
1179810172 21:43865158-43865180 GGCGGCGCGGCCGAGGGCGGAGG + Intergenic
1179885915 21:44314257-44314279 CGGGGCTGAGCCTGGGGCGGCGG - Intronic
1180095189 21:45553119-45553141 GGAGGCTGGGCCTGGAGGGCAGG + Intergenic
1180101823 21:45590982-45591004 GGAGGCGGGGGCGGGGGCGGGGG + Intergenic
1180759287 22:18187354-18187376 GGAGGCTTGGCTTGAGGCTGAGG + Intergenic
1180769595 22:18371650-18371672 GGAGGCTTGGCTTGAGGCTGAGG + Intergenic
1180776733 22:18491016-18491038 GGAGGCTTGGCTTGAGGCTGAGG - Intergenic
1180785007 22:18542304-18542326 GGAGCCTGGGCCGGGCGCGGTGG - Intergenic
1180809460 22:18748382-18748404 GGAGGCTTGGCTTGAGGCTGAGG - Intergenic
1180827535 22:18874613-18874635 GGAGGCTTGGCTTGAGGCTGAGG + Intergenic
1180959949 22:19758067-19758089 GGAGGCTGGCCCTGGGCCTGAGG - Intronic
1181031482 22:20150432-20150454 TGGGGCTGGGGCTGGGGCGGTGG + Intronic
1181072381 22:20353368-20353390 GGAGGCTTGGCTTGAGGCTGAGG - Intronic
1181123123 22:20685900-20685922 GGTGGCTAGGCCGGGTGCGGTGG + Intergenic
1181123494 22:20688607-20688629 AGAGTCTCGGCCGGGCGCGGTGG + Intergenic
1181128590 22:20716337-20716359 GGAGCCTGGGCCGGGTGCGGTGG - Intronic
1181189676 22:21129034-21129056 AGAGTCTCGGCCCGGCGCGGTGG - Intergenic
1181195452 22:21182302-21182324 GGAGGCTTGGCTTGAGGCTGAGG - Intergenic
1181209527 22:21281470-21281492 AGAGTCTCGGCCCGGCGCGGTGG + Intergenic
1181213995 22:21310472-21310494 GGAGGCTTGGCTTGAGGCTGAGG + Intergenic
1181241910 22:21481658-21481680 GGAGCCTGGGCCGGGCGCGGTGG - Intergenic
1181280588 22:21717125-21717147 GGAGGCCGGGGCTGGGGGGGCGG + Intronic
1181307287 22:21923973-21923995 GGGAGCTCGGCCTGGTGTGGTGG - Intronic
1181524441 22:23472105-23472127 GGAGGCTTGGCTTGAGGCTGAGG + Intergenic
1181707946 22:24660164-24660186 AGAGTCTCGGCCCGGCGCGGTGG - Intergenic
1181788323 22:25243599-25243621 GGAAGCCTGGCCTGGCGCGGTGG + Intergenic
1181811417 22:25405586-25405608 GGAGGCTCGGCGCGGGGCTGGGG + Intergenic
1182358776 22:29734823-29734845 TGGGGCTGGGGCTGGGGCGGGGG - Intronic
1182447515 22:30398135-30398157 GGAGGCCCAGCCTGGGACAGAGG - Intronic
1183253620 22:36746762-36746784 GCAGGACTGGCCTGGGGCGGGGG - Intergenic
1183265508 22:36822777-36822799 GCAGGATGGGCCTGGGTCGGTGG - Intergenic
1183564261 22:38601848-38601870 GGAGGAACAGGCTGGGGCGGTGG + Intronic
1183665572 22:39244129-39244151 GGAGCCGGGGCCGGGGGCGGCGG - Exonic
1183734361 22:39635698-39635720 TGAGGCAGGGCCTGGGGCAGTGG + Intronic
1183894969 22:40961049-40961071 GGTGGCTCGGCCGGGCGTGGTGG - Intronic
1184022908 22:41833068-41833090 GGGGGCGCGGGCTGGGGCGGGGG + Intronic
1184023358 22:41835613-41835635 GGTGGCTCGGCCAGGCACGGTGG - Intronic
1184164734 22:42720662-42720684 GGTGGCCCGGGCTAGGGCGGCGG + Intronic
1184336765 22:43858420-43858442 GGAGGCTTGACCTGGGGAAGGGG - Intronic
1184423029 22:44392779-44392801 GGAGGCTGGGGCTGGGGCTGGGG - Intergenic
1184523001 22:45007086-45007108 GGGCGCGCGGCCGGGGGCGGGGG + Intronic
1184562111 22:45269264-45269286 GGAGGCGGGGGCGGGGGCGGGGG + Intergenic
1184606376 22:45576913-45576935 CGAGGCTGGGACTGGGGCTGGGG + Intronic
1184693445 22:46127696-46127718 GGAGGCTCCACCAGGGGCAGGGG - Intergenic
1184754061 22:46506517-46506539 GGGGGCTGGGGCTGGGGCTGAGG - Intronic
1184958825 22:47913984-47914006 GGAGGCTTTGCCTGGCCCGGTGG - Intergenic
1185380759 22:50506609-50506631 GACGGCTGGGCCTGGGGCTGTGG - Intronic
1185417922 22:50720276-50720298 GGCGGCGCGGTCTGCGGCGGGGG - Intergenic
1185420285 22:50731074-50731096 GAAGGGTCGGCGTGGGCCGGGGG - Intergenic
1203217418 22_KI270731v1_random:13965-13987 AGAGTCTCGGCCCGGCGCGGTGG - Intergenic
1203231426 22_KI270731v1_random:112837-112859 GGAGGCTTGGCTTGAGGCTGAGG + Intergenic
1203277632 22_KI270734v1_random:100603-100625 GGAGGCTTGGCTTGAGGCTGAGG + Intergenic
949152885 3:791688-791710 TGAGACTCTGTCTGGGGCGGAGG + Intergenic
949203518 3:1410111-1410133 GTAGACTCGGCCAGGGGCGGTGG - Intergenic
949979686 3:9494240-9494262 GGGGGCTCGGCTGGGCGCGGTGG - Intergenic
949987519 3:9552687-9552709 GGAGGCGGGGCCGGCGGCGGCGG + Exonic
950452497 3:13073170-13073192 GGAGGCTGGGGCGGGAGCGGGGG + Intergenic
951456295 3:22896015-22896037 GGAGGCTTGGACTAGGGTGGTGG - Intergenic
953614384 3:44477457-44477479 GGAGGCTGCGCCCGTGGCGGGGG - Intronic
953618137 3:44510454-44510476 GGAGGCTGCACCCGGGGCGGGGG - Intronic
954332496 3:49898459-49898481 ACAGGCTGGGCCTGGGGTGGTGG - Intronic
954820583 3:53323109-53323131 GGAAACTCGGCCGGGCGCGGTGG - Intronic
955019543 3:55105981-55106003 GGAGAGTCAGCCTGGGGAGGGGG + Intergenic
956825851 3:72996639-72996661 GGAGCCTGGGCCTGGGGCTGGGG + Intronic
957869729 3:86075796-86075818 GGAGACTTGGCCGGGTGCGGTGG - Intergenic
958026670 3:88058444-88058466 GGGGGTTCGGGCGGGGGCGGGGG + Intronic
958476609 3:94592116-94592138 ACAGGCTCGGCCTGGCACGGTGG + Intergenic
959055369 3:101562364-101562386 GGAGGCTGAGCCGGGCGCGGTGG + Intronic
960107676 3:113815681-113815703 GGAGGGTAGGCCGGGTGCGGTGG + Intergenic
960902366 3:122565223-122565245 GGAGACTGGGCCGGGTGCGGTGG + Intronic
961013475 3:123450037-123450059 GGAGCCCTGGCCGGGGGCGGGGG - Intergenic
961361377 3:126370304-126370326 GGAGGCTCAGCCTTGGGCAGCGG - Intergenic
961440885 3:126952579-126952601 TGAGGCTCGGCATGGGGCCCAGG + Intronic
961814894 3:129544385-129544407 GGAGGCTGGGGCTGGGGAGTTGG + Intronic
962094255 3:132277291-132277313 TGAGGTTCGGCCGGGCGCGGTGG + Intronic
962349130 3:134644110-134644132 GGAGGCTCGGCCGGGCGCGGTGG - Intronic
962353366 3:134672793-134672815 GGAGGCTTGGGCTGGGGCAAGGG - Intronic
963091621 3:141487658-141487680 GGAGGCGCGGCCCGAGGAGGTGG + Intronic
963321982 3:143818792-143818814 GGAGGATCGGCCAGGCGCGGTGG + Intronic
963621307 3:147609837-147609859 GGAGGGTGGGCCGGGTGCGGTGG - Intergenic
963892127 3:150647658-150647680 GGAATCTCGGCCGGGCGCGGTGG - Intergenic
965658375 3:171015179-171015201 GCAGGCTAGGCCAGGCGCGGTGG + Intronic
965701057 3:171459915-171459937 GGGGGCTGGGGCTGGGGCAGGGG - Intronic
965820866 3:172683114-172683136 GGAGGCAGGGCCGGGCGCGGTGG + Intronic
965823538 3:172708641-172708663 GGTGTCATGGCCTGGGGCGGTGG - Intronic
966868540 3:184275975-184275997 CGGGGCTCCGCGTGGGGCGGTGG + Intronic
966982834 3:185153549-185153571 GGAGGCCCGCCCTGGGTGGGGGG - Intergenic
968551407 4:1225593-1225615 GGAGGCTGGGCCCGGCCCGGGGG - Intronic
968616685 4:1580652-1580674 GGAGGCGTGGCCTGGGCGGGAGG - Intergenic
968616734 4:1580782-1580804 GGAGGCGGGGCCTGGGTGGGAGG - Intergenic
968622053 4:1608275-1608297 GGAGGGGCCGCCTGGGGTGGGGG - Intergenic
968703411 4:2067214-2067236 CAAGGCTGGGCATGGGGCGGAGG - Exonic
968703695 4:2068754-2068776 GGAGGCTCAGCCCGGGGCCTGGG - Exonic
968727008 4:2252434-2252456 GGAGGCTCAGCGTGGTGTGGCGG + Exonic
969038980 4:4279035-4279057 GAAGGCTGGGCCAGGTGCGGAGG + Intronic
969251367 4:5970775-5970797 GGGGGCTGGGCCTTGGGCTGAGG - Intronic
969553123 4:7885451-7885473 TGATGGTCGGCCTGAGGCGGGGG - Intronic
969625961 4:8305917-8305939 GAAGGCTGTGCCTGGGGAGGCGG + Intronic
969871245 4:10106526-10106548 GGCAGCACGGCCTGGGGAGGAGG - Intronic
969873178 4:10116987-10117009 GGAGGCGGGGCCGGGGCCGGCGG - Intergenic
970106917 4:12595495-12595517 GGAGGCTCTCCCTGGTGAGGGGG - Intergenic
970459113 4:16255168-16255190 GTAGGCTTGGCCAGGTGCGGTGG - Intergenic
970574541 4:17414370-17414392 GGAGGCTCGGGCGCGGGCGGAGG + Intergenic
970899838 4:21146109-21146131 GGAGACTCGGCCGGGCGCAGTGG + Intronic
971324502 4:25633144-25633166 GGAGGCAAGGCCGGGCGCGGTGG - Intergenic
972446032 4:39144695-39144717 GGAGGATGGGCCGGGCGCGGTGG - Intergenic
973170119 4:47131443-47131465 CAAGACTCGGCCTGGTGCGGTGG - Intronic
974035459 4:56814207-56814229 GGAGTCTCGGCAGGGTGCGGCGG - Intronic
975983468 4:80183821-80183843 GGAGCCTCGGCAGCGGGCGGGGG - Intergenic
976146150 4:82044281-82044303 GGAGGCTCGGGCTGCGGACGGGG - Intergenic
976316035 4:83659953-83659975 GGGGGCTTGGCCGGGTGCGGTGG + Intergenic
976423582 4:84874066-84874088 GGACACCAGGCCTGGGGCGGTGG - Intronic
976629157 4:87219928-87219950 GGAGCCGCGGCCTGCGGGGGCGG - Intronic
977355591 4:95942227-95942249 GGAGGCAGGGCCGGGGGCAGTGG - Intergenic
978760833 4:112355563-112355585 GGTGGCTGGGCCTAGGGAGGTGG + Intronic
979273882 4:118793178-118793200 GAAGGCCCGGCCGGGCGCGGTGG + Intronic
979469110 4:121073171-121073193 GGAGGCTCGGTCTGCGCCGAGGG - Intergenic
979546882 4:121950315-121950337 GAGGTCTCGGCCTCGGGCGGTGG + Intronic
980930145 4:139177032-139177054 GGACGCTCGGCCAACGGCGGCGG - Exonic
981119712 4:141035863-141035885 TGGGGCCAGGCCTGGGGCGGGGG + Intronic
981475095 4:145180064-145180086 GGCGGCTCGGGCTGGGGCTCGGG + Intronic
981981048 4:150791739-150791761 GAAGGCTTGGCCGGGCGCGGTGG + Intronic
982046162 4:151448204-151448226 GGAGGCTAGGCCAGGTGCAGAGG - Intronic
982172431 4:152674866-152674888 GGAGGCAAGGCCAGGTGCGGTGG + Intronic
982985125 4:162197732-162197754 GGATCCTCGGCCGGGCGCGGTGG + Intergenic
983254113 4:165379190-165379212 GAAGGCACGGCCGGCGGCGGCGG + Exonic
983774902 4:171594759-171594781 GGAGGCCCTGCCTGGTGAGGAGG + Intergenic
983809945 4:172049694-172049716 GCAGGCTCAGCCTGGCGCAGCGG + Intronic
984599588 4:181710834-181710856 GGAGTCTCGGCCGGGCGCGGTGG - Intergenic
985227475 4:187778171-187778193 GAAGGCTTGGCCTGGGACGTTGG + Intergenic
985349927 4:189048862-189048884 GCATGCTCGGCCGGGCGCGGTGG - Intergenic
985445989 4:190021653-190021675 GGGGGCGCGGGCTGGGGAGGTGG + Intergenic
985451395 4:190065632-190065654 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
985452385 4:190068925-190068947 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
985453370 4:190072222-190072244 GGGGGCGCGGGCTGGGGAGGTGG - Exonic
985454360 4:190075515-190075537 GGGGGCGCGGGCTGGGGAGGTGG - Exonic
985455348 4:190078808-190078830 GGGGGCGCGGGCTGGGGAGGTGG - Exonic
985456335 4:190082108-190082130 GGGGGCGCGGGCTGGGGAGGTGG - Exonic
985457320 4:190085402-190085424 GGGGGCGCGGGCTGGGGAGGTGG - Intergenic
985458307 4:190088695-190088717 GGGGGCGCGGGCTGGGGAGGTGG - Exonic
985459296 4:190091995-190092017 GGGGGCGCGGGCTGGGGAGGTGG - Exonic
985463548 4:190174764-190174786 GGGGGCGCGGGCTGGGGAGGTGG - Exonic
985490129 5:174275-174297 GGGGGCTGGGGCTGGGGTGGGGG + Intronic
985615068 5:915369-915391 GGATGCTGGCCCTGGGGCAGAGG + Intronic
985615084 5:915425-915447 GGATGCTGGCCCTGGGGCAGAGG + Intronic
985615098 5:915481-915503 GGATGCTGGCCCTGGGGCAGAGG + Intronic
985615113 5:915537-915559 GGATGCTGGCCCTGGGGCAGAGG + Intronic
985660808 5:1155776-1155798 GGGGGCTCGGGGTGGGGCGCTGG + Intergenic
985684553 5:1275085-1275107 CGAGTCTCGGCCGGGCGCGGCGG + Intronic
985726333 5:1517845-1517867 GGAGGCACTGCCAGGGGTGGGGG - Intronic
985881123 5:2640111-2640133 AGGGGCTCGGCCGGGGGCAGTGG - Intergenic
985895625 5:2748794-2748816 CGGGGCGCGGCCTCGGGCGGGGG + Exonic
985953749 5:3244357-3244379 GGAGGTTAGGCCGGGCGCGGTGG - Intergenic
986451419 5:7869277-7869299 GGAGAGGCGGCCCGGGGCGGGGG + Intronic
988997417 5:36727600-36727622 GGGGCCTTGGCCGGGGGCGGTGG + Intergenic
989178834 5:38556572-38556594 GGAGGCTCTGGCGGCGGCGGCGG - Intronic
990460623 5:56027978-56028000 GGAGCCTCTGCCAGGTGCGGTGG - Intergenic
991560556 5:67947246-67947268 AGAGGCTCGGCGGGGCGCGGTGG + Intergenic
991772418 5:70052253-70052275 GGAGGATCGGCCGGGCGCTGTGG + Intronic
991851711 5:70927672-70927694 GGAGGATCGGCCGGGCGCTGTGG + Intronic
992449078 5:76859491-76859513 GAAGCCTCGGCCGGGGGCAGTGG + Intronic
992716312 5:79514230-79514252 GGAGCCGCGGCCGGGGGCTGGGG + Intergenic
992816601 5:80446972-80446994 GGATACTAGGCCTGGCGCGGTGG + Intronic
992939570 5:81750246-81750268 TGGGGCTGGGGCTGGGGCGGGGG - Intronic
995133668 5:108657969-108657991 AGAGTCTCAGCCTGGTGCGGTGG + Intergenic
996666347 5:126064594-126064616 TGAAGCTCGGCCGGGCGCGGTGG - Intergenic
996691783 5:126348019-126348041 GGAGGCTGGGCCAGGAACGGTGG - Intergenic
996717935 5:126602232-126602254 GGAAGCTGGGCCGGGCGCGGTGG - Intronic
996862828 5:128084269-128084291 GGCGGCTGGTGCTGGGGCGGGGG + Exonic
997176441 5:131782833-131782855 GGAGGCTAGGCCAGGCGTGGTGG + Intronic
997190320 5:131927856-131927878 AGAGGATCGGCCGGGCGCGGTGG + Intronic
997309282 5:132866473-132866495 GGAGGCCCTGCCCGGGCCGGTGG - Intronic
997947320 5:138214028-138214050 GGAAGCTCGGCCAGGCGCGGTGG + Intergenic
998334577 5:141360152-141360174 GGAGGTGCGGGCTGGTGCGGTGG + Exonic
998350930 5:141500494-141500516 TGAAGCTCGGCCAGGCGCGGTGG - Intronic
999278713 5:150350135-150350157 GAAGGCTGGGCCTTGGGCAGAGG - Intergenic
999566526 5:152868772-152868794 GGAGCTTTGGCCAGGGGCGGTGG + Intergenic
999699038 5:154211227-154211249 GGAGGGTGGCCCTGGGGCTGGGG + Intronic
999938584 5:156515945-156515967 GGAGGCCCTGCCTGGTGAGGAGG - Intronic
1000133968 5:158326441-158326463 GGAGCCTGGGCCTGGGGCCTGGG - Intergenic
1000201763 5:159018004-159018026 GGAGGCTGGGGCAGGGACGGGGG - Intronic
1001050023 5:168406652-168406674 GGAGAGTCGGCCGGGCGCGGTGG + Intronic
1001470337 5:172007185-172007207 AGAAGCTCGGCCTGGGGAAGAGG + Intergenic
1001550900 5:172601744-172601766 TGAAGCTCGGCCAGGCGCGGTGG - Intergenic
1001597641 5:172908289-172908311 GGAGGCTGAGGCGGGGGCGGGGG + Intronic
1001712444 5:173789453-173789475 GGAGGCTGGGCCTGGGGTGCTGG + Intergenic
1001933386 5:175688378-175688400 GGTGGCTGGGCCTGGGGAGGTGG - Intergenic
1001934959 5:175697174-175697196 GGATGCCCGGCCGGGCGCGGTGG + Intergenic
1002290220 5:178195313-178195335 TGAGGCTCGGCCGGGCACGGTGG + Intergenic
1002316910 5:178349544-178349566 GGAGGCCAGGCGTGGGGCGTGGG - Intronic
1002399978 5:178986309-178986331 GGTGGCTGAGCCTGGGGCCGCGG - Exonic
1002498447 5:179632017-179632039 GGCGTCTCGGCCGGGCGCGGCGG + Intronic
1002596201 5:180325132-180325154 GGAGGCCCGGCCTAGGAGGGTGG - Intronic
1002608420 5:180397608-180397630 GGAAATTCGGCCTGGCGCGGGGG - Intergenic
1002613513 5:180436410-180436432 GCAGGCTGGGCCTGGGGTGCGGG - Intergenic
1002641715 5:180633557-180633579 GGAGTCTGGGCCAGGGGCTGGGG + Intronic
1003003278 6:2357339-2357361 TGAGGCTCAGCCAGGCGCGGTGG - Intergenic
1003035019 6:2634394-2634416 GGGCGCACGGCCTGGGGCGTCGG - Intronic
1003107530 6:3227712-3227734 GGGGGCTCGGGCTGGGGGCGCGG - Exonic
1003322385 6:5063433-5063455 GGAGGATAGGCCTGGGGGAGGGG - Intergenic
1003545165 6:7052373-7052395 GGGGGCTCGGCTTGGGGCTGAGG + Intergenic
1003624067 6:7726954-7726976 GGATGCCGGGGCTGGGGCGGAGG + Exonic
1003668241 6:8131545-8131567 GGAGGCTCGTGCTGGGTGGGAGG - Intergenic
1003910447 6:10739334-10739356 AGAGTCTCGGCCGGGCGCGGTGG + Intergenic
1004044393 6:12011625-12011647 GGCGGCTCGGCCGGGCGGGGCGG + Intronic
1004045747 6:12021171-12021193 GGAGTCTGGGCCGGGTGCGGTGG - Intronic
1004836572 6:19538235-19538257 TGTGGCACGGCCTGGGGCGATGG - Intergenic
1004924185 6:20402812-20402834 GGGGGCTCGGCCAGGCGCGCGGG + Intronic
1005476467 6:26212865-26212887 GGAAACTCGGCCGGGCGCGGTGG - Intergenic
1005504400 6:26457496-26457518 GGAGGTTGGGCCTGGAGCGCAGG - Intergenic
1005620359 6:27614393-27614415 GGAGCCTAGGCCGGGCGCGGTGG + Intergenic
1005709583 6:28490285-28490307 GGAGGCTGGGGCTGGGGATGGGG + Intergenic
1005712081 6:28512194-28512216 GGCAGCTCGGCCTGCGGCCGTGG + Intronic
1006087670 6:31608064-31608086 GAAGACTAGGCCTGGCGCGGTGG - Intergenic
1006210450 6:32389135-32389157 AGAAGCTCGGCCAGGTGCGGTGG - Intergenic
1006300731 6:33192505-33192527 GGGGGCCGGGCCGGGGGCGGGGG - Intergenic
1006340961 6:33446788-33446810 TGAGGGGCGGCCTGGGGAGGGGG + Intronic
1006635045 6:35456004-35456026 GGGGGCTGGGCCTGGGGGGCAGG + Exonic
1006860791 6:37170479-37170501 GAAGGCTATGCCTGGGGCTGTGG - Exonic
1007665291 6:43509929-43509951 GGAGGCTGCGGCTGCGGCGGAGG + Exonic
1007700161 6:43761739-43761761 AGAGGCCAGGCCTGAGGCGGTGG - Intergenic
1010980287 6:82363793-82363815 GGAGGTTGGGCCAGGGGCTGGGG + Exonic
1011739259 6:90343009-90343031 GGAGAATCGGCCGGGCGCGGTGG - Intergenic
1012423541 6:99090599-99090621 AGAGACTCGGCCAGGTGCGGTGG + Intergenic
1013045498 6:106481259-106481281 AGAGTCTCGGCCGGGCGCGGTGG - Intergenic
1013808232 6:114016751-114016773 GGAGGAGCAGCCTGGGGAGGAGG + Intergenic
1014202054 6:118618873-118618895 GGTGGCAAGGCCTGGGTCGGGGG - Intronic
1015116482 6:129655031-129655053 AGAGGCTCGGCCGGGTGCGGTGG + Intronic
1016065521 6:139678714-139678736 AGAGAATCGGCCTGGTGCGGTGG + Intergenic
1016827821 6:148404698-148404720 GGAGGCTGGGCTTGGGGGGCAGG - Intronic
1017060895 6:150483984-150484006 GGAGGAGATGCCTGGGGCGGTGG - Intergenic
1017470666 6:154734123-154734145 GGAGGGCCGCCCTGGGGCGGAGG + Intronic
1017725747 6:157274958-157274980 GGAGGCTCGGCCTGGAAGGCAGG + Intergenic
1017910896 6:158791993-158792015 GGAGTCTGGGCCGGGCGCGGTGG - Intronic
1017921696 6:158878593-158878615 GGAAACTAGGCCTGGCGCGGTGG - Intronic
1018282130 6:162198296-162198318 GGATGCTGGGCCTGGGGAGCAGG + Intronic
1019006954 6:168806308-168806330 GAAGTCTCAGCCGGGGGCGGTGG - Intergenic
1019145036 6:169970888-169970910 TGAGGCAGGGCCTGGGGCAGCGG + Intergenic
1019473377 7:1232922-1232944 GGAGGCGCGGGCGGCGGCGGCGG - Exonic
1020107840 7:5430370-5430392 GAAGGCTCTGCCTGGGAAGGGGG - Intergenic
1020187466 7:5970169-5970191 GAAGGCTTGGCCGGGCGCGGTGG - Intronic
1020204794 7:6105585-6105607 GGTGGCTAGGCCTGGGGAGGGGG - Intronic
1020295450 7:6754601-6754623 GAAGGCTTGGCCGGGCGCGGTGG + Intronic
1021186987 7:17576030-17576052 GGAGGCCCTGCCTGGTGAGGAGG - Intergenic
1021295867 7:18905176-18905198 GGAGGCTGGGCCGGGCGCAGTGG - Intronic
1021393527 7:20122235-20122257 CTTGGCTCGGCCTGGGGAGGAGG - Intergenic
1022091436 7:27110342-27110364 GGGGGCGCGGCCTGGGGCGGCGG + Exonic
1022303610 7:29125678-29125700 GGAGAGTAGGCCGGGGGCGGTGG - Intronic
1022562546 7:31364774-31364796 CGAGTCTCGGCCGGGTGCGGTGG + Intergenic
1022614490 7:31915291-31915313 GGAGGCCAGGCATGGGGCTGGGG - Intronic
1022721077 7:32942611-32942633 GGGGCCTCGGCCCGGGGAGGCGG - Intergenic
1024259401 7:47562670-47562692 GCAGACTAGGCCTGGTGCGGTGG - Intronic
1024865518 7:53901088-53901110 GGAGGCTCTCCCTGCGGCTGAGG - Intergenic
1025190669 7:56893322-56893344 GCAGGCTCTGGCTGGGGCAGAGG + Intergenic
1025291311 7:57727029-57727051 GGATTCTCGGCCGGGCGCGGTGG - Intergenic
1025681274 7:63683602-63683624 GCAGGCTCTGGCTGGGGCAGAGG - Intergenic
1025767892 7:64474424-64474446 GTAGGCTTGGCCAGGCGCGGTGG - Intergenic
1026036991 7:66836910-66836932 GAAGGCTGGGGCTGGGGTGGTGG + Intergenic
1026846951 7:73703900-73703922 GGAGCCCGGGCCTGGGACGGAGG - Intronic
1026911510 7:74094145-74094167 GGATGCCCAGCCTGGGGCCGCGG + Intronic
1026966825 7:74445475-74445497 GGTGGGGCGGCCTGGGGAGGCGG + Intergenic
1026984327 7:74545612-74545634 GAAGGCTGGGGCTGGGGCGGTGG - Intronic
1027774155 7:82443830-82443852 GGAGGCGGGGGCGGGGGCGGAGG + Intergenic
1028852109 7:95549582-95549604 GGAGTCTCGGCCGGGCGCGGTGG - Intergenic
1029387304 7:100251917-100251939 GGAGCCTGGGCCGGGTGCGGTGG + Intronic
1029438936 7:100576930-100576952 GGAGGCAGGGGCAGGGGCGGGGG + Exonic
1029458530 7:100682904-100682926 AGAGGCTGGGACTGGGGCTGGGG + Intronic
1029623115 7:101702309-101702331 GGAGGCACAGCCTGGGGGAGAGG + Intergenic
1030234466 7:107243224-107243246 GAAGTCTCGGCCTGGGGCGGTGG + Intronic
1032019010 7:128396359-128396381 GGGGGCTCTGCCTGGGGCTTGGG - Intronic
1032105057 7:129021066-129021088 GGAGGTTTGGCCGGGCGCGGTGG + Intronic
1032116562 7:129122727-129122749 GGGGGCTGGGGCTGGGGCTGGGG + Intergenic
1032148229 7:129403574-129403596 GGAGCCTGGGCCAGGCGCGGTGG + Intronic
1032687660 7:134252044-134252066 GGAGCCTAGGCCTGGTGCAGTGG + Intronic
1032840839 7:135712312-135712334 GGAGACACGGCCTGGGGCTCAGG + Intronic
1032940420 7:136782450-136782472 GGAGACTGGGGCTGGGGTGGTGG - Intergenic
1032981122 7:137284241-137284263 TGATGCTCGGCCCGGCGCGGTGG - Intronic
1033345663 7:140523858-140523880 GTAGGCTCGGCCAGGTGCAGTGG - Intronic
1033477136 7:141702044-141702066 GGAGGCTGGGGCCGGGGCGGCGG - Exonic
1033657465 7:143382975-143382997 TGAGGCTTGGGCTGGGGCTGGGG - Exonic
1033718477 7:144029413-144029435 GAAGGTTCGGCCGGGCGCGGTGG + Intergenic
1033989075 7:147262515-147262537 GGAGGCCGGGCCTGGCGCGGTGG + Intronic
1034192638 7:149223859-149223881 GGTGGCTGGGGCTGGGGCTGGGG - Exonic
1034207052 7:149326406-149326428 GGAAGTTCGGCCGGGTGCGGTGG - Intergenic
1034355916 7:150450769-150450791 AGAGGCTTGGCCAGGGGCTGGGG - Exonic
1034560383 7:151876274-151876296 TGGGGCTCCGCCTGGGGCGGGGG - Intronic
1034977861 7:155458456-155458478 GGCGGCTCGGGCGGCGGCGGCGG + Exonic
1035013231 7:155739778-155739800 GGAGGCTGGTGCTGTGGCGGGGG - Exonic
1035013245 7:155739820-155739842 GGGGGCTGGTGCTGGGGCGGGGG - Exonic
1035167992 7:157002950-157002972 CTCGGCTCGGCCTGGGGCGGTGG - Intronic
1035168090 7:157003382-157003404 GGGGGCTCGGCCTGGAGCTGGGG - Intronic
1035179115 7:157076658-157076680 GCAGGCTGGGCTGGGGGCGGTGG - Intergenic
1035320631 7:158027111-158027133 GCCGGCTCTGCCTGGGGCTGGGG - Intronic
1035557683 8:578980-579002 GGAGTCTCTGCTTGGGGCTGTGG - Intergenic
1036950334 8:13133546-13133568 GGAGGCGCGGGGCGGGGCGGGGG - Intronic
1037758274 8:21725396-21725418 GAATGCCCAGCCTGGGGCGGGGG + Intronic
1038002625 8:23404203-23404225 GGAGGCCGGGCCTGCTGCGGCGG - Exonic
1038041685 8:23728573-23728595 GGAGGTTTGGCCAGGGGAGGTGG + Intergenic
1038425633 8:27462200-27462222 GCAGGCTGGGGGTGGGGCGGGGG + Intronic
1038808399 8:30815016-30815038 GGAGGCTGGGCCAGGTGCAGTGG + Intergenic
1038905973 8:31903434-31903456 GAAGGCTCGGCCGGGCGCGGTGG - Intronic
1039460749 8:37742054-37742076 TGAGGATCGGCCGGGCGCGGTGG + Intronic
1039542197 8:38381857-38381879 GGAGGCCCGGAGTGGGGCTGGGG + Exonic
1039921478 8:41896828-41896850 GGCGGCTCGTACTGCGGCGGCGG + Intergenic
1039921581 8:41897167-41897189 GGAGGCTCGGCCTAGAGGGCGGG + Intergenic
1040009398 8:42648715-42648737 GGAGACTGGGCCGGGCGCGGTGG + Intergenic
1041449941 8:57995108-57995130 GGAGGCTGGGCACGGGGCCGGGG + Intronic
1041651943 8:60310599-60310621 GGAGGAGCAGCCTGGGGAGGAGG + Intergenic
1041921471 8:63187011-63187033 TGAGGCTGGGCCTGTGGCTGAGG - Exonic
1041974651 8:63783471-63783493 GGAGCCTCGGCTTGGGGATGGGG + Intergenic
1042148961 8:65761083-65761105 GGAGTCTCGCCCTGTGGCGTAGG + Intronic
1042190045 8:66177311-66177333 GGCTGCTCGGACTGCGGCGGCGG + Exonic
1042957859 8:74271245-74271267 GGAGGGTGGGCCTGGGGTGTTGG - Intronic
1044960243 8:97523384-97523406 TGTGGCACGGCCTGGCGCGGTGG - Intergenic
1045053124 8:98344604-98344626 GGACCCTCGGCCGGGCGCGGTGG + Intergenic
1045277486 8:100721325-100721347 TGAGGCTCGGGCGGCGGCGGCGG - Intronic
1045304991 8:100951245-100951267 GGAGCCCAGGCCTGGCGCGGCGG - Intronic
1045383905 8:101653011-101653033 GGAGGCACAGCATGGGGCTGTGG + Intronic
1045802835 8:106121710-106121732 GTAGGCTAGGCCGGGCGCGGTGG - Intergenic
1045815271 8:106270673-106270695 GGAGGCTGGGTTTGGGGCGCGGG + Intronic
1045891680 8:107165211-107165233 GGAGGATGGGCCAGGTGCGGTGG - Intergenic
1046074800 8:109302472-109302494 CGAGGCACAGCCTGGGGAGGAGG - Intronic
1046236032 8:111424732-111424754 GGAGGTTCGGCCGGGCGCGGTGG + Intergenic
1046654215 8:116874727-116874749 GGAGGCGCCGGCTGTGGCGGCGG - Exonic
1046897036 8:119484213-119484235 GGAAGTTAGGCCTGGCGCGGTGG + Intergenic
1047393720 8:124475030-124475052 GGGGCCGCGGCCGGGGGCGGGGG - Exonic
1047952153 8:129943884-129943906 GGAGTCTCGGCGGGGCGCGGTGG - Intronic
1048287351 8:133152134-133152156 GGAGGCTGGGCTTGGGGAGAAGG - Intergenic
1048993375 8:139774329-139774351 GGAGGCTGGGACTGGGGGCGCGG + Intronic
1049166373 8:141128555-141128577 GGAGGCGGGGCCTGGAGGGGCGG - Intronic
1049280481 8:141741640-141741662 AGCTGCTCGGGCTGGGGCGGGGG - Intergenic
1049325214 8:142018037-142018059 GCAGGCAGGGCCTGGGGTGGGGG - Intergenic
1049353792 8:142177888-142177910 GGAGGCACGGCCTGGCGCTGCGG + Intergenic
1049417083 8:142500189-142500211 GGAGGAGCGGTGTGGGGCGGGGG - Intronic
1049428630 8:142549146-142549168 GGAAGCAGGGCCTGGGGAGGTGG - Intergenic
1049441532 8:142611966-142611988 GGAGGCTCTGACGGGGTCGGGGG - Intronic
1049619268 8:143590615-143590637 GGAGCCTCGGCCAGGCACGGTGG + Intronic
1049673020 8:143878116-143878138 GGAGAGGCGGCCAGGGGCGGGGG - Intronic
1049711659 8:144066798-144066820 TGAGGCTCGGCCAGGCGAGGTGG + Intergenic
1049766552 8:144357949-144357971 GGTGGCCCGGGCGGGGGCGGAGG - Intronic
1049867857 8:144950598-144950620 GGCAGCTCGGCCTGGGCTGGAGG - Intronic
1051374600 9:16390309-16390331 GGAGGCTAGGCTGGGGGTGGAGG - Intergenic
1052597086 9:30574856-30574878 GGTGGCTCGGCATGGGCCTGTGG + Intergenic
1053393722 9:37753784-37753806 GGAAGCGAGGCCGGGGGCGGGGG + Intronic
1053592314 9:39526741-39526763 GGGGGCTGGGCCGGGCGCGGTGG - Intergenic
1053789227 9:41674672-41674694 GGTGGCTGTGCCTGGGGCAGGGG + Intergenic
1054155913 9:61640091-61640113 GGTGGCTGTGCCTGGGGCAGGGG - Intergenic
1054160359 9:61668671-61668693 GGGGGCTGGGGCTGGGGCTGGGG - Intergenic
1054177508 9:61886025-61886047 GGTGGCTGTGCCTGGGGCAGGGG + Intergenic
1054475684 9:65571091-65571113 GGTGGCTGTGCCTGGGGCAGGGG - Intergenic
1054573987 9:66838538-66838560 GGGGGCTGGGCCGGGCGCGGTGG + Intergenic
1054660023 9:67694783-67694805 GGTGGCTGTGCCTGGGGCAGGGG - Intergenic
1054927120 9:70600606-70600628 GGAGGCTGGGGGTGGGGTGGAGG + Intronic
1055040365 9:71864504-71864526 GAAGACTGGGCCAGGGGCGGTGG - Intronic
1055265994 9:74497173-74497195 GGAGGCGGGGGGTGGGGCGGGGG - Intergenic
1056113656 9:83421225-83421247 GATGGCTCGGCCGGGCGCGGTGG - Intronic
1056153996 9:83817388-83817410 GGGGACTCGGCCTGAGGCGACGG - Intronic
1056168555 9:83960912-83960934 GGAGGGTCGGCCAGGTGTGGTGG + Intergenic
1056356498 9:85805699-85805721 GGGGACTCGGCCTGAGGCGACGG + Intergenic
1056840929 9:89997520-89997542 GGGGGCTCTGCCTGGTGCTGGGG - Intergenic
1056950499 9:91037251-91037273 GGAGGGGAGCCCTGGGGCGGAGG - Intergenic
1057072822 9:92115118-92115140 GGAGGAACGGGCGGGGGCGGGGG - Intronic
1057269744 9:93644097-93644119 AGAGGCTCGGCTGGGCGCGGTGG + Intronic
1057436826 9:95048446-95048468 TGAGGCGGGGCCTGGGGCGCAGG + Intronic
1057462093 9:95272223-95272245 GGAGGCGGGGCCGGGCGCGGTGG - Intronic
1057880024 9:98786264-98786286 GGAGTTCCGGCCTGGAGCGGTGG - Intronic
1058991155 9:110256250-110256272 GGCGTCTCGGCCTGGGACTGCGG - Intronic
1059979176 9:119750924-119750946 GGATGCTGGGCCGGGTGCGGTGG + Intergenic
1060108240 9:120888261-120888283 GGAGGCTGGGCCAGGCGCGGTGG - Intronic
1060186679 9:121567993-121568015 CGAGGCTGGGCATGGGGGGGTGG + Intronic
1060283482 9:122228860-122228882 TGAGGCCGGGCCCGGGGCGGCGG - Intronic
1060391957 9:123285152-123285174 AGTGGCTCAGCCTGGCGCGGTGG + Intergenic
1060562459 9:124557418-124557440 GGAGGATTGGCCGGGCGCGGTGG - Intronic
1060759559 9:126235892-126235914 CGAGGCCCGGTTTGGGGCGGGGG - Intergenic
1060952597 9:127613107-127613129 CGCGGCGCGGCCCGGGGCGGGGG - Intronic
1061000423 9:127899438-127899460 GGAGGCGGGGGCTGGGGCGGAGG - Intronic
1061092172 9:128432858-128432880 GGAGGCCAGGCCAGGTGCGGTGG + Intronic
1061235674 9:129341433-129341455 GGAGGGTGGGCCGGGGGCTGGGG - Intergenic
1061252013 9:129431994-129432016 GCAGGCTGGGCCTGGAGCTGGGG + Intergenic
1061320126 9:129823497-129823519 GGGGGCTGGGGCTGGGGCTGGGG - Intronic
1061320266 9:129823866-129823888 GGAGGCTGGGGCTGGGGCTGGGG - Intronic
1061378287 9:130239062-130239084 GGACCCTCGGCCGGGCGCGGTGG + Intergenic
1061478770 9:130886062-130886084 GGAGGCCCAGCCGGGGGAGGAGG - Intronic
1061515326 9:131086598-131086620 GGAGTCTCGGCCAGGTGTGGTGG + Intronic
1061541002 9:131277728-131277750 GGGGGGGCGGCCGGGGGCGGAGG + Intergenic
1061543527 9:131290744-131290766 GGAGGCTGGGCCAGAGGCGGTGG + Intronic
1061584782 9:131558612-131558634 GGAGGTTGGGCGGGGGGCGGAGG - Intergenic
1061625420 9:131838392-131838414 CGGGGCTGGACCTGGGGCGGGGG + Intergenic
1061799429 9:133105850-133105872 GGGGGCTGGGGCTGGGGCGGGGG - Intronic
1061854893 9:133436698-133436720 CGAGGCACGGCCTGGAGCTGAGG + Intronic
1061879362 9:133561056-133561078 GGAGGGTCGGCCCGGGGCTCAGG + Intronic
1062200376 9:135299776-135299798 GTGGGCTCTGCCTGGGGAGGTGG - Intergenic
1062209476 9:135356010-135356032 GGGGGCTCCGGCTGGGGAGGGGG - Intergenic
1062393725 9:136344170-136344192 GGAGGCGCGGACAGGAGCGGGGG + Intronic
1062444508 9:136587975-136587997 GGAGGCGGGGGCGGGGGCGGGGG + Intergenic
1062488532 9:136792897-136792919 GGAGGGTCGGCCTGGGGTCAGGG - Exonic
1062617984 9:137406809-137406831 TGAGGAGCGGCCTGGGGTGGGGG - Intronic
1062659584 9:137622405-137622427 AGATGATCGGCCGGGGGCGGTGG - Intronic
1186369279 X:8930216-8930238 GGTGACTCGGCCAGGCGCGGTGG - Intergenic
1187150085 X:16673171-16673193 GTAGCCTCGGCCGGGCGCGGTGG - Intronic
1188089396 X:25944728-25944750 GAAGGCTCGGCCGGGCGCGGTGG + Intergenic
1188482970 X:30653346-30653368 GGGGGCGGGGCCTGGGCCGGAGG + Exonic
1189267851 X:39730330-39730352 GGAGGCTGGGGCTGGGGCCTGGG + Intergenic
1190057469 X:47190047-47190069 GGAGTCTTGGCCGGGCGCGGCGG - Intergenic
1190108410 X:47574410-47574432 GGCGGCGCGGCCTGGGACGCGGG + Exonic
1190869809 X:54415418-54415440 GGGGGCTTGGCCGGGTGCGGTGG - Intergenic
1190878160 X:54474489-54474511 GGGCGCTCGGCCTGGGGCCTGGG - Intronic
1190908609 X:54751392-54751414 GGAGTGTGGGCCTGGAGCGGGGG + Intronic
1192203666 X:69082580-69082602 TGAGGCTGGGGCTGGGGCTGGGG - Intergenic
1193478413 X:81996292-81996314 GGAGGCCCCGCCTGGTGAGGAGG - Intergenic
1194421060 X:93673390-93673412 GGAGGCCCGGGCTGCGGAGGTGG + Exonic
1194459302 X:94146913-94146935 GAAGTCTCGGCCAGGCGCGGTGG - Intergenic
1195095084 X:101494016-101494038 TGAGGCTGGGGCTGGGGCTGAGG + Exonic
1195095091 X:101494034-101494056 TGAGGCTGGGGCTGGGGCTGAGG + Exonic
1195095100 X:101494052-101494074 TGAGGCTGGGGCTGGGGCTGGGG + Exonic
1195095114 X:101494088-101494110 TGAGGCTGGGGCTGGGGCTGGGG + Exonic
1195108501 X:101623212-101623234 GGCGGGCCGGCCTGCGGCGGAGG + Exonic
1195197895 X:102516928-102516950 GGAGGTGGGGCCTGGGGAGGCGG - Intergenic
1195306070 X:103585462-103585484 GGAGGCGGGGCGTGGGGCGGTGG + Intronic
1196698576 X:118641074-118641096 GGGGGCTCGGCTGGGTGCGGTGG - Intronic
1197204661 X:123779357-123779379 GGAGACTAGGCCGGGCGCGGTGG - Intergenic
1198276373 X:135098600-135098622 GGCGGCTCTGTCTGCGGCGGCGG - Intergenic
1198387939 X:136147071-136147093 GGCGGCTGGGGCTGGGGAGGTGG - Intergenic
1200003316 X:153072823-153072845 AGAGGCGCGGCCAGGGGAGGAGG + Intronic
1200004407 X:153077186-153077208 AGAGGCGCGGCCAGGGGAGGAGG - Intergenic
1200058823 X:153474996-153475018 GGAGGGCCGGCCGGGGGAGGGGG + Intronic
1200292459 X:154886246-154886268 GCAGGCTCGGGCTGGGGAGCCGG + Intronic
1200339303 X:155381986-155382008 GCAGGCTCGGGCTGGGGAGCCGG + Intergenic
1200347167 X:155458707-155458729 GCAGGCTCGGGCTGGGGAGCCGG - Intergenic
1201395570 Y:13544249-13544271 GGGGTCTCGGCCTGGGGCCTTGG + Intergenic