ID: 1131228228

View in Genome Browser
Species Human (GRCh38)
Location 15:90642559-90642581
Sequence TGGGGCGGCGGCACCGGAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 323}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131228215_1131228228 9 Left 1131228215 15:90642527-90642549 CCGAAGGCGGGCCCGGAGTGGGA 0: 1
1: 0
2: 1
3: 4
4: 88
Right 1131228228 15:90642559-90642581 TGGGGCGGCGGCACCGGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 323
1131228218_1131228228 -2 Left 1131228218 15:90642538-90642560 CCCGGAGTGGGAGGCTCGGCCTG 0: 1
1: 0
2: 2
3: 32
4: 285
Right 1131228228 15:90642559-90642581 TGGGGCGGCGGCACCGGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 323
1131228219_1131228228 -3 Left 1131228219 15:90642539-90642561 CCGGAGTGGGAGGCTCGGCCTGG 0: 1
1: 0
2: 4
3: 19
4: 345
Right 1131228228 15:90642559-90642581 TGGGGCGGCGGCACCGGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 323
1131228206_1131228228 28 Left 1131228206 15:90642508-90642530 CCACTGATCTCCGTCCGCACCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1131228228 15:90642559-90642581 TGGGGCGGCGGCACCGGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 323
1131228210_1131228228 18 Left 1131228210 15:90642518-90642540 CCGTCCGCACCGAAGGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1131228228 15:90642559-90642581 TGGGGCGGCGGCACCGGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 323
1131228212_1131228228 14 Left 1131228212 15:90642522-90642544 CCGCACCGAAGGCGGGCCCGGAG 0: 1
1: 0
2: 0
3: 9
4: 54
Right 1131228228 15:90642559-90642581 TGGGGCGGCGGCACCGGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131228228 Original CRISPR TGGGGCGGCGGCACCGGAGA GGG Exonic
900138330 1:1128198-1128220 TGGGGCGGGCGCGCAGGAGAGGG + Intergenic
900149525 1:1171965-1171987 CGGGGAGGCGGCTCCGGAGCGGG + Intergenic
900388163 1:2420008-2420030 TGGGGAGGCAGCACAGGAGGGGG - Intergenic
900656931 1:3763116-3763138 GGAGTCTGCGGCACCGGAGAGGG + Exonic
901443316 1:9292654-9292676 CAGGGCGGCGGCTCGGGAGAGGG + Intergenic
902935092 1:19759269-19759291 TGTGGCGGTGGCAGTGGAGAAGG - Intronic
902998079 1:20243112-20243134 AGGGGAGGCGGCAGCGGAGAGGG - Intergenic
903296114 1:22343971-22343993 TGGGGCGGCTGCAGTGGAGCAGG + Intergenic
903652465 1:24930228-24930250 TGGGGCTGCGGCCGCGGAGTCGG - Intronic
904045136 1:27604116-27604138 AGCGGCGGCGGCGGCGGAGACGG - Intronic
904471364 1:30738483-30738505 TGGTGGGGCTGCACCAGAGATGG - Intronic
905202449 1:36323534-36323556 AGGGGCGGCGGGACCCGAGCGGG - Intronic
906572217 1:46852476-46852498 TGGGGTGGGGGCAGCGGGGAGGG + Intergenic
907777892 1:57536762-57536784 TGGGGCTGCGGCAGCAGAAAGGG - Intronic
910719492 1:90270605-90270627 TGGGGTGGGGGCAGCGGGGAGGG - Intergenic
912037856 1:105344302-105344324 TGGGGTGGCGGAAGCGGGGAGGG + Intergenic
912727613 1:112072550-112072572 TGGGGAGGAGGCACTGGTGAAGG + Intergenic
913300689 1:117366780-117366802 AGGGGCGGCGGCAGCGGAGCCGG + Intergenic
915325325 1:155078923-155078945 GGCGGCGGCGGCTCCGGGGATGG + Exonic
915720227 1:157979146-157979168 TGGGGCGGCGGAAGGGGACAGGG - Intergenic
916647205 1:166797651-166797673 TGGGGCGGGGACAGTGGAGAGGG + Intergenic
918172573 1:182011209-182011231 TGGGGTGGCGGCCCGGCAGAGGG - Intergenic
918332557 1:183473103-183473125 TGGGGCGGGGGAACCGCGGAGGG + Intronic
919609975 1:199733061-199733083 TGGGGCGGGGGGATGGGAGAGGG + Intergenic
923429186 1:233904768-233904790 TAGGGCGGCGGCGACGGTGACGG + Intergenic
923541257 1:234889854-234889876 TCGGGCTGCGGCACAGCAGAAGG + Intergenic
1063189630 10:3681164-3681186 TGGGGTGGGGGCAGCGGGGAGGG + Intergenic
1064086644 10:12350191-12350213 TGGGGAGAAGGCAGCGGAGAGGG - Intronic
1064418043 10:15168035-15168057 TCGGGTGGCGGCTGCGGAGAGGG + Intronic
1068159152 10:53241509-53241531 TGGGGTGGGGGGAGCGGAGAGGG - Intergenic
1069464788 10:68628693-68628715 TGGGGCTGCTGGACCGGGGAAGG + Intronic
1069818407 10:71212897-71212919 GGAGGCGGCGGCGGCGGAGACGG + Exonic
1070508711 10:77140354-77140376 TGGGCCTGCTGCTCCGGAGAAGG - Intronic
1070563888 10:77589262-77589284 TGGGGAGGCAGCACTGGAGTAGG + Intronic
1071744085 10:88395043-88395065 TGGGGTGGGGGGACGGGAGAGGG + Intronic
1072887602 10:99292934-99292956 TGGGGAGGCGGGAGCAGAGAAGG - Intergenic
1074303075 10:112250462-112250484 TGGGGTGGCGGGAGGGGAGAGGG + Intergenic
1076067739 10:127462507-127462529 TGGGGTGGCGGGAGCGGGGAGGG + Intergenic
1076746106 10:132515302-132515324 TGTGGCGGAGGCACAGCAGAGGG + Intergenic
1076834159 10:133012660-133012682 TGGCACGGCGGCACCGGAAGCGG + Intergenic
1076911496 10:133392326-133392348 TGGGGTGGAGGGGCCGGAGAGGG - Intronic
1077085376 11:747442-747464 TGCGGCGGCGGCGGCGGCGACGG - Exonic
1077107827 11:849640-849662 TGGGGCGCCGGCGCGGGCGAAGG + Intronic
1077304837 11:1864380-1864402 TGGGGCAGGGGCACCACAGAGGG + Intronic
1077831514 11:5876773-5876795 TGGGGTGGGGGCAGCGGGGAGGG + Intronic
1077915944 11:6611780-6611802 TGGCGCGGCGCCCCCGGAGGGGG - Exonic
1078416770 11:11172447-11172469 TGGGGAGGCAGCAGTGGAGAAGG + Intergenic
1080485269 11:32699730-32699752 TGGGGTGGGGGGAGCGGAGAGGG + Intronic
1081860781 11:46332494-46332516 TGGGGAAGGGGCACAGGAGAGGG - Intergenic
1083264082 11:61538100-61538122 TGCGGCGGCGGCGGCAGAGAAGG - Intronic
1083669331 11:64291577-64291599 TGGGGCGGCGCCGGCGGCGAGGG + Intronic
1084028368 11:66466835-66466857 TGGGGCGGGGCCTCCGGACAGGG + Intronic
1084546749 11:69818607-69818629 GGGGGAGGCGGCGCCGGGGAGGG - Intronic
1085128178 11:74016298-74016320 TGGGGCGGCTTCACAGGAGGTGG + Intronic
1085265843 11:75237413-75237435 GGGGGCTGCGGCAAAGGAGATGG + Intergenic
1086614893 11:88804536-88804558 TGGGGTGGCGGGAGCGGGGAGGG + Intronic
1086673376 11:89573944-89573966 TGGGGCGACTCCACCGGAAAAGG - Intergenic
1087840013 11:102910689-102910711 TGGGGTGGCGGGAGCGGGGAGGG + Intergenic
1089689916 11:120180842-120180864 TGGGGTGGGGGCACTGGAGAAGG - Intronic
1089966065 11:122655917-122655939 GGAGGCGGCGGCAGCGGAGGCGG - Exonic
1091167748 11:133494721-133494743 TGGGGCGGGGGGACGGGGGAGGG + Intronic
1091391439 12:128690-128712 TGGGGCAGGGGCACTGGGGAAGG - Intronic
1091613951 12:2035055-2035077 GGGGGCGCCGGCACCTGAGGTGG - Intronic
1093514180 12:19966469-19966491 TGGGGTGGGGGCAGCGGGGAGGG - Intergenic
1096787787 12:54027585-54027607 TAGGGAGGTGGCACCGGAGGGGG - Intronic
1096895011 12:54812712-54812734 TGGGGTGGCGGGAGCGGGGAGGG - Intergenic
1097053525 12:56237379-56237401 TGGGGAGGCGGGAGTGGAGAGGG + Intronic
1097225806 12:57476283-57476305 TGTGGGGGCGGCAGCGGGGAGGG - Intronic
1099955940 12:89352720-89352742 AGGGGAGGCGGCAGCGGAGGAGG + Exonic
1101259413 12:103013271-103013293 GGGGGAGGGGGTACCGGAGAAGG + Intergenic
1103800358 12:123533739-123533761 GGCGGCGGCGGCAGCGGGGAGGG + Intergenic
1104606221 12:130190899-130190921 TGGGGCGGGGGCAGAGGGGAGGG + Intergenic
1104786878 12:131455733-131455755 TGGGGTGGGGGCACAGGACAGGG + Intergenic
1105299385 13:19118688-19118710 GGTGGTGGCGGCAACGGAGACGG + Intergenic
1105801083 13:23903721-23903743 TGGGGCGGAGGCGCGGGAGGCGG - Intergenic
1108573068 13:51769181-51769203 TGCGGCTGCGGCAGAGGAGAGGG + Exonic
1108689271 13:52847309-52847331 GGCGGCGGCGGCAGCGGCGAAGG + Exonic
1108727782 13:53201087-53201109 GGCGGCGGCGGCAGCGGCGAAGG - Intergenic
1110119754 13:71866516-71866538 GGCGGCGGCGGCAGCGGAGGCGG - Exonic
1112091898 13:96091111-96091133 GGGGGCCGCGGCGCCGGAGGAGG + Exonic
1113490517 13:110688126-110688148 TGAGGCCGAGGCACCGGAGGTGG - Intronic
1114048530 14:18898570-18898592 TGGGGTGGAGGCAGCGGGGAGGG + Intergenic
1114113982 14:19503076-19503098 TGGGGTGGAGGCAGCGGGGAGGG - Intergenic
1114115681 14:19620828-19620850 TGGGGTGGAGGCAGCGGGGAGGG - Intergenic
1114195079 14:20469743-20469765 TGGGGTGGCGCCACCGGAGCAGG + Intronic
1114665873 14:24376784-24376806 TGGGGAGGGGGCTCCGGAGCAGG + Exonic
1115747255 14:36450289-36450311 TGGGGGAGTGGCAGCGGAGAGGG - Intergenic
1116170589 14:41396488-41396510 TGGGGTGGGGGCAGGGGAGAGGG + Intergenic
1117115724 14:52508905-52508927 TGGGGTGGGGGCAGCGGGGAGGG + Intronic
1117605289 14:57422620-57422642 TGGGGCGGCAGCAGCGGGGGTGG - Intergenic
1118636532 14:67753261-67753283 TGGGGCTGTGGCACTGGAGCAGG - Intronic
1119215935 14:72869062-72869084 TGTGGCTGCAGCACTGGAGAGGG - Intronic
1119623689 14:76152177-76152199 GGGGGCTGTGGCCCCGGAGACGG - Intronic
1120757535 14:88258045-88258067 TGGGGTGGGGTCACCGGGGAGGG - Intronic
1121299642 14:92860353-92860375 GGGGGCGGCGGAAAAGGAGAGGG + Intergenic
1122620961 14:103057472-103057494 TGCGGCGGCGGCGGCGGGGAGGG - Intergenic
1122736945 14:103848360-103848382 GGGGGCGGCGCCTCTGGAGACGG - Intergenic
1125169501 15:36750099-36750121 TGTGGTGGGGGCACAGGAGAGGG + Intronic
1125674464 15:41494812-41494834 TGCGGCCGCGGCACCGGAGAGGG - Intronic
1127322236 15:57858053-57858075 TGGGGAGACTGCACCAGAGAAGG - Intergenic
1127433300 15:58933218-58933240 CGGGGCGGGGGCACCGCGGAAGG + Intronic
1128719752 15:69939761-69939783 TGGGGCAGCAGCAGCAGAGAGGG + Intergenic
1128813506 15:70588376-70588398 TGGGGAGGAGGCACAGGAGCAGG - Intergenic
1128929377 15:71690447-71690469 TGGGGCGTGGGGACCTGAGATGG + Intronic
1129698167 15:77752469-77752491 TGGGGAGGCTGGGCCGGAGAAGG - Intronic
1130538218 15:84802150-84802172 GGAGGCGGCGGCAGCGGAGATGG + Exonic
1131228228 15:90642559-90642581 TGGGGCGGCGGCACCGGAGAGGG + Exonic
1132111655 15:99106038-99106060 TGGGGCGACGGCAGCGGGTATGG - Intronic
1132580090 16:680710-680732 GGCGGCGGTGGCACCGGGGAGGG + Intronic
1132843690 16:1990403-1990425 GGGGCCGGCGGCGCCGGAGAGGG + Intronic
1132846727 16:2004178-2004200 GGGGGCGGGGGCGCCGGACAGGG - Intronic
1133311135 16:4847529-4847551 TGAGGCGGCGGCGGCGGCGACGG + Intronic
1136500874 16:30669221-30669243 TGCGGCGGCGGCAGCGGCGGCGG - Exonic
1137537119 16:49335914-49335936 TGGTGCAGCGGCAACGGTGAAGG - Intergenic
1137878450 16:52020522-52020544 TGGGGCGGTGGGAGTGGAGAGGG + Intronic
1138379425 16:56589950-56589972 GGGGGCGGCGGCAGAGGGGAAGG - Intronic
1139451402 16:67030094-67030116 TTAGGCGGCGACACCGAAGAAGG + Intronic
1139528551 16:67530479-67530501 AGGGGCGGCTGCAAGGGAGAAGG - Intronic
1139577563 16:67851648-67851670 TGGGGCGGGGGTAGCGGGGAGGG - Intronic
1140527832 16:75638376-75638398 AGGGGCGGGGGGACCGGGGAGGG - Intronic
1142583806 17:958242-958264 TTGGGCAGAGGCACCGGGGAAGG - Intronic
1142836795 17:2593588-2593610 TGGGGCGGCGGCGGCGGCGGCGG + Intronic
1143618720 17:8069068-8069090 TGGAGTGGGGGCACAGGAGAGGG - Intergenic
1143894857 17:10128011-10128033 AGGGGAGGCAGCACCGGCGAGGG + Intronic
1144877981 17:18412264-18412286 GGGGGCGGCGGCAGCCGTGATGG - Intergenic
1145154248 17:20532161-20532183 GGGGGCGGCGGCAGCCGTGATGG + Intergenic
1145291663 17:21551446-21551468 TGGGGCGGCGGGACCGGTGCGGG + Exonic
1145388401 17:22435582-22435604 TGGGGCGGCGGGGCCGGTGGGGG - Intergenic
1146393656 17:32444667-32444689 TCGGTCGGCGGCAGCGGAGAGGG + Intronic
1149661866 17:58338291-58338313 TGGGGCTGCGGCTCTGGGGAGGG + Intergenic
1150316076 17:64170421-64170443 TGGGGCAGCTGCACCCGTGAGGG + Intronic
1151559267 17:74861838-74861860 TGGGGACGCGGTTCCGGAGAGGG - Intergenic
1151589191 17:75032411-75032433 TAGGGCGGCGGCAGCAGGGATGG + Intergenic
1151615151 17:75205356-75205378 TGGGGCGGCGGCACTTGGGTGGG - Intergenic
1152729218 17:81961502-81961524 AGGGGCGGCGGCGACGGGGAGGG + Intronic
1152801338 17:82332237-82332259 TGAGGCGCCGGCACCAGACACGG + Intronic
1153299448 18:3580516-3580538 GGAGGCGGCGGCAGCGGAGATGG + Intronic
1155392740 18:25352361-25352383 AGGGGCGGCGGCGCAGGAGCGGG - Intergenic
1158730533 18:60017844-60017866 TGGGGTGGGGGCAGCGGGGAGGG - Intergenic
1160135047 18:76264632-76264654 TGAGGGGACGGCACAGGAGATGG - Intergenic
1160745390 19:708984-709006 GGGGGCGGCGGCACCGGCTCGGG - Intergenic
1160863992 19:1249297-1249319 TAGGGCCGCGGCCCCGGGGAGGG - Intronic
1162934146 19:13972825-13972847 GGAGGCGGCGGCAGCGGAGCAGG - Exonic
1162935332 19:13979000-13979022 CGGGGCGGCGGCTCCGGCGGCGG + Intronic
1163197576 19:15733884-15733906 TGGGGCAGTGGCCCAGGAGAGGG + Intergenic
1163442455 19:17328766-17328788 GGGGGCGGCGGCAGCGGGGGCGG - Exonic
1163508026 19:17719696-17719718 TGGGGCGGCGGCGGCGGCGGCGG + Intronic
1163693501 19:18750531-18750553 TGGGGCGGTGCCATCAGAGAAGG + Intronic
1164835112 19:31350877-31350899 TGGGGCGGCCGCGCCGGGGCCGG + Intergenic
1166703815 19:44897227-44897249 TGGGGGGGTGGCCCAGGAGATGG + Intronic
1166710133 19:44931528-44931550 TGGGGCAGGGGTGCCGGAGAGGG + Intergenic
1166994632 19:46714328-46714350 TGGGGAGGAGGCACAGGGGAGGG - Intronic
1167115043 19:47484177-47484199 TGGGGCGGGGGCTGCGGAGAGGG - Exonic
1167244290 19:48364460-48364482 GGGGGTGACGGCACCTGAGAAGG - Exonic
1167478060 19:49712405-49712427 TGGGGGGGCGGCAAGGCAGAAGG + Intronic
1168102480 19:54148448-54148470 GGAGGCGGCGGCAGCGGAGGCGG + Exonic
1168332361 19:55578084-55578106 TGGGGTGGGGTCCCCGGAGAGGG + Exonic
927168590 2:20350334-20350356 CGAGGCGGCGGCCCCGCAGAGGG + Intronic
927826731 2:26314493-26314515 AGGGGAGGTGGCACAGGAGATGG + Exonic
927842640 2:26455278-26455300 TGGGGCAGGGGCACTGGAGCTGG + Intronic
929743045 2:44624468-44624490 TGGGGTGGGGGCACAGGGGAGGG - Intronic
931468678 2:62515662-62515684 TGGGGTGGCAGCACGGGGGAGGG - Intergenic
931734776 2:65183792-65183814 TGGGGCGGGGGGAGGGGAGAGGG + Intergenic
932236568 2:70125280-70125302 TGGGGCGGCGGCAGCGTGGCAGG - Intergenic
932496590 2:72148637-72148659 TGGGGCGGCGGCGGCGGCGGCGG + Intergenic
932820709 2:74897503-74897525 TGGGGCGGCGGCGGCGGGGAGGG - Intergenic
934065992 2:88342445-88342467 TGGGGTGGCGGGAGCGGGGAGGG + Intergenic
934487024 2:94725201-94725223 TGGGGCGGGGACAGTGGAGAGGG - Intergenic
934488413 2:94738691-94738713 TGGGGCGGAGACAGTGGAGAGGG + Intergenic
938038140 2:128053520-128053542 TGGGGCGGCGGCGGCGGGGGCGG - Intergenic
940729638 2:157374404-157374426 TGGGGTGGCGGGAGCGGGGAGGG + Intergenic
946447287 2:219751057-219751079 TGGGGCGGCGGCTGGGCAGAGGG + Intergenic
947639243 2:231697056-231697078 TGGGGCAGAGGGACCTGAGAGGG + Intergenic
947860528 2:233354561-233354583 TCGGGCGGCGGCGGCGGAGGCGG - Exonic
948893063 2:240916403-240916425 TGGGCGGGGGGCACCGGGGAAGG - Intergenic
948909242 2:240994657-240994679 TGGGGAGGGGGCACTGGAGGAGG + Intergenic
948951485 2:241255123-241255145 AGGGGCGGCGACAGAGGAGACGG + Exonic
1169245024 20:4018298-4018320 TGGGGAGGCTCCACAGGAGAAGG + Intergenic
1169556804 20:6759897-6759919 TGGGGTGGGGGCAGCGGGGAGGG + Intergenic
1170150417 20:13221462-13221484 GGCGGCGGCGGCGGCGGAGACGG - Intergenic
1170908896 20:20543730-20543752 TGGGGCGGGGGGAGCGGGGAGGG + Intronic
1172037053 20:32018287-32018309 TGCGGCGGGGGCAGAGGAGATGG + Intronic
1172083219 20:32358680-32358702 TGGGGCGGCGGCGGCGGTGGGGG - Exonic
1172474587 20:35227035-35227057 GCGGGGGGCGGCACCGGGGACGG + Intronic
1172622711 20:36330307-36330329 GGGGGCGGCAGGACTGGAGAAGG + Intronic
1173263701 20:41459301-41459323 TGGGGCGGGGGTACAGGAAATGG + Intronic
1173425214 20:42936683-42936705 TGGGGCAGCAGCACAGGAGGTGG + Intronic
1173868614 20:46328534-46328556 TGGGATGGCGGCAGCGGGGAAGG - Intergenic
1175029600 20:55938904-55938926 TGGGGTGGGGGCAGCGGGGAGGG - Intergenic
1175580958 20:60099287-60099309 TGGGGTGGCGGGAGCGGGGAGGG - Intergenic
1175917471 20:62433365-62433387 TGGGGTGGAGGCTCCGGGGAGGG + Intergenic
1176223014 20:63979015-63979037 TGGGGCGGGGGCACCGAGGCGGG + Intronic
1176604826 21:8820196-8820218 AGGGGCGGCTGCACCGGGGCAGG + Intergenic
1178953821 21:37006393-37006415 CGGGGAGGGGGCACCAGAGAAGG - Intronic
1180086204 21:45509054-45509076 TGGAGCCGCGGCAAAGGAGAGGG + Intronic
1180347116 22:11711801-11711823 AGGGGCGGCTGCACCGGGGCAGG + Intergenic
1180354866 22:11829891-11829913 AGGGGCGGCTGCACCGGGGCAGG + Intergenic
1180383385 22:12162440-12162462 AGGGGCGGCTGCACCGGGGCAGG - Intergenic
1180467070 22:15621232-15621254 TGGGGTGGAGGCAGCGGGGAGGG + Intergenic
1180948762 22:19711021-19711043 TGGGGAGGTGGCAACGGTGATGG - Intergenic
1180950663 22:19719136-19719158 GGGGGCGGCGGCAGCGGCGGTGG - Intronic
1181640569 22:24195225-24195247 TGGGGTGGCGGGAGGGGAGAGGG + Intergenic
1183326486 22:37197332-37197354 TGAGTCGGCAGCACTGGAGAGGG + Intronic
1183379477 22:37483849-37483871 GGGGGCGGGGGCACAGGAGAGGG + Intronic
1184557394 22:45240749-45240771 GGGGGCGGCGGCGGCGGGGAGGG + Intronic
950487255 3:13281144-13281166 TGGGGAGGCGGCACCAGGGCAGG - Intergenic
950603266 3:14055365-14055387 TGGGGTGGCGGGAGCGGGGAGGG - Intronic
952958970 3:38577918-38577940 TGAGGCGGGGGCAGCGGAGATGG - Intronic
953561823 3:43998250-43998272 TGGGGCGGCACCACCCTAGATGG - Intergenic
954474985 3:50736041-50736063 TGGGGTGGGGGCAGCGGGGAGGG - Intronic
954477540 3:50762106-50762128 TGGGGTGGGGGCAGCGGGGAGGG + Intronic
954829858 3:53411218-53411240 TGTGTGGGAGGCACCGGAGAGGG + Intergenic
955818800 3:62874863-62874885 GGGGGCGGCGGCGCCGGCGCCGG - Exonic
956675021 3:71725284-71725306 GGGGGCGGCGGCAGCGGCGGCGG + Exonic
956794699 3:72707111-72707133 TGGGGCTGGGGCACCAGAGGAGG - Intergenic
958412832 3:93838248-93838270 TGGGGTGGTGGCAGCGGCGAGGG + Intergenic
960540310 3:118854680-118854702 TGGGGCTGGGGGACTGGAGATGG - Intergenic
962891735 3:139678060-139678082 GGGGGCGGGGGCAGGGGAGAGGG - Intergenic
963835170 3:150050804-150050826 TGGGGCGGCGGCACTGCTGGCGG + Intergenic
964546493 3:157839609-157839631 TGGGGCGGGGGCAGGGGGGAGGG + Intergenic
966355059 3:179071377-179071399 CGGGGCGGGGGCAACTGAGAGGG + Intronic
966919413 3:184602211-184602233 GGGGTCAGCGACACCGGAGAAGG - Intronic
967490838 3:190089219-190089241 TGGGGCGGGGGAAGCGGGGAGGG + Intronic
968353486 3:198081282-198081304 TGGGGCGGCTGCACAGGGGCGGG - Intergenic
968522062 4:1038504-1038526 TGGGCAGGCGGCCCCGGGGAGGG - Intergenic
969167881 4:5332637-5332659 TGGGGTGGAGGCAGCGGGGAGGG - Intronic
970202898 4:13627538-13627560 GGAGGCGGCGGCGCCGGAGGAGG + Exonic
973263480 4:48186898-48186920 TGGGGTGGCGGCCACGCAGAGGG - Intronic
973373294 4:49270741-49270763 AGGGGCGGCTGCACCGGGGCAGG - Intergenic
974716037 4:65669753-65669775 CGGGACAGCGGCACCGGAGGAGG - Exonic
975520486 4:75295791-75295813 TGGGGTGGGGGCAGGGGAGAGGG - Intergenic
976177977 4:82373630-82373652 CGGGGCGGCGGCAGCGGCAACGG - Exonic
978645395 4:110925090-110925112 TAGGGCGGAGGCAGCAGAGATGG - Intergenic
983873506 4:172849866-172849888 TGAGGCTGAGGCAACGGAGAAGG + Intronic
984610798 4:181834602-181834624 TGGGGCGGGGGAAGCGGGGAAGG + Intergenic
985404757 4:189626819-189626841 TGGGGCGGGGGGACCTCAGAAGG - Intergenic
985492895 5:189591-189613 TGGGACGGCGGCGCCAGAGCTGG + Exonic
986330557 5:6713767-6713789 TGGGGCGGCGGCGGCGGTGATGG - Intergenic
988482075 5:31639321-31639343 CGCGGCGGCGGCACCGGTGGTGG + Intergenic
989827181 5:45871530-45871552 TGGGGTGGGGGCAGGGGAGAGGG + Intergenic
990545308 5:56815892-56815914 TGGGGCGGCGGCACCGCCACAGG - Exonic
990679179 5:58221876-58221898 TGGGGTGGCGGGAGCGGGGAGGG + Intergenic
993924626 5:93851594-93851616 TGGGGTGGCGGAAGCGGGGAGGG - Intronic
994072823 5:95620837-95620859 GGCGGCGGCGGCAGCGGCGAGGG - Exonic
994805778 5:104446517-104446539 TGGGGTGGCGGGAGCGGGGAGGG - Intergenic
996121233 5:119674754-119674776 TGGGGTGGCGGCAGGGGGGAGGG - Intergenic
997284306 5:132667538-132667560 TGGGGAGGAGGCAGGGGAGAGGG - Intergenic
998151976 5:139762823-139762845 TGGGGCTGTGGCAGCAGAGAGGG + Intergenic
999317583 5:150594222-150594244 TGGGGCTGGGGCAGTGGAGATGG + Intergenic
1002006428 5:176238407-176238429 CGGGGCGGCGGCAGCGGCGGCGG - Exonic
1002219950 5:177672230-177672252 GGGGGCGGCGGCAGCGGCGGCGG + Intergenic
1004924051 6:20402372-20402394 CGGGGCGGCGGCAGCGGCGGCGG - Exonic
1005135976 6:22570097-22570119 GAGGGCGGCGGAAGCGGAGAGGG + Exonic
1005725952 6:28648952-28648974 AGGGGAGGCGTCACCGGACAGGG + Intergenic
1005913079 6:30327361-30327383 TGGGGCTGGGGCATTGGAGAGGG - Intronic
1006117254 6:31781895-31781917 TGAGGCGGAGGCCCGGGAGAAGG - Exonic
1006303240 6:33204981-33205003 CCGGGCAGCGGCACAGGAGACGG + Exonic
1009437566 6:63635829-63635851 TGCGGCGGCGGCGCGGGAGCTGG - Exonic
1009554249 6:65141342-65141364 TGGGGTGGCGGGAGCGGGGAGGG + Intronic
1011470253 6:87701514-87701536 CGAGGCGGCCGCAGCGGAGAAGG + Exonic
1011549844 6:88521349-88521371 TGGGGTGGGGGGAGCGGAGAGGG - Intergenic
1012834433 6:104247178-104247200 TGGGGTGGAGGCATGGGAGAGGG + Intergenic
1012888732 6:104875114-104875136 TGGGGTGGAGGAAGCGGAGAGGG + Intergenic
1013488525 6:110621216-110621238 GGGGTCGGGGGCACCGGAGCAGG - Exonic
1013512830 6:110859586-110859608 TGGGGCGGGGACAGTGGAGAGGG + Intronic
1015976464 6:138796089-138796111 TCGGGCCGCAGCTCCGGAGAGGG - Exonic
1016567054 6:145466993-145467015 TGGGGCGGTGGGAGTGGAGAGGG + Intergenic
1017760189 6:157562509-157562531 TGGGGTGGGGGCTCCCGAGAGGG + Intronic
1019013572 6:168862777-168862799 TGGGCCCGTGGCACCGCAGATGG + Intergenic
1019795019 7:3043056-3043078 GGTGGCGGGGGCACAGGAGAGGG - Intronic
1020418250 7:7969601-7969623 CGAGGCGGCGGCAGCGGCGACGG - Exonic
1022215358 7:28254842-28254864 TGGGGTGGCGGGAGCGGGGAGGG - Intergenic
1022763725 7:33385981-33386003 TGGGGTGGGGGGAGCGGAGAGGG + Intronic
1027238062 7:76309847-76309869 TGGGCTGGCGACGCCGGAGACGG - Intergenic
1027667706 7:81058974-81058996 TGGGGTGGGGGAAGCGGAGAGGG + Intergenic
1028414896 7:90569152-90569174 TGCGGGGGCGTCACCAGAGAAGG + Intronic
1028477001 7:91264491-91264513 TCAGGCGGCGGCGGCGGAGAAGG + Exonic
1028926096 7:96358408-96358430 TGGGGCGGCCGCTCCAAAGATGG + Intergenic
1030348316 7:108456663-108456685 TGGGGCGGCCGCTCAGGTGAGGG - Intronic
1032274280 7:130440880-130440902 GGGGGCGGGCGCACCGGAAAAGG - Intronic
1034277678 7:149830766-149830788 TGGAGGGGAGGCACAGGAGAAGG - Intergenic
1035165223 7:156985437-156985459 TGGGGCGGAGGGCCAGGAGAAGG + Intergenic
1035611976 8:973145-973167 TGGGGTGGCGGCAGGGCAGAGGG + Intergenic
1036398230 8:8386489-8386511 GCGGGCGGCGTCACCGGAGGCGG - Exonic
1036566394 8:9941793-9941815 TGGGGTGGCGGGAGCGGGGAGGG + Intergenic
1039349262 8:36743453-36743475 TGGGGTGGCGGGAGGGGAGAAGG - Intergenic
1039576207 8:38626022-38626044 TGGGGCGGAGGAAAGGGAGAGGG - Intergenic
1040458851 8:47627238-47627260 TGGGGTGGCGGGAGCGGGGAGGG + Intronic
1042097267 8:65230581-65230603 TGGTGCAGCTGCACTGGAGAAGG - Intergenic
1042241292 8:66666915-66666937 GGTGGCGGCGGCAACGGAGGCGG + Exonic
1042878143 8:73458818-73458840 TGGGTGGGTGGCACTGGAGAAGG + Intronic
1043346240 8:79301183-79301205 TGGGGCGGGGGGAGCGGGGAGGG + Intergenic
1047374273 8:124281342-124281364 TGGGGCGGGGGCACTGGGCAGGG + Intergenic
1047639157 8:126799757-126799779 TGGGGTGGCGGCAGCGGGGAGGG - Intergenic
1048381448 8:133869338-133869360 TGGGGTGGGGGCACCGGCGAGGG + Intergenic
1050881789 9:10709190-10709212 TGGGGTGGGGGGACGGGAGAGGG + Intergenic
1051206373 9:14693312-14693334 CTGGGCGGCGGCGCCGGAGGAGG - Exonic
1051324267 9:15947966-15947988 TGGGGTGGGGGCAGCGGGGAGGG - Intronic
1051514189 9:17909831-17909853 TGGGGTGGGGGGACCGGGGAGGG + Intergenic
1053003316 9:34589688-34589710 GGCGGCGGCGGCAGCGGAGGCGG - Exonic
1053137581 9:35661069-35661091 TGGGGCGGGGACTACGGAGAAGG + Exonic
1053669375 9:40345674-40345696 TGGGGCGGAGACAGTGGAGAGGG - Intergenic
1053670770 9:40359128-40359150 TGGGGCGGGGACAGTGGAGAGGG + Intergenic
1053920572 9:42985500-42985522 TGGGGCGGGGACAGTGGAGAGGG + Intergenic
1054380505 9:64485695-64485717 TGGGGCGGAGACAGTGGAGAGGG - Intergenic
1054381890 9:64499190-64499212 TGGGGCGGGGACAGTGGAGAGGG + Intergenic
1054513844 9:66017173-66017195 TGGGGCGGGGACAGTGGAGAGGG - Intergenic
1054515241 9:66030617-66030639 TGGGGCGGAGACAGTGGAGAGGG + Intergenic
1054828572 9:69598283-69598305 TGGGGTGGGGGCACGGGGGAGGG + Intronic
1056350231 9:85741924-85741946 TGCGGCGGCGGCGCTGGAGGCGG + Intronic
1056852261 9:90094582-90094604 TGGGGCGGCGGGACCGGGGTGGG + Intergenic
1058425898 9:104874956-104874978 TGGGGCGGCGGCCGGGTAGAGGG - Intronic
1058467523 9:105244510-105244532 GGAGGCGGCGGCCCGGGAGAGGG + Intergenic
1060996561 9:127877556-127877578 AGGGGCAGCGGCACCGGGGGAGG - Intronic
1062022523 9:134326237-134326259 CGGGGCGGCGGCGGCGGAGGGGG + Intronic
1062659135 9:137619183-137619205 TGAGGCGGCGGCAGCGGCGGCGG - Intronic
1203552206 Un_KI270743v1:172285-172307 AGGGGCGGCTGCACCGGGGCAGG + Intergenic
1185495927 X:554674-554696 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185495944 X:554747-554769 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185495958 X:554805-554827 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185495992 X:554978-555000 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185496000 X:555007-555029 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185496008 X:555036-555058 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185496028 X:555123-555145 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185496050 X:555210-555232 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185496084 X:555370-555392 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185496098 X:555428-555450 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185496123 X:555544-555566 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185496131 X:555573-555595 TGGGGAGGCTGCTCTGGAGAGGG + Intergenic
1185643567 X:1601265-1601287 CGGGGCCGGGCCACCGGAGACGG + Exonic
1186850871 X:13578779-13578801 TGGGGTGGGGGCAGCGGGGAGGG + Intronic
1186857812 X:13642485-13642507 TGGGGCGGGGGCAGGGGGGAGGG + Intergenic
1186993505 X:15094398-15094420 TGGGGTGGGGGCAGCGGGGAGGG + Intergenic
1187067308 X:15854254-15854276 TGGGGGGGAGGCACCGGCGACGG - Intronic
1187547325 X:20266780-20266802 AGCGGCGGCGGCCCCAGAGAGGG + Exonic
1189323262 X:40098420-40098442 TTGGGCGGCGGCGGCGGCGAGGG + Intronic
1190062249 X:47219031-47219053 TGGGGCGGCGGCCCGGGATGAGG - Intronic
1190324115 X:49196132-49196154 TGGGGAGGGGGCACAGGGGATGG + Intronic
1192203839 X:69083250-69083272 TGGGGAGGCGGGACAGGAGAAGG + Intergenic
1196105801 X:111894048-111894070 TGGTACTGCAGCACCGGAGAAGG + Intronic
1197147244 X:123184359-123184381 GGAGGCGGCGGCAGCGGAGGAGG + Exonic
1197516571 X:127438963-127438985 TGGGGTGGCGGAACGGGGGAGGG + Intergenic
1199104743 X:143851681-143851703 TGGGGTGGGGGGAGCGGAGAGGG - Intergenic
1201153487 Y:11107858-11107880 GGGGGCGGCTGCACCGGGGCAGG + Intergenic