ID: 1131234407

View in Genome Browser
Species Human (GRCh38)
Location 15:90683543-90683565
Sequence ACGCACTCACCCCTCCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131234399_1131234407 19 Left 1131234399 15:90683501-90683523 CCTGGTTCCAGTGTCCCCCTCAG No data
Right 1131234407 15:90683543-90683565 ACGCACTCACCCCTCCCCCATGG No data
1131234403_1131234407 4 Left 1131234403 15:90683516-90683538 CCCCTCAGTTGATCTGAGGAAAG No data
Right 1131234407 15:90683543-90683565 ACGCACTCACCCCTCCCCCATGG No data
1131234404_1131234407 3 Left 1131234404 15:90683517-90683539 CCCTCAGTTGATCTGAGGAAAGC No data
Right 1131234407 15:90683543-90683565 ACGCACTCACCCCTCCCCCATGG No data
1131234402_1131234407 5 Left 1131234402 15:90683515-90683537 CCCCCTCAGTTGATCTGAGGAAA No data
Right 1131234407 15:90683543-90683565 ACGCACTCACCCCTCCCCCATGG No data
1131234405_1131234407 2 Left 1131234405 15:90683518-90683540 CCTCAGTTGATCTGAGGAAAGCA No data
Right 1131234407 15:90683543-90683565 ACGCACTCACCCCTCCCCCATGG No data
1131234398_1131234407 20 Left 1131234398 15:90683500-90683522 CCCTGGTTCCAGTGTCCCCCTCA No data
Right 1131234407 15:90683543-90683565 ACGCACTCACCCCTCCCCCATGG No data
1131234400_1131234407 12 Left 1131234400 15:90683508-90683530 CCAGTGTCCCCCTCAGTTGATCT No data
Right 1131234407 15:90683543-90683565 ACGCACTCACCCCTCCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131234407 Original CRISPR ACGCACTCACCCCTCCCCCA TGG Intergenic
No off target data available for this crispr