ID: 1131237175

View in Genome Browser
Species Human (GRCh38)
Location 15:90706698-90706720
Sequence CCACTTCTATTTACAGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131237175_1131237187 23 Left 1131237175 15:90706698-90706720 CCCCAGGCTGTAAATAGAAGTGG No data
Right 1131237187 15:90706744-90706766 GAAGGCATAGGCACAAGAACAGG No data
1131237175_1131237185 11 Left 1131237175 15:90706698-90706720 CCCCAGGCTGTAAATAGAAGTGG No data
Right 1131237185 15:90706732-90706754 CCCAGATTTGAAGAAGGCATAGG No data
1131237175_1131237182 5 Left 1131237175 15:90706698-90706720 CCCCAGGCTGTAAATAGAAGTGG No data
Right 1131237182 15:90706726-90706748 GGATGCCCCAGATTTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131237175 Original CRISPR CCACTTCTATTTACAGCCTG GGG (reversed) Intergenic
No off target data available for this crispr