ID: 1131237185

View in Genome Browser
Species Human (GRCh38)
Location 15:90706732-90706754
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131237175_1131237185 11 Left 1131237175 15:90706698-90706720 CCCCAGGCTGTAAATAGAAGTGG No data
Right 1131237185 15:90706732-90706754 CCCAGATTTGAAGAAGGCATAGG No data
1131237172_1131237185 19 Left 1131237172 15:90706690-90706712 CCCATGGCCCCCAGGCTGTAAAT No data
Right 1131237185 15:90706732-90706754 CCCAGATTTGAAGAAGGCATAGG No data
1131237173_1131237185 18 Left 1131237173 15:90706691-90706713 CCATGGCCCCCAGGCTGTAAATA No data
Right 1131237185 15:90706732-90706754 CCCAGATTTGAAGAAGGCATAGG No data
1131237174_1131237185 12 Left 1131237174 15:90706697-90706719 CCCCCAGGCTGTAAATAGAAGTG No data
Right 1131237185 15:90706732-90706754 CCCAGATTTGAAGAAGGCATAGG No data
1131237178_1131237185 9 Left 1131237178 15:90706700-90706722 CCAGGCTGTAAATAGAAGTGGAG No data
Right 1131237185 15:90706732-90706754 CCCAGATTTGAAGAAGGCATAGG No data
1131237177_1131237185 10 Left 1131237177 15:90706699-90706721 CCCAGGCTGTAAATAGAAGTGGA No data
Right 1131237185 15:90706732-90706754 CCCAGATTTGAAGAAGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131237185 Original CRISPR CCCAGATTTGAAGAAGGCAT AGG Intergenic
No off target data available for this crispr