ID: 1131237938

View in Genome Browser
Species Human (GRCh38)
Location 15:90713267-90713289
Sequence GGCCCTGAAGAACACCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131237932_1131237938 5 Left 1131237932 15:90713239-90713261 CCCTTCTCTAGTGCCAGCCATTG No data
Right 1131237938 15:90713267-90713289 GGCCCTGAAGAACACCCTCATGG No data
1131237936_1131237938 -8 Left 1131237936 15:90713252-90713274 CCAGCCATTGTGGTAGGCCCTGA No data
Right 1131237938 15:90713267-90713289 GGCCCTGAAGAACACCCTCATGG No data
1131237933_1131237938 4 Left 1131237933 15:90713240-90713262 CCTTCTCTAGTGCCAGCCATTGT No data
Right 1131237938 15:90713267-90713289 GGCCCTGAAGAACACCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131237938 Original CRISPR GGCCCTGAAGAACACCCTCA TGG Intergenic
No off target data available for this crispr