ID: 1131239839

View in Genome Browser
Species Human (GRCh38)
Location 15:90729725-90729747
Sequence AAGCATATTCACAACATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131239836_1131239839 11 Left 1131239836 15:90729691-90729713 CCGTATGACAGTAATTCACCTTT 0: 1
1: 0
2: 2
3: 31
4: 1177
Right 1131239839 15:90729725-90729747 AAGCATATTCACAACATCCAAGG 0: 1
1: 0
2: 3
3: 22
4: 237
1131239837_1131239839 -7 Left 1131239837 15:90729709-90729731 CCTTTGTCATGTAACCAAGCATA 0: 1
1: 1
2: 5
3: 70
4: 270
Right 1131239839 15:90729725-90729747 AAGCATATTCACAACATCCAAGG 0: 1
1: 0
2: 3
3: 22
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131239839 Original CRISPR AAGCATATTCACAACATCCA AGG Intronic
901349661 1:8582809-8582831 CAGCATATTCTCACCATCAAAGG + Intronic
901366256 1:8751585-8751607 AAGCACATGCAGAACATGCATGG + Intronic
902130601 1:14257117-14257139 AAGGACATACACTACATCCAGGG - Intergenic
903301447 1:22381240-22381262 AAGAAAAGTCACAATATCCAAGG + Intergenic
904148885 1:28419898-28419920 AAGGATATACACAACATTCGTGG - Intronic
905851548 1:41278626-41278648 AAGTATATTTACAACCTCCTTGG + Intergenic
909297703 1:73971553-73971575 AGGCCTATTCTCAACCTCCAGGG - Intergenic
911707217 1:101027402-101027424 AAGCATATTCAACACATCCAAGG + Intergenic
911798894 1:102109360-102109382 AAGCAAAATCACATCTTCCATGG + Intergenic
916218653 1:162421069-162421091 TAACATATTCACAAAATCCAGGG + Intergenic
918727491 1:187944028-187944050 TAACATATTCACAAGTTCCAGGG - Intergenic
919070638 1:192751246-192751268 AAACATATACTCAAAATCCAAGG + Intergenic
919083881 1:192897559-192897581 AAGCATTTTCTCAACTTTCAAGG - Intergenic
919478729 1:198060824-198060846 AAGCATACTACCAACATCCCTGG - Intergenic
921839871 1:219817083-219817105 GAACATATTCACAGGATCCAGGG - Intronic
922501554 1:226100607-226100629 ATGCTTGTTAACAACATCCAAGG - Intergenic
923925387 1:238621235-238621257 CAGCATATTCACAGGTTCCAAGG - Intergenic
1063274772 10:4553324-4553346 AAGCAAATTCACATCTTGCAAGG + Intergenic
1065837798 10:29675041-29675063 GAACATATTCACAGCTTCCAGGG + Intronic
1066016271 10:31246996-31247018 AGGCATATTCACAATAGCAAAGG - Intergenic
1066598851 10:37082243-37082265 AAGCAGATTTAGAACATCCAGGG - Intergenic
1067340531 10:45398954-45398976 AAGCATATTCCCAACAGAAATGG + Intronic
1068986687 10:63114141-63114163 AAGAATTTTCACAACATACATGG - Intergenic
1069469499 10:68675184-68675206 AAGGATCTTCAAAACATTCAAGG + Intronic
1070687065 10:78493269-78493291 AAGCATTTTCTCTACATACATGG - Intergenic
1071556913 10:86611433-86611455 AAACATATTGACAATGTCCATGG + Intergenic
1072466648 10:95669585-95669607 AAGCAGATAGACATCATCCATGG - Intronic
1073270503 10:102258948-102258970 AAGAATATTTACATCATTCAAGG + Exonic
1075272393 10:121063708-121063730 AAGTATACTCACAATATGCAAGG + Intergenic
1075502748 10:122991794-122991816 ATGCACCTTCACAACATCCATGG + Exonic
1075622099 10:123935455-123935477 TAGCAGTTTCACATCATCCAAGG - Intronic
1077680186 11:4232845-4232867 AAACATATTGACAATGTCCAAGG - Intergenic
1077681300 11:4243061-4243083 AAACATATTGACAATGTCCAAGG + Intergenic
1077689596 11:4329422-4329444 AAACATATTGACAATGTCCAAGG - Intergenic
1077834338 11:5911251-5911273 AAGCATATTCAAAAAATAGAAGG - Intronic
1079641736 11:22814166-22814188 CAACATATTCACAGCTTCCAGGG + Intronic
1081120427 11:39258542-39258564 AAGAATAATCACAACATCTTTGG + Intergenic
1085438795 11:76538071-76538093 GAGCAAATTCACACCATCCTTGG + Intronic
1088132018 11:106504060-106504082 AAATCTATTCAGAACATCCAGGG + Intergenic
1088493596 11:110410696-110410718 GAGCATATTCACAAATTTCAAGG - Intergenic
1090624989 11:128599344-128599366 AACAATATTCACAATATTCATGG + Intergenic
1090731320 11:129575409-129575431 TAGCATATTCACAGATTCCAGGG + Intergenic
1093062502 12:14622059-14622081 AAGCATGTCCACCACTTCCATGG + Exonic
1095726130 12:45455168-45455190 AAGCAAATACACATCCTCCATGG - Intergenic
1096256474 12:50065014-50065036 GAGCAGACTCTCAACATCCAGGG + Intronic
1096704345 12:53409390-53409412 CAGCATATTTGCCACATCCAAGG + Exonic
1097919266 12:65054053-65054075 AAGCAAATTCACAAAATTCCAGG - Intronic
1098443571 12:70543347-70543369 AAGGATATTAACTACATTCAAGG - Intronic
1099126086 12:78759981-78760003 AAACATATTCACATGTTCCAGGG + Intergenic
1099698051 12:86045771-86045793 CAGCATATTCATAACATGCTTGG + Intronic
1100775838 12:97973496-97973518 AAGCAGATTCTCCACATCCTAGG - Intergenic
1101858651 12:108464687-108464709 TGGCATATTCAGAACAGCCAGGG + Intergenic
1102488551 12:113274717-113274739 AACCATACTCACTACCTCCACGG - Intronic
1102670396 12:114613805-114613827 CATTGTATTCACAACATCCAAGG - Intergenic
1104956409 12:132468558-132468580 AAGAACATTTACAATATCCATGG + Intergenic
1107098455 13:36561632-36561654 AAGCCCATTCATAACATTCAGGG + Intergenic
1107366452 13:39683525-39683547 ATGTATATGCACAACATTCAGGG - Intronic
1109160134 13:58962117-58962139 GTGCTTTTTCACAACATCCAAGG - Intergenic
1109562559 13:64071721-64071743 TAGCATATTCACATGTTCCAGGG + Intergenic
1110891033 13:80698858-80698880 AAGTATAGTCACAATATACAAGG - Intergenic
1111033896 13:82644654-82644676 AAATAATTTCACAACATCCATGG - Intergenic
1116074625 14:40095007-40095029 AAGCACATTCAATACATCAAAGG + Intergenic
1116248529 14:42452161-42452183 AAGTATATTCATAACATTAAAGG - Intergenic
1116291547 14:43049409-43049431 AAGCAAATTCTAAATATCCATGG + Intergenic
1117009733 14:51458365-51458387 TAGCATGTTCACAGCTTCCATGG + Intergenic
1118231006 14:63949871-63949893 AACCACACTCACATCATCCAGGG - Exonic
1118576316 14:67244808-67244830 AAACATATTCACAGGTTCCAGGG - Intronic
1120603583 14:86543365-86543387 AAGCATATTTAAAACAGCCAAGG - Intergenic
1121969622 14:98344319-98344341 CTGCATTTTCACAACATCCCTGG + Intergenic
1122064661 14:99164039-99164061 AAGCTTTTCCACATCATCCAGGG + Intergenic
1122929519 14:104926973-104926995 AAGCACACCCCCAACATCCAGGG + Intronic
1124194633 15:27610963-27610985 AATCTTTTTCACAACATCTATGG - Intergenic
1125776147 15:42215949-42215971 AACATTATTCACAACAGCCAAGG + Intronic
1126254033 15:46603788-46603810 AAGCAGCCTCACATCATCCAAGG + Intergenic
1126710398 15:51449081-51449103 ATGCAGATTGACATCATCCAGGG - Exonic
1127633522 15:60848251-60848273 TAGCATATTCACAGGTTCCAGGG - Intronic
1127853765 15:62938252-62938274 GAGCAAAGTCACAACATACATGG + Intergenic
1130196002 15:81780874-81780896 AAGAATATTTACAACACCCACGG + Intergenic
1131239839 15:90729725-90729747 AAGCATATTCACAACATCCAAGG + Intronic
1136570988 16:31096585-31096607 TATCATATTCACAAGTTCCAGGG - Intergenic
1137893033 16:52182164-52182186 TAACATATTCACAAGTTCCAGGG + Intergenic
1138634787 16:58329479-58329501 AAGGATATTCAGCACAACCATGG - Intronic
1138819654 16:60243658-60243680 AAGCATAGTCACAATATTAATGG + Intergenic
1141403038 16:83767421-83767443 AAGCAAAGTCACAACTTACATGG - Intronic
1143691231 17:8567940-8567962 AAGGATATTCCCAACCTCCTTGG + Intronic
1144767719 17:17741783-17741805 AAGCACACTCCCCACATCCAGGG + Intronic
1148428126 17:47618288-47618310 AATCATATGCAGAACATCCAAGG + Intronic
1149717005 17:58801282-58801304 AAGCATATTGACAGAATCAAAGG - Intronic
1150326119 17:64259407-64259429 AAGAATATTCACAACAGCATGGG + Intronic
1150517448 17:65828329-65828351 AATGATATGCACAACTTCCATGG + Intronic
1150664954 17:67125694-67125716 TAACATATTCACAGGATCCAGGG - Intronic
1153076517 18:1167645-1167667 TAACATATTCACAAATTCCAGGG - Intergenic
1154431274 18:14310332-14310354 AAGCAAATTAACTACTTCCAAGG - Intergenic
1155982352 18:32194574-32194596 ACACATATTCAAAACATCCCAGG + Intronic
1156946087 18:42833413-42833435 AAGACTATTCACAACAGCAATGG - Intronic
1158556551 18:58479827-58479849 CTGCATATTCCCAAGATCCAGGG + Intergenic
1158888763 18:61853827-61853849 TAACATATTCACAAGTTCCAAGG + Intronic
1159912383 18:74158378-74158400 AATCATATTCACCACTTCCTGGG - Exonic
1161219176 19:3110181-3110203 AAGCAGATGCGCATCATCCACGG + Exonic
1163921409 19:20293229-20293251 AGGCATATTCTCAAGATGCAGGG + Intergenic
1163970646 19:20790669-20790691 AGGCATATTCTCAAGATGCAGGG + Intronic
1164464946 19:28479746-28479768 ATGTAGATTCACCACATCCAGGG + Intergenic
1164926333 19:32132684-32132706 AAGCACATTCAAAGCTTCCAAGG + Intergenic
1165216046 19:34273567-34273589 GAGCTCATTCAAAACATCCAAGG - Intronic
926558467 2:14388197-14388219 TAGCATAGTCACAAGTTCCAGGG + Intergenic
926569341 2:14512276-14512298 GTGCATATTCACAAATTCCAAGG + Intergenic
927078956 2:19609113-19609135 AACCATACCCACAACCTCCAGGG + Intergenic
928879343 2:36079895-36079917 CAACAAATTCTCAACATCCAGGG + Intergenic
931173289 2:59827997-59828019 AAGCATATGCACAATGCCCATGG - Intergenic
931606026 2:64052964-64052986 AAGCCTATTAACAAAAGCCAAGG - Intergenic
931800247 2:65751071-65751093 TAACATATTCACAGCTTCCAGGG + Intergenic
933448789 2:82418902-82418924 TAGCATATTTACAAAACCCAGGG - Intergenic
935014662 2:99169437-99169459 AATCAAAATCACAATATCCAAGG + Exonic
936029714 2:109061679-109061701 TAGAAAATTCACAACATCCAAGG - Intergenic
937570985 2:123361077-123361099 TAGCATATTCACAGGTTCCAGGG + Intergenic
940468966 2:154068426-154068448 AACACTATTCACAACAGCCAGGG + Intronic
940480558 2:154225077-154225099 AAGGACATTCACAACACACATGG + Intronic
940815502 2:158293232-158293254 AAGCACATTCACAATATCTATGG + Intronic
942659538 2:178249726-178249748 CAGCATATTGATAACAACCAAGG - Intronic
943645555 2:190405788-190405810 AAGCATATTCACAGGCTCCTGGG - Intergenic
944630875 2:201622749-201622771 TAGTATATTCACAAGTTCCAGGG + Exonic
945983343 2:216334048-216334070 TAACATATTCACAAGTTCCATGG - Intronic
946991708 2:225338364-225338386 AAGTAAATTTACAACATCCCTGG + Intergenic
947074107 2:226323060-226323082 AAGCATATTCACAACCTAGATGG + Intergenic
947179784 2:227401733-227401755 AAGCATAGTCACTCAATCCAGGG - Intergenic
947406044 2:229778548-229778570 AAGTATATTCAAAACCTCCAGGG - Exonic
948705899 2:239792328-239792350 AAGCTCATCCCCAACATCCAAGG - Intronic
1171814004 20:29767336-29767358 CAGCATATTCACAACCATCAAGG - Intergenic
1174950841 20:55040309-55040331 CAGCCTATTCACAATATCCAAGG + Intergenic
1175040555 20:56046186-56046208 CAGCATATTCACAACTGCAAAGG + Intergenic
1175278228 20:57786366-57786388 TAGCATTCTCACAACATCCCTGG - Intergenic
1175677544 20:60959625-60959647 AAGCAAATTCACAGCATCATTGG + Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178205898 21:30464586-30464608 AGGCAAATTCATAAGATCCAGGG - Intergenic
1181096815 22:20510868-20510890 TAGCATATTCACAAGTTCTAGGG + Intronic
1181145296 22:20841657-20841679 TAACATATTCACAGCTTCCAGGG - Intronic
1182673794 22:32020624-32020646 AAACATAGTCTCACCATCCATGG + Intergenic
949100322 3:136438-136460 AAACCTATTCCCAACATCTATGG - Intergenic
950067549 3:10125076-10125098 ATCCATATTCACAGGATCCAGGG + Intronic
951242121 3:20298990-20299012 AACAATATTCACAAAAGCCAAGG - Intergenic
951753963 3:26068575-26068597 ATGCAAATTCCCAACACCCAGGG - Intergenic
955022610 3:55135547-55135569 TAGCATATTCACAGATTCCAGGG + Intergenic
955897652 3:63717713-63717735 AAACATGTTCACAAGTTCCAGGG + Intergenic
956930619 3:74038995-74039017 AAGCATCTTCACAAAATTCAAGG + Intergenic
957665884 3:83226012-83226034 AAGCATATGCTCTGCATCCAGGG - Intergenic
960839398 3:121940945-121940967 AAGCACATTCCTCACATCCAGGG + Exonic
962435710 3:135364861-135364883 AGACATATGCACATCATCCAGGG - Intergenic
963565986 3:146931709-146931731 AAATATATTCACAATATACATGG + Intergenic
963665605 3:148181482-148181504 TAACATATTCACAGCTTCCAGGG + Intergenic
964013782 3:151922091-151922113 TAGCATATTCATAGAATCCAAGG + Intergenic
964017991 3:151971451-151971473 AAGCATAGTCACAACCCTCAAGG - Intergenic
964702038 3:159578928-159578950 TAGCATATTCACAAGTTTCAGGG + Intronic
965661650 3:171048356-171048378 AAGCATAATTAGAACATGCAAGG + Intergenic
965694275 3:171390840-171390862 TAGCAGGTTCACAACATCCATGG - Intronic
966669853 3:182514934-182514956 TAGCATATTAACATCATCCGTGG + Intergenic
967323096 3:188213241-188213263 TAGCATTTGCACAGCATCCACGG + Intronic
971444827 4:26732074-26732096 AAGAATATTCGTAACATCCTTGG + Intronic
971828228 4:31655877-31655899 AAGGATTTTCAAAACATTCATGG + Intergenic
972030176 4:34445656-34445678 AAGCAAAGTTACAACATACACGG + Intergenic
972728261 4:41765746-41765768 AACCATATTCAGATCATCTAGGG + Intergenic
974210675 4:58770482-58770504 GAGCATATTCACAATAGCAAGGG - Intergenic
975904813 4:79196677-79196699 TAACATATTCACAAGTTCCATGG - Intergenic
978426147 4:108584593-108584615 AAACATATTCACAGGTTCCAGGG + Intergenic
978510420 4:109511813-109511835 AAGCATATTAATAAAATCCAGGG - Intronic
980277674 4:130676310-130676332 AAACATATTTACATCATACATGG - Intergenic
980447823 4:132934248-132934270 AAGCATATTAACAGCTTCAATGG - Intergenic
981124643 4:141091942-141091964 ACACATATACACAATATCCAAGG + Intronic
981333826 4:143544631-143544653 AAAGATATTCACAAAATCCTGGG - Intronic
982010425 4:151100464-151100486 AAGCATCTTCTTAAAATCCAGGG + Exonic
983112637 4:163772099-163772121 CTGCATATTCACAACATCTCTGG + Intronic
983914270 4:173274839-173274861 AAGCATATGTTCAACATCCCCGG - Intronic
984246325 4:177279006-177279028 AAGAATATGGTCAACATCCATGG - Intergenic
986420027 5:7570875-7570897 AAGAATATTGACAACAGCCAAGG - Intronic
986814304 5:11391512-11391534 AAGCAAATTCATTACATCCCAGG - Intronic
987883438 5:23780588-23780610 AAGCACATTCACAGCTTCCTTGG + Intergenic
988034345 5:25806726-25806748 AAGCAAATTGAAAACATTCAGGG - Intergenic
989755866 5:44953206-44953228 AAGCATATGCATAACATCAATGG + Intergenic
990479596 5:56196756-56196778 CAGCATTTTAACAACATCCTAGG - Intronic
992752491 5:79874209-79874231 AAGCATATTCCCTAAAGCCAAGG + Intergenic
993142979 5:84057094-84057116 AAACATATTCAGAATCTCCAAGG - Intronic
993854632 5:93058224-93058246 ATCCATTTTAACAACATCCAGGG - Intergenic
994978720 5:106844552-106844574 AAGCATAAGCAGAAAATCCATGG + Intergenic
996166018 5:120225057-120225079 AAGCATATTCATAACCGCAATGG - Intergenic
996244121 5:121238590-121238612 AAGCATATCCACAGCTTCCTGGG - Intergenic
996929198 5:128866110-128866132 TAGCATATTCACAGATTCCAAGG - Intronic
996996488 5:129702553-129702575 AAGCATATTCACAAAAATCCTGG + Intronic
997686523 5:135792121-135792143 AATATTATTCATAACATCCAAGG + Intergenic
998330204 5:141319176-141319198 AAGCAGATTGACAACATGAAAGG - Exonic
998738685 5:145174133-145174155 AAAAATATTCACAACATAAAGGG - Intergenic
998921138 5:147069635-147069657 AACCATGTTCAAAAAATCCATGG - Intronic
999717263 5:154371334-154371356 AGCCACATTCACAACAACCAGGG + Intronic
1000573183 5:162940588-162940610 AAGCCTATTAAAAACCTCCAGGG + Intergenic
1001633254 5:173192218-173192240 GGGCATATTCACAAGTTCCAGGG + Intergenic
1005993332 6:30916949-30916971 CAGAACACTCACAACATCCATGG - Exonic
1011301577 6:85879765-85879787 AAACATATTCACAAGTTCCCAGG - Intergenic
1012676561 6:102120526-102120548 AAGCATATTCATCACCTCCAAGG - Intergenic
1013261110 6:108443418-108443440 CATCATAGTCACAACATTCAAGG + Intronic
1014885320 6:126773522-126773544 AAGTATTTTCACAAACTCCAAGG + Intergenic
1016026531 6:139292976-139292998 AAACATATTCACAGGTTCCAGGG - Intergenic
1018110473 6:160532355-160532377 ATGCATATTCAGATCATCTAAGG - Intronic
1018124196 6:160666048-160666070 ATGTATATTCAGATCATCCAAGG - Intergenic
1018511442 6:164528552-164528574 AAACATATTCACAAGTCCCAAGG + Intergenic
1019009666 6:168833952-168833974 AAGCATATTCCCAGCATCCCTGG + Intergenic
1019655101 7:2188943-2188965 AAAAATATTCAAAACATACAAGG + Intronic
1019765039 7:2843917-2843939 AAGCAGATGCGCATCATCCACGG - Exonic
1022563210 7:31371523-31371545 AAAAATATAGACAACATCCATGG + Intergenic
1023461370 7:40400981-40401003 AAGCATTTTAGCAACTTCCAAGG - Intronic
1024449552 7:49523546-49523568 AAGCATATTCATAATTTCAAGGG + Intergenic
1025992437 7:66506034-66506056 AAGCAGATGCGCATCATCCATGG - Intergenic
1026661171 7:72303955-72303977 AATCATATTCACAAAATCTTTGG + Intronic
1027649177 7:80844109-80844131 GAGCATATTCTCATCCTCCATGG - Intronic
1028332170 7:89608384-89608406 AAGCATATTAACAAATTCCAGGG - Intergenic
1028456518 7:91043987-91044009 AAGCATATTCACTTTATCCGAGG - Intronic
1028941211 7:96523966-96523988 AAGCATATTGTGAACGTCCAAGG - Intronic
1030918751 7:115352515-115352537 AGGCATATTCACAGGTTCCAGGG - Intergenic
1034646532 7:152652689-152652711 AAGCACATTCAGAAGATCCTGGG - Intronic
1037689010 8:21167278-21167300 AGGCATGTTCCCAAGATCCAGGG - Intergenic
1037798245 8:22014944-22014966 AGGCATACTCACATCATCAAGGG + Intergenic
1038789400 8:30655303-30655325 AAGCAATTTCACTACAACCAGGG + Intronic
1040641593 8:49340733-49340755 ATTTATATTCACAATATCCATGG - Intergenic
1041186760 8:55308809-55308831 TAGCATATTCACACGTTCCAGGG - Intronic
1042438721 8:68799451-68799473 GAGCATATTCATACCAGCCAAGG + Intronic
1043386678 8:79755838-79755860 AAGCCCATTCACAACATTCAGGG + Intergenic
1045840015 8:106568828-106568850 AAGCATAAACACACCGTCCAGGG + Intronic
1046113008 8:109749451-109749473 AAGCATATTCATGAGATTCAGGG + Intergenic
1046414794 8:113898713-113898735 AAGCATATTCACAGGTTTCAGGG + Intergenic
1046886659 8:119375054-119375076 TAGCATATTCACAGGTTCCAGGG - Intergenic
1047683321 8:127277375-127277397 AACCTTATGCACAATATCCAAGG + Intergenic
1048512335 8:135074164-135074186 AAGTACATTCACAACAGCCCAGG + Intergenic
1048631688 8:136249634-136249656 AAATATATTCACAATTTCCAGGG - Intergenic
1049058185 8:140255420-140255442 AAGCATCTGAACACCATCCAAGG - Intronic
1049599287 8:143499596-143499618 CAGCATTTTCACAGCATTCAGGG + Intronic
1049861087 8:144900044-144900066 AAGCATGTTTTCAACATACATGG + Intronic
1050673374 9:8023770-8023792 AAGTATATCCACAACATCAGAGG - Intergenic
1050778556 9:9300372-9300394 CAGCATATTCAAAGCTTCCAAGG - Intronic
1050881065 9:10701276-10701298 AAACATATTTACAAAATCAATGG + Intergenic
1052036551 9:23687790-23687812 AAGCATACTTATAATATCCAGGG + Intergenic
1052467758 9:28851535-28851557 TAACATATTCACAGAATCCAGGG + Intergenic
1054365581 9:64335974-64335996 GAACATATTCAATACATCCAAGG - Intergenic
1055510865 9:76994467-76994489 AAGCTTATTCTAAACATTCAGGG - Intergenic
1060609777 9:124952912-124952934 AATCATATCCACAACTGCCAAGG - Exonic
1203790117 EBV:146849-146871 CAGCAAATTCACATCTTCCATGG - Intergenic
1187008469 X:15255137-15255159 AAGAATATTCACAACAGCATTGG + Intronic
1188046750 X:25434167-25434189 AAGCATAGTTCCTACATCCAAGG + Intergenic
1189412154 X:40781955-40781977 AAGCAAAGTCACATCTTCCATGG - Intergenic
1189820198 X:44862807-44862829 AAGCATATTCATCACATGAAAGG + Intergenic
1195347526 X:103965127-103965149 AAGCATATTCACAAAAGCCAAGG + Intronic
1195359916 X:104073714-104073736 AAGCATATTCACAAAAGCCAAGG - Intergenic
1196677077 X:118430996-118431018 AAACATCTTCACATCAACCATGG - Intronic
1196770742 X:119291021-119291043 TAACATATTCACAGCTTCCAGGG - Intergenic
1197011386 X:121569067-121569089 TAACATATTCACCACTTCCAAGG - Intergenic
1199927864 X:152488026-152488048 GAGCATTTTCTCAATATCCAAGG + Intergenic
1200084512 X:153597115-153597137 AAACAAATTCACAACCACCAGGG + Intronic
1200320792 X:155186992-155187014 AAGCATATTCACAGATTCCATGG - Intergenic
1200979390 Y:9248143-9248165 AAGCATACTCAGACCATGCATGG - Intergenic
1202111628 Y:21427379-21427401 AAGCATACTCAGACCATGCATGG + Intergenic
1202116816 Y:21476758-21476780 AAGCATACTCAGACCATGCATGG - Intergenic
1202383576 Y:24300612-24300634 TAACATATTCACAGCTTCCAGGG + Intergenic
1202487207 Y:25369508-25369530 TAACATATTCACAGCTTCCAGGG - Intergenic