ID: 1131245129

View in Genome Browser
Species Human (GRCh38)
Location 15:90784998-90785020
Sequence GCTGCTCTTGCTTACCATGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 529}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131245126_1131245129 9 Left 1131245126 15:90784966-90784988 CCATGGCTGACACGTTACAGAGA 0: 1
1: 0
2: 2
3: 7
4: 90
Right 1131245129 15:90784998-90785020 GCTGCTCTTGCTTACCATGCTGG 0: 1
1: 0
2: 0
3: 16
4: 529
1131245124_1131245129 27 Left 1131245124 15:90784948-90784970 CCAGGCGAGAATGTGACACCATG 0: 1
1: 0
2: 0
3: 39
4: 314
Right 1131245129 15:90784998-90785020 GCTGCTCTTGCTTACCATGCTGG 0: 1
1: 0
2: 0
3: 16
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131245129 Original CRISPR GCTGCTCTTGCTTACCATGC TGG Exonic
900273510 1:1807634-1807656 GGTGCTGTTGTTTACCAAGCAGG - Intronic
900847851 1:5117936-5117958 CCTGCTCTTGTTTACACTGCCGG + Intergenic
902664683 1:17929274-17929296 GCTGCTTATGCCTACCACGCAGG + Intergenic
904996123 1:34632870-34632892 CCTGCTCTTGTTTACACTGCTGG - Intergenic
905060047 1:35132466-35132488 CCTGCTCTTGTTTACACTGCCGG - Intergenic
905812807 1:40925421-40925443 GCTTCTCCTCCTTACCCTGCTGG - Intergenic
906081283 1:43090270-43090292 CCTGCTCTTGTTTACACTGCTGG + Intergenic
906443478 1:45872508-45872530 TTTGCTCTTGCTTCCCAGGCTGG + Intronic
906744151 1:48209894-48209916 CCTGCTCTTGTTTACACTGCTGG - Intergenic
907292998 1:53429095-53429117 CCTGCTCTTGTTTACACTGCCGG + Intergenic
907503209 1:54898781-54898803 CCTGCTCTTGTTTACAATGCCGG - Intergenic
907521627 1:55027387-55027409 CCTGCTCTTGTTTACACTGCCGG + Intergenic
908461342 1:64350877-64350899 CCTGCTCTTGTTTACACTGCCGG - Intergenic
908591751 1:65644121-65644143 CCTGCTCTTGTTTACACTGCCGG - Intergenic
908852769 1:68391059-68391081 CCTGCTCTTGTTTACACTGCCGG + Intergenic
909222381 1:72981363-72981385 CCTGCTCTTGTTTACACTGCTGG - Intergenic
909223292 1:72988732-72988754 CCTGCTCTTGTTTACACTGCCGG - Intergenic
909730000 1:78878466-78878488 CCTGCTCTTGTTTACACTGCCGG + Intergenic
909792614 1:79697253-79697275 CCTGCTCTTGTTTACACTGCCGG - Intergenic
909910330 1:81250252-81250274 CCTGCTCTTGTTTACACTGCCGG + Intergenic
909978079 1:82068436-82068458 CCTGCTCTTGTTTACACTGCCGG - Intergenic
910421956 1:87075197-87075219 TTTGCTCTTGCTTCCCAGGCTGG + Intronic
911510228 1:98801983-98802005 CCTGCTCTTGTTTACACTGCTGG - Intergenic
912939339 1:114031196-114031218 CCTGCTCTTGTTTACATTGCCGG + Intergenic
913486478 1:119336283-119336305 GCTGCTCCTGTTCACCATGCAGG - Intergenic
914762900 1:150613229-150613251 GTTGCTCTTGTTTCCCAGGCTGG - Intronic
914786702 1:150839654-150839676 GCTTCTCTTTCTTTCCATGCAGG - Exonic
914849034 1:151300575-151300597 TCTGCTCTTGTTTCCCAGGCTGG - Intronic
918248860 1:182684337-182684359 GCTGCTCTTTCTTACCTGCCTGG + Intronic
918320396 1:183358751-183358773 GCTGCACATTCTTAGCATGCTGG - Intronic
918347480 1:183618437-183618459 CCTGCTCTTGTTTACACTGCCGG + Intergenic
918567300 1:185949212-185949234 CCTGCTCTTGTTTACACTGCCGG - Intronic
919476834 1:198040082-198040104 CCTGCTCTTGTTTACACTGCCGG + Intergenic
919600922 1:199621346-199621368 GCTGCCCTTGCTTACCACTCTGG + Intergenic
920829679 1:209453050-209453072 CCTGCTCTTGTTTACACTGCCGG + Intergenic
921256254 1:213342407-213342429 ACTGCTGTTGCCTACCATGCTGG - Intergenic
921409365 1:214818695-214818717 TCTGCTCTTGTTTCCCAGGCTGG + Intergenic
921732614 1:218594719-218594741 CCTGCTCTTGTTTACACTGCCGG - Intergenic
922043842 1:221924314-221924336 GCTGCTCTTTCTTATCCTTCTGG - Intergenic
922048762 1:221970689-221970711 CCTGCTCTTGTTTACACTGCCGG + Intergenic
922049170 1:221974011-221974033 CCTGCTCTTGTTTACACTGCCGG - Intergenic
922153702 1:223025325-223025347 TCTGCTCTTGTTTACACTGCCGG - Intergenic
922877435 1:228950997-228951019 CCTGCTCTTGTTTACACTGCCGG + Intergenic
922906764 1:229179226-229179248 CCTGCTCTTGTTTACACTGCCGG + Intergenic
923213742 1:231830565-231830587 CCTGCTCTTGTTTACGCTGCCGG - Intronic
923245131 1:232122990-232123012 CCTGCTCTTGTTTACACTGCCGG + Intergenic
923256968 1:232230543-232230565 CCTGCTCTTGTTTACACTGCCGG - Intergenic
923408265 1:233684363-233684385 CCTGCTCTTGTTTACACTGCCGG - Intergenic
923450633 1:234113831-234113853 TCTGCTCTTGCTGCCCAGGCTGG - Intronic
923770388 1:236933224-236933246 CCTGCTCTTGTTTACACTGCCGG - Intergenic
923963159 1:239106159-239106181 CCTGCTCTTGTTTACACTGCTGG + Intergenic
924007767 1:239631011-239631033 TCTGCTATTGCTTGCCATGTTGG - Intronic
924895745 1:248336597-248336619 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1062833363 10:620787-620809 GCTCCACTTGCTTACAAAGCAGG - Intronic
1063363563 10:5476115-5476137 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1063509227 10:6630512-6630534 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1064886630 10:20120084-20120106 CCTGCTCTTGTTTACACTGCCGG - Intronic
1066429456 10:35337280-35337302 GCTGCTCTTGCTTGCCCAGCCGG + Intronic
1068057986 10:52034690-52034712 CCTGCTCTTGTTTACACTGCCGG - Intronic
1068178616 10:53493655-53493677 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1068231343 10:54171552-54171574 CCTGCTCTTGTTTACACTGCCGG + Intronic
1068591973 10:58861927-58861949 TCTGCTCTTGTTTACACTGCTGG - Intergenic
1069617939 10:69818095-69818117 GCTGCCCATGCCTACCCTGCTGG + Intronic
1069786780 10:70993331-70993353 CCTAGTCTTGCTCACCATGCCGG - Intergenic
1071429290 10:85593726-85593748 CCATCTCTTTCTTACCATGCAGG + Intergenic
1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG + Intergenic
1071897377 10:90081952-90081974 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1071916573 10:90299788-90299810 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1071961496 10:90812304-90812326 CCTGCTCTTGTTTACACTGCCGG + Intronic
1072010902 10:91302173-91302195 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1072448437 10:95519567-95519589 TCTGCTCTTGCTTAAAATTCAGG - Intronic
1072580462 10:96735680-96735702 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1074019439 10:109567331-109567353 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1075249065 10:120849626-120849648 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1076311315 10:129509871-129509893 GCTGCTCTTCCTTTTCATTCTGG - Intronic
1077612559 11:3652730-3652752 CCTGCTCTTGTTTACACTGCCGG + Intronic
1077678695 11:4220218-4220240 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1077688100 11:4316621-4316643 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1077766021 11:5161189-5161211 CCTGCTCTTGTTTACACTGCCGG - Intronic
1077810576 11:5632474-5632496 GCTGCTTTTTCCTCCCATGCTGG - Exonic
1078045777 11:7913079-7913101 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1078660573 11:13282415-13282437 GCTGCTCTTCGTTGCCTTGCCGG + Intronic
1078881680 11:15456359-15456381 TTTGCTCTTGCTGCCCATGCTGG + Intergenic
1078921556 11:15835667-15835689 GCTCCTCTTTCTTACAATTCTGG + Intergenic
1079217675 11:18528418-18528440 TTTGCTCTTGCTTCCCAGGCTGG + Intergenic
1080928539 11:36783762-36783784 GCTCCTGTTCCTTCCCATGCCGG - Intergenic
1084355917 11:68638490-68638512 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1084371654 11:68749332-68749354 GCTGCTCTGGCTTATGATACAGG + Intronic
1084612913 11:70215151-70215173 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1084821222 11:71692295-71692317 GATTCTCTTGCTTTCCCTGCAGG - Intergenic
1085934649 11:81126576-81126598 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1085988473 11:81811765-81811787 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1086125199 11:83342873-83342895 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1086135802 11:83443017-83443039 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1087099456 11:94350511-94350533 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1087100033 11:94354635-94354657 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1087315043 11:96592719-96592741 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1087741405 11:101891662-101891684 GGTGCTCTTGCCTAATATGCTGG - Intronic
1088371094 11:109089365-109089387 ACTGTTCTTGCTGACCCTGCTGG - Intergenic
1089349357 11:117813392-117813414 CCTGCTCTTGTTTACACTGCCGG + Intronic
1089470691 11:118717924-118717946 TCTGCTCTTGTTTACACTGCCGG - Intergenic
1089866604 11:121638283-121638305 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1089988042 11:122831909-122831931 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1090107174 11:123866195-123866217 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1090526402 11:127543443-127543465 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1090850228 11:130565309-130565331 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1090926561 11:131255411-131255433 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1091035206 11:132226882-132226904 GCTGCTGGTGTATACCATGCTGG + Intronic
1092626391 12:10333910-10333932 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1092723370 12:11463099-11463121 CCTGCTCTTGTTTACACTGCCGG - Intronic
1092738961 12:11610645-11610667 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1092924417 12:13260506-13260528 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1093584170 12:20817973-20817995 CCTGCTCTTGTTTACACTGCTGG - Intronic
1094264435 12:28539885-28539907 GCTGCTCTTCCTCATCATTCAGG - Intronic
1094401153 12:30061540-30061562 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1096632189 12:52935047-52935069 TTTGCTCTTGTTTCCCATGCTGG - Intronic
1096906806 12:54943768-54943790 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1097541720 12:60952133-60952155 CCTGCTCTTGTTTACATTGCCGG - Intergenic
1098173300 12:67767733-67767755 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1098629421 12:72708143-72708165 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1098898519 12:76089105-76089127 TTTGCTCTTGCTGACCAGGCTGG + Intergenic
1099131756 12:78841535-78841557 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1099189087 12:79544670-79544692 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1099382817 12:81976091-81976113 TCTGCTCTTGTTTACACTGCCGG - Intergenic
1099517108 12:83610537-83610559 CCTGCCCTTCCTTACCATGTGGG - Intergenic
1099950318 12:89294550-89294572 GTTGCTCTTGCTGCCCAGGCTGG - Intergenic
1100561719 12:95753954-95753976 CCTGCTCTTGTTTACACTGCCGG + Intronic
1100940777 12:99720827-99720849 CCTGCTCTTGTTTACACTGCCGG + Intronic
1101251425 12:102939651-102939673 CCTGCTCTTCTTAACCATGCAGG + Intronic
1103332545 12:120164268-120164290 GCTGCCCCTGCTTACGATGTGGG - Intronic
1103831501 12:123783298-123783320 CCAGGTCATGCTTACCATGCTGG + Intronic
1104753817 12:131256463-131256485 GGTCCTCTTGCTTTCCATTCTGG + Intergenic
1105374799 13:19834004-19834026 GTTGCTCTTGCTGCCCAGGCTGG + Intronic
1106933425 13:34692058-34692080 GCTGCTCTAACTTAACATTCAGG + Intergenic
1107219889 13:37969890-37969912 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1107611172 13:42114500-42114522 TCTGCTCTCGCTGAGCATGCAGG + Intronic
1108203104 13:48061380-48061402 CCTGCTCTTGATTACACTGCCGG + Intronic
1109353366 13:61210378-61210400 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1109499714 13:63218214-63218236 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1109716368 13:66227297-66227319 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1110352560 13:74526192-74526214 TCTGCTCTTGTTTATCTTGCTGG - Intergenic
1110978912 13:81871530-81871552 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1111125672 13:83909212-83909234 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1111302411 13:86363200-86363222 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1111458477 13:88513752-88513774 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1111630797 13:90844204-90844226 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1111631338 13:90849504-90849526 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1112237228 13:97647303-97647325 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1112888913 13:104208479-104208501 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1114164705 14:20209030-20209052 TTTGCTCTTGCTGCCCATGCTGG - Intergenic
1115569386 14:34652574-34652596 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1115601149 14:34956970-34956992 TTTGCTCTTGCTTTCCAGGCTGG - Intergenic
1115905178 14:38195573-38195595 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1116534414 14:46013337-46013359 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1116573816 14:46548704-46548726 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1116701994 14:48256085-48256107 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1116702933 14:48263283-48263305 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1117801538 14:59448875-59448897 CCTGCTCTTGTTTACACTGCCGG + Intronic
1118152493 14:63204693-63204715 TGTCCTGTTGCTTACCATGCTGG - Exonic
1119022777 14:71129095-71129117 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1119317566 14:73708283-73708305 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1120250989 14:82061794-82061816 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1120437684 14:84501131-84501153 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1120539111 14:85733322-85733344 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1120618604 14:86736148-86736170 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1120736425 14:88057950-88057972 GCTGCTCTTTCTGTCCAAGCAGG + Intergenic
1121282328 14:92708119-92708141 TCTGCTCTTGCTGCCCAGGCTGG - Intronic
1122380887 14:101306154-101306176 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1123721315 15:23064161-23064183 GCAGATCTTGCCTACCATGCTGG + Intergenic
1125046049 15:35242899-35242921 CCTGCTCTTGTTTACACTGCCGG + Intronic
1125131153 15:36286554-36286576 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1125192290 15:37007493-37007515 GCTGCTCTTTGTTCACATGCCGG - Intronic
1126605607 15:50472878-50472900 TCTGCTCTTGCTGCCCAGGCTGG - Intronic
1126844228 15:52744281-52744303 TCTGCTCTTGTTTACACTGCCGG + Intergenic
1126900268 15:53307720-53307742 GATGGTCTTGCTGGCCATGCTGG - Intergenic
1126912052 15:53427760-53427782 CCTGCTCTTGTTTACCCTGCTGG - Intergenic
1130031371 15:80317592-80317614 TCTGCTCCTGCTTCCCAAGCTGG - Intergenic
1130304995 15:82707512-82707534 CCTGCTCTTGTTTACACTGCCGG + Intronic
1130781480 15:87044606-87044628 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1130855473 15:87836068-87836090 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1131245129 15:90784998-90785020 GCTGCTCTTGCTTACCATGCTGG + Exonic
1131684554 15:94755563-94755585 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1131685123 15:94759469-94759491 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1131882153 15:96872790-96872812 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1132463081 16:64983-65005 GCTGCTCGTGCTGTCCCTGCGGG + Exonic
1133765351 16:8833946-8833968 CCTGCTCTTGTTTACACTGCCGG - Intronic
1133939198 16:10294312-10294334 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG + Intergenic
1134341816 16:13353492-13353514 CCTGCTCTTGTTTACACTGCAGG - Intergenic
1137549861 16:49430063-49430085 GATGCACTTCCCTACCATGCTGG + Intergenic
1138110060 16:54316645-54316667 GCCGCTCTAGCTCACCATCCAGG + Intergenic
1138805315 16:60083624-60083646 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1139225551 16:65230739-65230761 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1139230222 16:65276171-65276193 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1139942683 16:70617394-70617416 CCTGCTCTTGTTTACACTGCCGG - Intronic
1140588986 16:76328673-76328695 TTTGCTCTTGTTTCCCATGCTGG + Intronic
1141864831 16:86742944-86742966 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1142376588 16:89709880-89709902 GCTGCTCTCGCTGACCCTTCTGG - Exonic
1144104941 17:11976015-11976037 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1146652111 17:34613392-34613414 GCTGCTCCTGCTTAGCTGGCTGG + Intronic
1147248310 17:39137056-39137078 GCTGTTTTTGTTTGCCATGCTGG - Intronic
1148583091 17:48757070-48757092 TCTGCTCCTGCTTATCATGCTGG + Intergenic
1150075341 17:62187390-62187412 TTTGCTCTTGCTGACCAGGCTGG + Intergenic
1150241349 17:63636076-63636098 GCTCCTCTGGCTTTCCTTGCTGG - Intronic
1150582753 17:66490371-66490393 TTTGCTCTTGCTACCCATGCTGG + Intronic
1151416923 17:73972632-73972654 GCTGCTCTACCTTGCCATCCAGG + Intergenic
1151622862 17:75257368-75257390 CCTGCTCTTGTTTACACTGCTGG + Intronic
1151839386 17:76606878-76606900 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1154098256 18:11441344-11441366 GCTGTTTTTTCTCACCATGCTGG + Intergenic
1154306008 18:13231356-13231378 GCTGCTCTTGGTGAGCATGTCGG + Intronic
1155941995 18:31809152-31809174 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1156251532 18:35357032-35357054 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1156958594 18:42995895-42995917 TCTGCTCTTGTTTACACTGCTGG + Intronic
1157521098 18:48346110-48346132 GCTTCTCTTCCTCACCATGTTGG + Intronic
1158106748 18:53894210-53894232 GCTTCTCTTGTTTAAAATGCAGG - Intergenic
1161246907 19:3257988-3258010 TTTGCTCTTGTTTTCCATGCTGG + Intronic
1161726509 19:5932437-5932459 GCTGCTGTTTCTTACCAGTCTGG + Exonic
1162473346 19:10885557-10885579 GATGCTCTTGTTAACCATCCCGG + Intronic
1162598151 19:11645262-11645284 TCTGCTCTTGCTGCCCAGGCTGG - Intergenic
1164459034 19:28432103-28432125 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1165494916 19:36146873-36146895 GCTGCTCTTGTTGCCCAGGCTGG + Intronic
1166826795 19:45614872-45614894 GATGCTCCTGCTTACGCTGCGGG - Intronic
1166926721 19:46274088-46274110 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1167046245 19:47050760-47050782 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1168211670 19:54895191-54895213 CCTGCTCTTGTTTACACTGCTGG - Intergenic
925227820 2:2200850-2200872 GGCGCATTTGCTTACCATGCTGG - Intronic
926413954 2:12631295-12631317 CCTGCTCTTGTTTACAGTGCTGG + Intergenic
926463691 2:13164700-13164722 CCTGCTCTTGTTTACACTGCCGG - Intergenic
926673232 2:15594874-15594896 GCTGATATTGCCTACCTTGCAGG - Intronic
928241578 2:29591401-29591423 GCTTCCCTTGTTTACCATCCTGG - Intronic
928779339 2:34801889-34801911 CCTGCTCTTGTTTACTCTGCCGG - Intergenic
928827262 2:35437805-35437827 CCTGCTCTTGTTTACATTGCCGG - Intergenic
928857549 2:35817874-35817896 CCTGCTCTTGTTTACACTGCCGG + Intergenic
928928931 2:36603828-36603850 CCTGCTCTTGTTTACACTGCCGG + Intronic
929792701 2:45035366-45035388 CCTGCTCTTGTTTACACTGCCGG - Intergenic
930244207 2:48966862-48966884 GCTGCTCTAACTTACCATCCAGG - Intronic
930955458 2:57197747-57197769 CCTGCTCTTGTTTACACTGCCGG + Intergenic
931026026 2:58114340-58114362 CCTGCTCTTGTTTACACTGCTGG - Intronic
931042982 2:58318493-58318515 CCTGCTCTTGTTTACACTGCCGG + Intergenic
931608524 2:64075647-64075669 CCTGCTCTTGTTTACACTGCCGG - Intergenic
931761751 2:65423801-65423823 TCTGCTCTTGTTGACCAGGCTGG + Intronic
931850777 2:66248718-66248740 CCTGCTCTTGTTTACACTGCTGG + Intergenic
931948640 2:67336608-67336630 CCTGCTCTTGTTTACATTGCCGG + Intergenic
932159003 2:69443893-69443915 CCTGCTCTTGTTTACAGTGCCGG - Intergenic
932296224 2:70625508-70625530 CCTGCTCTTGTTTACACTGCCGG + Intronic
932358618 2:71087288-71087310 CCTGCTCTTGTTTACACTGCTGG - Intergenic
932366861 2:71158689-71158711 CCTGCTCTTGTTTACACTGCTGG - Intergenic
932853840 2:75214660-75214682 CCTGCTCTTGTTTACACTGCCGG - Intergenic
932973548 2:76574556-76574578 CCTGCTCTTGTTTACACTGCCGG - Intergenic
933013457 2:77093162-77093184 CCTGCTCTTGTTTACACTGCCGG + Intronic
933079638 2:77969904-77969926 CCTGCTCTTGTTTACACTGCCGG + Intergenic
933164083 2:79056170-79056192 CCTGCTCTTGTTTACACTGCCGG + Intergenic
933179352 2:79212215-79212237 CCTGCTCTTGTTTACACTGCCGG - Intronic
933329320 2:80876712-80876734 CCTGCTCTTGTTTACACTGCCGG - Intergenic
933552043 2:83789839-83789861 CCTGCTCTTGTTTACACTGCCGG - Intergenic
935125978 2:100223300-100223322 CCTGTTCCTGCTTACCATGGAGG + Intergenic
936883689 2:117283529-117283551 CCTGCTCTTGTTTACACTGCCGG + Intergenic
937669089 2:124519481-124519503 GCTCCTTTTGCTCATCATGCTGG - Intronic
939959602 2:148554653-148554675 GCTGCTCTTTCTCCCCAGGCAGG + Intergenic
940426332 2:153535435-153535457 CCTGCTCTTGTTTACACTGCCGG - Intergenic
940508369 2:154583828-154583850 CCTGCTCTTGTTTACACTGCCGG - Intergenic
940675454 2:156720977-156720999 CCTGCTCTTGTTTACACTGCCGG - Intergenic
941340759 2:164300633-164300655 CCTGCTCTTGTTTACACTGCCGG + Intergenic
941675213 2:168336965-168336987 GCTGCACTTCCTGGCCATGCAGG - Intergenic
942729897 2:179052467-179052489 TCTGCTCTTGTTTACACTGCTGG - Intergenic
943450550 2:188038225-188038247 CCTGCTCTTGTTTACACTGCCGG + Intergenic
944875751 2:203962833-203962855 CCTGCTCTTGTTTACACTGCCGG - Intergenic
946780504 2:223189603-223189625 CCTGCTCTTGTTTACACTGCCGG - Intronic
948391058 2:237611743-237611765 CCTGCTCTTGTTTACACTGCCGG + Intergenic
948632486 2:239310956-239310978 GCTGCTCTTGCTTAGTATTAGGG - Intronic
1171249560 20:23637817-23637839 GCTGCTCCTGCTGGCCATCCTGG - Exonic
1171386340 20:24771722-24771744 GTTGCTCCTGCTCACCCTGCCGG - Intergenic
1171397103 20:24842470-24842492 TCTGCTCCTCCTTCCCATGCAGG + Intergenic
1173119232 20:40273807-40273829 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1173413663 20:42837456-42837478 GGTGCTCTTGGTCACCATGGTGG - Intronic
1177103082 21:16918996-16919018 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1178001570 21:28165995-28166017 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1178259403 21:31085006-31085028 GCTGCTTTTCCTTCTCATGCAGG - Intergenic
1179649953 21:42801780-42801802 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1180617179 22:17136018-17136040 TTTGCTCTTGTTTACCAAGCTGG - Intergenic
1180617229 22:17136337-17136359 TTTGCTCTTGTTTACCAAGCTGG - Intergenic
1181939495 22:26464303-26464325 GCTGCTCTTGGGCTCCATGCTGG + Exonic
1182522808 22:30893726-30893748 GCTGGTCCTGCTTACCTTCCGGG - Exonic
1183407224 22:37636277-37636299 GCTCCTCTTGCCTGCCTTGCTGG - Intronic
949161725 3:891583-891605 CCTGCTCTTGTTTACACTGCCGG - Intergenic
949827805 3:8181804-8181826 CCTGCTCTTGTTTACACTGCCGG + Intergenic
950507449 3:13403998-13404020 GCTGCCCCTGATTCCCATGCAGG - Intronic
950644148 3:14367244-14367266 TTTGCTCTTGCTTCCCCTGCGGG - Intergenic
950926860 3:16749111-16749133 CCTGCTCTTGTTTACACTGCCGG + Intergenic
951315923 3:21189900-21189922 CCTGCTCTTGTTTACACTGCCGG - Intergenic
952297443 3:32073751-32073773 CCTGCTCTTGTTTACACTGCCGG + Intronic
952895692 3:38077221-38077243 CCTGCTCTTGTTTACACTGCCGG - Intronic
953076768 3:39578721-39578743 CCTGCTCTTGTTTACACTGCCGG - Intergenic
953177557 3:40565768-40565790 CCTGCTCTTGTTTACACTGCCGG + Intronic
953784330 3:45899134-45899156 TTTGCTCTTGCTTCCCAGGCTGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954968908 3:54635410-54635432 CCTGCTCTTGTTTACACTGCCGG - Intronic
955107099 3:55908799-55908821 GCTGTTCTAGCTTACCATCAAGG + Intronic
955253781 3:57308622-57308644 CCTGCTCTTGTTTACACTGCCGG + Intronic
956548590 3:70435565-70435587 CCTGCTCTTGTTTACACTGCCGG - Intergenic
956709631 3:72027995-72028017 CCTGCTCTTGTTTACACTGCCGG + Intergenic
957986141 3:87574520-87574542 CCTGCTCTTGTTTACACTGCTGG + Intergenic
958055957 3:88412301-88412323 GCTCCTCTTGCCTTCCATGGAGG + Intergenic
958183234 3:90085860-90085882 CCTGCTCTTGTTTACACTGCCGG + Intergenic
958676344 3:97273338-97273360 CCTGCTCTTGTTTACACTGCCGG - Intronic
959287993 3:104440846-104440868 CCTGCTCTTGTTTACACTGCAGG - Intergenic
960282503 3:115794415-115794437 CCTGCTCTTGTTTACACTGCTGG - Intergenic
960309767 3:116106276-116106298 CCTGCTCTTGTTTACACTGCCGG - Intronic
961711265 3:128830129-128830151 CCTGCTCTTGTTTACACTGCCGG - Intergenic
961730947 3:128964455-128964477 CCTGCTCTTGTTTACACTGCCGG + Intronic
961881412 3:130064062-130064084 CCTGCTCTTGTTTACACTGCCGG + Intergenic
963456314 3:145552108-145552130 CCTGCTCTTGTTTACATTGCTGG - Intergenic
963520841 3:146358562-146358584 CCTGCTCTTGTTTACACTGCTGG + Intergenic
963684691 3:148419141-148419163 CCTGCTCTTGTTTACACTGCCGG + Intergenic
964125017 3:153227041-153227063 CCTGCTCTTGTTTACACTGCCGG - Intergenic
964299791 3:155275327-155275349 CCTGCTCTTGTTTACACTGCCGG - Intergenic
964625255 3:158752539-158752561 TTTGCTATTGCTCACCATGCTGG + Intronic
964984008 3:162717355-162717377 CCTGCTCTTGTTTACACTGCCGG + Intergenic
965262245 3:166501485-166501507 CCTGCTCTTGTTTACACTGCCGG - Intergenic
965639612 3:170818498-170818520 CCTGCTCTTGTTTACACTGCCGG - Intronic
965861520 3:173156117-173156139 CCTGCTCTTGTTTACACTGCCGG - Intergenic
966181211 3:177190343-177190365 GATGCTCTTGTTGACCAGGCTGG + Intronic
967044071 3:185720372-185720394 GTTGCTCTTGCTGCCCAGGCTGG + Intronic
967211797 3:187176442-187176464 CCTGCTCTTGTTTACACTGCCGG - Intronic
967243815 3:187467187-187467209 CCTGCTCTTGTTTACACTGCCGG - Intergenic
967496589 3:190149295-190149317 CCTGCTCTTGTTTACACTGCCGG + Intergenic
967657743 3:192072003-192072025 CCTGCTCTTGTTTACACTGCCGG - Intergenic
967740832 3:193000480-193000502 CCTGCTCTTGTTTACACTGCCGG + Intergenic
968633512 4:1665666-1665688 CCTGCTCCTGCTGACCCTGCCGG - Intronic
969963101 4:10965958-10965980 TATGGTCTTGCTTTCCATGCTGG - Intergenic
970087940 4:12368773-12368795 CCTGCTCTTGTTTACACTGCAGG + Intergenic
970255984 4:14170883-14170905 CCTGCTCTTGTTTACACTGCCGG - Intergenic
970853621 4:20630660-20630682 CCTGCTCTTGTTTACACTGCTGG - Intergenic
971200498 4:24505800-24505822 CCTGCTCTTGTTTACACTGCTGG + Intergenic
972146038 4:36026868-36026890 GTTGCTGTTGCTTGCCCTGCTGG - Intronic
972399687 4:38689097-38689119 GCTGCACTTGCTTAGCGTACTGG + Intronic
973905731 4:55528314-55528336 TCTGCTCTTGTTTCCCAGGCTGG - Intronic
974428037 4:61765177-61765199 CCTGCTCTTGTTTACACTGCTGG - Intronic
975864729 4:78714776-78714798 CCTGCTCTTGTTTACACTGCCGG - Intergenic
975923850 4:79425086-79425108 ACTGCACTTGTTTACCAGGCTGG - Intergenic
976697803 4:87936851-87936873 CCTGCTCTTGTTTACACTGCCGG - Intergenic
976884202 4:89965677-89965699 CCTGCTCTTGTTTACACTGCCGG - Intergenic
977012562 4:91655536-91655558 CCTGCTCTTGTTTACACTGCTGG - Intergenic
977074838 4:92439887-92439909 CCTGCTCTTGTTTACACTGCCGG - Intronic
977198066 4:94085545-94085567 CCTGCTCTTGTTTACACTGCTGG - Intergenic
977224901 4:94383830-94383852 CCTGCTCTTGTTTACACTGCCGG - Intergenic
978000757 4:103554684-103554706 CCTGCTCTTGTTTACACTGCCGG - Intergenic
978031885 4:103946089-103946111 CCTGCTCTTGTTTACACTGCTGG + Intergenic
978438979 4:108713946-108713968 CCTGCTCTTGTTTACACTGCCGG + Intergenic
979054256 4:115976582-115976604 CCTGCTCTTGTTTACACTGCCGG - Intergenic
979146975 4:117256883-117256905 CCTGCTCTTGTTTACACTGCCGG + Intergenic
979170989 4:117601053-117601075 CCTGCTCTTGTTTACACTGCCGG - Intergenic
979380301 4:119998717-119998739 CCTGCTCTTGTTTACACTGCCGG + Intergenic
979849942 4:125562549-125562571 CCTGCTCTTGTTTACACTGCCGG - Intergenic
979894812 4:126146103-126146125 CCTGCTCTTGTTTACACTGCCGG - Intergenic
980002947 4:127511867-127511889 CCTGCTCTTGTTTACACTGCCGG - Intergenic
980111547 4:128641781-128641803 TCTGCTCTTGTTTACACTGCCGG - Intergenic
981040612 4:140218290-140218312 CCTGCTCTTGTTTACACTGCCGG + Intergenic
981274295 4:142879927-142879949 TCTGCTCTAGCTTTCCCTGCAGG + Intergenic
981525410 4:145702554-145702576 CCTGCTCTTGTTTACACTGCCGG + Intronic
981540086 4:145837553-145837575 CCTGCTCTTGTTTACACTGCCGG + Intronic
982180119 4:152742278-152742300 CCTGCTCTTGTTTACACTGCCGG - Intronic
982396298 4:154919213-154919235 CCTGCTCTTGTTTACACTGCCGG - Intergenic
982535808 4:156605080-156605102 CCTGCTCTTGTTTACACTGCCGG + Intergenic
982740209 4:159050077-159050099 GCTGCTCTTTTTGACCCTGCAGG + Intergenic
983024245 4:162713893-162713915 CCTGCTCTTGTTTACACTGCCGG + Intergenic
983345960 4:166525527-166525549 CCTGCTCTTGTTTACACTGCCGG + Intergenic
983448423 4:167881120-167881142 CCTGCTCTTGTTTACACTGCCGG + Intergenic
983563709 4:169127639-169127661 CTTCCTCTTGCTTAACATGCAGG + Intronic
983805426 4:171986947-171986969 CCTGCTCTTGTTTACACTGCCGG - Intronic
984098641 4:175462100-175462122 CCTGCTCTTGTTTACACTGCCGG - Intergenic
984700872 4:182817983-182818005 CCTGCTCTTGTTTACACTGCCGG + Intergenic
985056992 4:186044905-186044927 CCTGCTCTTGATTACATTGCCGG - Intergenic
986193892 5:5520334-5520356 CCTGCTCTTGTTTACACTGCTGG + Intergenic
986344519 5:6822540-6822562 GCTGTTAGTGCTTACCATGTAGG + Intergenic
986389245 5:7268379-7268401 CCTGCTCTTGTTTACACTGCCGG + Intergenic
986653551 5:9988783-9988805 GCTGGTCTTGCTTTCCATGTGGG - Intergenic
986716287 5:10526277-10526299 GCTGGTCTTGCTTCCGTTGCTGG - Intergenic
987487849 5:18543063-18543085 CCTGCTCTTGTTTACACTGCCGG + Intergenic
987756196 5:22099636-22099658 CCTGCTCTTGTTTACACTGCCGG + Intronic
988899141 5:35712816-35712838 GAGATTCTTGCTTACCATGCGGG - Exonic
992395031 5:76362121-76362143 CCTGCTCTTGTTTACACTGCCGG + Intergenic
992961236 5:81958323-81958345 CCTGCTCTTGTTTACACTGCCGG + Intergenic
994083445 5:95732077-95732099 GCTGCTCTTCCTTACCCAGACGG - Exonic
994125654 5:96167292-96167314 CCTGCTCTTGTTTACACTGCCGG - Intergenic
994532200 5:100985206-100985228 CCTGCTCTTGTTTACACTGCTGG - Intergenic
994557271 5:101319688-101319710 CCTGCTCTTGTTTACACTGCCGG + Intergenic
994744558 5:103662747-103662769 TCTGCTCTTGCTTAGCATTTCGG + Intergenic
994989905 5:106983135-106983157 CCTGCTCTTGTTTACACTGCCGG + Intergenic
995122865 5:108554070-108554092 CCTGCTCTTGTTTACACTGCCGG + Intergenic
995297022 5:110534627-110534649 CCTGCTCTTGTTTACACTGCTGG + Intronic
996745032 5:126840262-126840284 CCTGCTCTTGTTTACACTGCCGG - Intergenic
996779603 5:127171426-127171448 GCAGCTTTTGCTTACCAGGCTGG + Intergenic
997332303 5:133073431-133073453 GCTGCTCTTGCTTACCACTGTGG + Intronic
997746762 5:136306091-136306113 CCTGCTCTTGTTTACACTGCCGG + Intronic
997969491 5:138389110-138389132 GCTGCTGTTGCTTCACAGGCAGG - Intronic
998693328 5:144612236-144612258 CCTGCTCTTGTTTACACTGCTGG - Intergenic
998995746 5:147868083-147868105 CCTGCTCTTGTTTACACTGCCGG + Intergenic
999464593 5:151790091-151790113 TTTGCTCTTGCTGACCAGGCTGG - Intronic
1000440174 5:161254099-161254121 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1003429813 6:6028719-6028741 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1004106632 6:12672152-12672174 CCTGCTCTTGTTTACACTGCGGG + Intergenic
1004283150 6:14297873-14297895 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1004507636 6:16259908-16259930 CCTGCTCTTGTTTACACTGCCGG - Intronic
1004575595 6:16890741-16890763 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1004768210 6:18755016-18755038 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1004837407 6:19543908-19543930 TCTGCTCTTGTTTACACTGCCGG + Intergenic
1005014289 6:21362424-21362446 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1006325276 6:33348998-33349020 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1008477001 6:51943476-51943498 CCTGCTCTTGTTTACACTGCCGG + Intronic
1009270247 6:61605307-61605329 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1010662579 6:78587512-78587534 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1011367508 6:86599127-86599149 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1011770582 6:90671129-90671151 CCTGCTCTTACTTACAGTGCCGG - Intergenic
1012066172 6:94554851-94554873 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1012316177 6:97784368-97784390 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1013407524 6:109856667-109856689 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1014359799 6:120463196-120463218 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1014556213 6:122844614-122844636 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1014793622 6:125702781-125702803 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1014891900 6:126853521-126853543 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1015165601 6:130197320-130197342 CCTGCTCTTGTTTACACTGCCGG + Intronic
1015196664 6:130530730-130530752 GCTGCTCTTGTTGCCCAGGCTGG - Intergenic
1015271723 6:131343610-131343632 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1015278517 6:131407608-131407630 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1015800918 6:137061498-137061520 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1016249268 6:142020827-142020849 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1016519160 6:144927921-144927943 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1016535390 6:145104070-145104092 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1016649940 6:146451385-146451407 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1016853639 6:148644595-148644617 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1017389869 6:153926272-153926294 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1017888984 6:158624149-158624171 GCTGCTCTTCCTTCCCAGTCAGG + Intronic
1017922310 6:158883135-158883157 CCTGCTCTTGTTTACACTGCCGG - Intronic
1017989600 6:159474556-159474578 GCTGCTCATCCTGACGATGCAGG - Intergenic
1018084134 6:160287493-160287515 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1018495030 6:164339656-164339678 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1018521105 6:164653033-164653055 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1018536996 6:164831286-164831308 TCTGCTTTTTCTAACCATGCTGG - Intergenic
1018670367 6:166171987-166172009 GCTGATTTTGCTTGGCATGCAGG + Intergenic
1020316346 7:6908079-6908101 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1020532348 7:9354338-9354360 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1020540657 7:9458634-9458656 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1021394037 7:20125593-20125615 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1021637755 7:22708416-22708438 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1021811011 7:24401040-24401062 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1021977545 7:26025119-26025141 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1022854389 7:34301049-34301071 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1023106660 7:36769681-36769703 GCTGCTCTTGCCTGCCTGGCAGG - Intergenic
1024548277 7:50540028-50540050 GCTGCTCTGTCCTCCCATGCAGG - Exonic
1025020855 7:55478011-55478033 GCTGGCCATGCTTACCATTCAGG + Intronic
1030855860 7:114556376-114556398 GCTGCTGCTGCTTCCCCTGCAGG + Intronic
1031400344 7:121320350-121320372 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1031526011 7:122822046-122822068 CCTGCTCTTGTTTACACTGCCGG + Intronic
1031776678 7:125914786-125914808 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1031777813 7:125923197-125923219 GCTGCTCTTGTTTACACTGCCGG + Intergenic
1033464559 7:141578975-141578997 CCTGCTCTTGTTTACACTGCCGG - Intronic
1033675590 7:143538146-143538168 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1033909107 7:146244300-146244322 CCTGCTCTTGTTTACACTGCCGG - Intronic
1034541634 7:151762218-151762240 GCTGCCCTCGGCTACCATGCAGG - Intronic
1035880261 8:3238884-3238906 CCTGCTCTTGATTACACTGCTGG - Intronic
1036248965 8:7145459-7145481 GATTCTCTTGCTTGCCCTGCAGG - Intergenic
1036471888 8:9059793-9059815 CCTGCTCTTGTTTACACTGCCGG - Intronic
1036639894 8:10576435-10576457 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1037367304 8:18136473-18136495 TCTGCTCTTGTTGACCAGGCTGG - Intergenic
1041801083 8:61800288-61800310 GTTGCTTTTGCTAATCATGCTGG - Intergenic
1042453920 8:68977936-68977958 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1043084583 8:75812988-75813010 TTTGCTCTTGCTGCCCATGCTGG + Intergenic
1043353306 8:79387021-79387043 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1044258264 8:90091139-90091161 CCTGCTCTTGTTTACACTGCCGG - Intronic
1045176363 8:99729223-99729245 ACTGCTCTTGCTTTCCACCCTGG + Intronic
1045395461 8:101756379-101756401 GCTGGTCGTGCTGACCATTCAGG - Intronic
1045645223 8:104291176-104291198 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1046188046 8:110748683-110748705 CCTGCTCTTTCTAGCCATGCTGG + Intergenic
1046385997 8:113510531-113510553 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1046440377 8:114246131-114246153 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1046443622 8:114286784-114286806 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1047367720 8:124227743-124227765 GGTGCTCTAGCTGACCATGCAGG - Intergenic
1047699715 8:127436510-127436532 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1047829178 8:128612834-128612856 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1048097959 8:131314994-131315016 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1048144170 8:131824192-131824214 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1048168079 8:132081168-132081190 CCTGCTCTTGTTTACACTGCCGG - Intronic
1048763832 8:137825526-137825548 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1050896471 9:10889809-10889831 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1051052997 9:12953148-12953170 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1051849123 9:21488213-21488235 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1052163540 9:25293240-25293262 TCTGCTCTTGCTTACACTGCCGG + Intergenic
1053078142 9:35152463-35152485 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1053161955 9:35819360-35819382 GCGGCACTGGCTTACCTTGCAGG + Exonic
1054792258 9:69267054-69267076 TCTGCTCTTGTTTCCCAGGCTGG - Intergenic
1055233432 9:74090456-74090478 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1055810422 9:80142208-80142230 CCTGCTCTTGTTTACATTGCTGG + Intergenic
1055882166 9:81014367-81014389 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1056061519 9:82888538-82888560 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1056522810 9:87415720-87415742 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1056883336 9:90417372-90417394 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1057235206 9:93352395-93352417 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1057378348 9:94544590-94544612 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1057684278 9:97219025-97219047 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1057982450 9:99674946-99674968 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1058025763 9:100141072-100141094 CCTGCTCTTGTTTACACTGCTGG - Intronic
1058753981 9:108066996-108067018 GCTGGTCTTGTTTATCATGGAGG + Intergenic
1059574967 9:115478091-115478113 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1059606340 9:115840111-115840133 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1060335654 9:122719261-122719283 TTTGCTCTTGCTGACCAGGCTGG - Intergenic
1185615573 X:1419683-1419705 GCTGGGCTTGCTTGCCCTGCAGG - Intronic
1185858055 X:3554053-3554075 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1185960327 X:4541408-4541430 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1185991435 X:4896383-4896405 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1186112485 X:6273102-6273124 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1186784447 X:12944624-12944646 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1187086154 X:16045608-16045630 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1187092256 X:16109058-16109080 TCTGCTCTTGTTTCCCAGGCTGG + Intergenic
1187099609 X:16180099-16180121 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1187552618 X:20321462-20321484 GCTCCTCCTGCCTACCATACTGG - Intergenic
1187882271 X:23858207-23858229 GGTGCCCTTGCTTTCCTTGCTGG - Intronic
1188462992 X:30449822-30449844 CCTGCTCTTGTTTACATTGCTGG - Intergenic
1188553063 X:31382419-31382441 CCTGCTCTTGTTTACACTGCTGG + Intronic
1190248985 X:48708112-48708134 TCTGCTCGTGCTTACAGTGCTGG + Exonic
1192203608 X:69082272-69082294 GCTGCTCAGGCGTGCCATGCTGG - Intergenic
1193323087 X:80147696-80147718 GTTGCTCTTGTTGCCCATGCTGG + Intergenic
1193443927 X:81577079-81577101 TCTGCTGCTCCTTACCATGCAGG + Intergenic
1193941866 X:87686689-87686711 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1194185879 X:90774245-90774267 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1194351531 X:92828433-92828455 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1194502613 X:94699738-94699760 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1194822407 X:98525180-98525202 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1194873330 X:99159604-99159626 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1195326401 X:103762031-103762053 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1196073448 X:111548717-111548739 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1196165907 X:112535399-112535421 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1196220605 X:113109635-113109657 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1196300394 X:114045081-114045103 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1196331193 X:114471556-114471578 CCTGCTCTTGTTTACACTGCTGG + Intergenic
1196341350 X:114602207-114602229 CCTGCTCTTGTTTACACTGCCGG - Intronic
1196572857 X:117283938-117283960 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1196773502 X:119318697-119318719 CCTGCTCTTGTTTACACTGCCGG - Intergenic
1197065272 X:122226830-122226852 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1197633272 X:128886609-128886631 CCTGCTTTTTCTAACCATGCTGG + Intergenic
1197643498 X:128992800-128992822 TCTGCTCTTGCCTACCACACCGG - Intergenic
1198983348 X:142424272-142424294 CCTGCTCTTGTTTACACTGCTGG - Intergenic
1199379684 X:147155622-147155644 GCTGCTTTTTCTAGCCATGCTGG + Intergenic
1200234171 X:154460207-154460229 GCTGCTCTTCCTTGCCGTGGGGG + Exonic
1200659852 Y:5945125-5945147 CCTGCTCTTGTTTACACTGCCGG + Intergenic
1201233752 Y:11890836-11890858 CCTGCTCTTGTTTACACTGCCGG - Intergenic