ID: 1131248645

View in Genome Browser
Species Human (GRCh38)
Location 15:90817085-90817107
Sequence GGCACAGCCTGCGACCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131248645_1131248648 -7 Left 1131248645 15:90817085-90817107 CCCTCAGGGTCGCAGGCTGTGCC No data
Right 1131248648 15:90817101-90817123 CTGTGCCTCCAGGAGCTCCCAGG No data
1131248645_1131248655 3 Left 1131248645 15:90817085-90817107 CCCTCAGGGTCGCAGGCTGTGCC No data
Right 1131248655 15:90817111-90817133 AGGAGCTCCCAGGGCTGTGGGGG No data
1131248645_1131248659 28 Left 1131248645 15:90817085-90817107 CCCTCAGGGTCGCAGGCTGTGCC No data
Right 1131248659 15:90817136-90817158 CAGATGAAAATAACGTGCATGGG No data
1131248645_1131248658 27 Left 1131248645 15:90817085-90817107 CCCTCAGGGTCGCAGGCTGTGCC No data
Right 1131248658 15:90817135-90817157 ACAGATGAAAATAACGTGCATGG No data
1131248645_1131248653 1 Left 1131248645 15:90817085-90817107 CCCTCAGGGTCGCAGGCTGTGCC No data
Right 1131248653 15:90817109-90817131 CCAGGAGCTCCCAGGGCTGTGGG No data
1131248645_1131248660 29 Left 1131248645 15:90817085-90817107 CCCTCAGGGTCGCAGGCTGTGCC No data
Right 1131248660 15:90817137-90817159 AGATGAAAATAACGTGCATGGGG No data
1131248645_1131248649 -6 Left 1131248645 15:90817085-90817107 CCCTCAGGGTCGCAGGCTGTGCC No data
Right 1131248649 15:90817102-90817124 TGTGCCTCCAGGAGCTCCCAGGG No data
1131248645_1131248651 0 Left 1131248645 15:90817085-90817107 CCCTCAGGGTCGCAGGCTGTGCC No data
Right 1131248651 15:90817108-90817130 TCCAGGAGCTCCCAGGGCTGTGG No data
1131248645_1131248654 2 Left 1131248645 15:90817085-90817107 CCCTCAGGGTCGCAGGCTGTGCC No data
Right 1131248654 15:90817110-90817132 CAGGAGCTCCCAGGGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131248645 Original CRISPR GGCACAGCCTGCGACCCTGA GGG (reversed) Intergenic