ID: 1131249051

View in Genome Browser
Species Human (GRCh38)
Location 15:90819041-90819063
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131249039_1131249051 13 Left 1131249039 15:90819005-90819027 CCTCCCTGGTTGGGGTGGGCTGT No data
Right 1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG No data
1131249041_1131249051 9 Left 1131249041 15:90819009-90819031 CCTGGTTGGGGTGGGCTGTGTAC No data
Right 1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG No data
1131249038_1131249051 14 Left 1131249038 15:90819004-90819026 CCCTCCCTGGTTGGGGTGGGCTG No data
Right 1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG No data
1131249040_1131249051 10 Left 1131249040 15:90819008-90819030 CCCTGGTTGGGGTGGGCTGTGTA No data
Right 1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131249051 Original CRISPR CAGGGTCACCACTGGGAAGA AGG Intergenic