ID: 1131249298

View in Genome Browser
Species Human (GRCh38)
Location 15:90820116-90820138
Sequence GCACCCAGTGAGAGCCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131249294_1131249298 -9 Left 1131249294 15:90820102-90820124 CCACCAGGTCCCTTGCACCCAGT No data
Right 1131249298 15:90820116-90820138 GCACCCAGTGAGAGCCAGTCTGG No data
1131249292_1131249298 0 Left 1131249292 15:90820093-90820115 CCACCGTCGCCACCAGGTCCCTT No data
Right 1131249298 15:90820116-90820138 GCACCCAGTGAGAGCCAGTCTGG No data
1131249290_1131249298 8 Left 1131249290 15:90820085-90820107 CCGTGCGGCCACCGTCGCCACCA No data
Right 1131249298 15:90820116-90820138 GCACCCAGTGAGAGCCAGTCTGG No data
1131249293_1131249298 -3 Left 1131249293 15:90820096-90820118 CCGTCGCCACCAGGTCCCTTGCA No data
Right 1131249298 15:90820116-90820138 GCACCCAGTGAGAGCCAGTCTGG No data
1131249289_1131249298 9 Left 1131249289 15:90820084-90820106 CCCGTGCGGCCACCGTCGCCACC No data
Right 1131249298 15:90820116-90820138 GCACCCAGTGAGAGCCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131249298 Original CRISPR GCACCCAGTGAGAGCCAGTC TGG Intergenic
No off target data available for this crispr