ID: 1131250460

View in Genome Browser
Species Human (GRCh38)
Location 15:90826975-90826997
Sequence CAGTAACCGTGGAGTAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131250460_1131250464 3 Left 1131250460 15:90826975-90826997 CCCACCTTACTCCACGGTTACTG No data
Right 1131250464 15:90827001-90827023 AGCGCCCAGAAGAGAAGCCATGG No data
1131250460_1131250470 24 Left 1131250460 15:90826975-90826997 CCCACCTTACTCCACGGTTACTG No data
Right 1131250470 15:90827022-90827044 GGATGTGGGCGACGCATTCGAGG No data
1131250460_1131250468 10 Left 1131250460 15:90826975-90826997 CCCACCTTACTCCACGGTTACTG No data
Right 1131250468 15:90827008-90827030 AGAAGAGAAGCCATGGATGTGGG No data
1131250460_1131250467 9 Left 1131250460 15:90826975-90826997 CCCACCTTACTCCACGGTTACTG No data
Right 1131250467 15:90827007-90827029 CAGAAGAGAAGCCATGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131250460 Original CRISPR CAGTAACCGTGGAGTAAGGT GGG (reversed) Intergenic
No off target data available for this crispr