ID: 1131250655

View in Genome Browser
Species Human (GRCh38)
Location 15:90828089-90828111
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131250648_1131250655 26 Left 1131250648 15:90828040-90828062 CCAGATCACTGCAAAGTGGGGCA No data
Right 1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG No data
1131250643_1131250655 30 Left 1131250643 15:90828036-90828058 CCCTCCAGATCACTGCAAAGTGG No data
Right 1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG No data
1131250645_1131250655 29 Left 1131250645 15:90828037-90828059 CCTCCAGATCACTGCAAAGTGGG No data
Right 1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131250655 Original CRISPR GACACCCAGGGCGCCCCAGC AGG Intergenic