ID: 1131250655 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:90828089-90828111 |
| Sequence | GACACCCAGGGCGCCCCAGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1131250648_1131250655 | 26 | Left | 1131250648 | 15:90828040-90828062 | CCAGATCACTGCAAAGTGGGGCA | No data | ||
| Right | 1131250655 | 15:90828089-90828111 | GACACCCAGGGCGCCCCAGCAGG | No data | ||||
| 1131250643_1131250655 | 30 | Left | 1131250643 | 15:90828036-90828058 | CCCTCCAGATCACTGCAAAGTGG | No data | ||
| Right | 1131250655 | 15:90828089-90828111 | GACACCCAGGGCGCCCCAGCAGG | No data | ||||
| 1131250645_1131250655 | 29 | Left | 1131250645 | 15:90828037-90828059 | CCTCCAGATCACTGCAAAGTGGG | No data | ||
| Right | 1131250655 | 15:90828089-90828111 | GACACCCAGGGCGCCCCAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1131250655 | Original CRISPR | GACACCCAGGGCGCCCCAGC AGG | Intergenic | ||