ID: 1131251152

View in Genome Browser
Species Human (GRCh38)
Location 15:90830926-90830948
Sequence CTCTGTTTTTAGATGTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131251152_1131251153 10 Left 1131251152 15:90830926-90830948 CCATGACACATCTAAAAACAGAG No data
Right 1131251153 15:90830959-90830981 GTACATGCATCTGAAAAGCAAGG No data
1131251152_1131251156 22 Left 1131251152 15:90830926-90830948 CCATGACACATCTAAAAACAGAG No data
Right 1131251156 15:90830971-90830993 GAAAAGCAAGGGAATAGTGTGGG No data
1131251152_1131251154 11 Left 1131251152 15:90830926-90830948 CCATGACACATCTAAAAACAGAG No data
Right 1131251154 15:90830960-90830982 TACATGCATCTGAAAAGCAAGGG No data
1131251152_1131251155 21 Left 1131251152 15:90830926-90830948 CCATGACACATCTAAAAACAGAG No data
Right 1131251155 15:90830970-90830992 TGAAAAGCAAGGGAATAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131251152 Original CRISPR CTCTGTTTTTAGATGTGTCA TGG (reversed) Intergenic
No off target data available for this crispr