ID: 1131252334

View in Genome Browser
Species Human (GRCh38)
Location 15:90838758-90838780
Sequence AAGCAGGGACGCTGAGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131252326_1131252334 9 Left 1131252326 15:90838726-90838748 CCCCAGTGCCAGGCAAGGACTAG No data
Right 1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG No data
1131252328_1131252334 7 Left 1131252328 15:90838728-90838750 CCAGTGCCAGGCAAGGACTAGAG No data
Right 1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG No data
1131252327_1131252334 8 Left 1131252327 15:90838727-90838749 CCCAGTGCCAGGCAAGGACTAGA No data
Right 1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG No data
1131252324_1131252334 15 Left 1131252324 15:90838720-90838742 CCTCAGCCCCAGTGCCAGGCAAG No data
Right 1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG No data
1131252329_1131252334 1 Left 1131252329 15:90838734-90838756 CCAGGCAAGGACTAGAGCCATGG No data
Right 1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131252334 Original CRISPR AAGCAGGGACGCTGAGTCCC TGG Intergenic
No off target data available for this crispr