ID: 1131253262

View in Genome Browser
Species Human (GRCh38)
Location 15:90844846-90844868
Sequence CCACCACGCCTGGCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131253258_1131253262 5 Left 1131253258 15:90844818-90844840 CCTGAGTAGCTGGGACCACAGGC 0: 4596
1: 84607
2: 202440
3: 237495
4: 171610
Right 1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG No data
1131253255_1131253262 14 Left 1131253255 15:90844809-90844831 CCTCAGACTCCTGAGTAGCTGGG 0: 1054
1: 99726
2: 205351
3: 239656
4: 153652
Right 1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG No data
1131253259_1131253262 -10 Left 1131253259 15:90844833-90844855 CCACAGGCGCATACCACCACGCC 0: 2
1: 88
2: 1225
3: 5419
4: 9567
Right 1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG No data
1131253253_1131253262 18 Left 1131253253 15:90844805-90844827 CCAGCCTCAGACTCCTGAGTAGC 0: 819
1: 83375
2: 182235
3: 213216
4: 143590
Right 1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131253262 Original CRISPR CCACCACGCCTGGCTAAAAC TGG Intergenic
No off target data available for this crispr