ID: 1131253377

View in Genome Browser
Species Human (GRCh38)
Location 15:90845505-90845527
Sequence AGCACAAAGCAGCACCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131253377_1131253379 -8 Left 1131253377 15:90845505-90845527 CCACACTGGTGCTGCTTTGTGCT No data
Right 1131253379 15:90845520-90845542 TTTGTGCTGGCAAATAGCACAGG No data
1131253377_1131253380 9 Left 1131253377 15:90845505-90845527 CCACACTGGTGCTGCTTTGTGCT No data
Right 1131253380 15:90845537-90845559 CACAGGCCCCCAAAATGACCTGG No data
1131253377_1131253386 26 Left 1131253377 15:90845505-90845527 CCACACTGGTGCTGCTTTGTGCT No data
Right 1131253386 15:90845554-90845576 ACCTGGAGGCTCCTTAACTGAGG No data
1131253377_1131253381 12 Left 1131253377 15:90845505-90845527 CCACACTGGTGCTGCTTTGTGCT No data
Right 1131253381 15:90845540-90845562 AGGCCCCCAAAATGACCTGGAGG No data
1131253377_1131253388 29 Left 1131253377 15:90845505-90845527 CCACACTGGTGCTGCTTTGTGCT No data
Right 1131253388 15:90845557-90845579 TGGAGGCTCCTTAACTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131253377 Original CRISPR AGCACAAAGCAGCACCAGTG TGG (reversed) Intergenic