ID: 1131253381

View in Genome Browser
Species Human (GRCh38)
Location 15:90845540-90845562
Sequence AGGCCCCCAAAATGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131253377_1131253381 12 Left 1131253377 15:90845505-90845527 CCACACTGGTGCTGCTTTGTGCT No data
Right 1131253381 15:90845540-90845562 AGGCCCCCAAAATGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131253381 Original CRISPR AGGCCCCCAAAATGACCTGG AGG Intergenic