ID: 1131257620

View in Genome Browser
Species Human (GRCh38)
Location 15:90872209-90872231
Sequence CGCCGGCGGCCGGCGCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131257606_1131257620 20 Left 1131257606 15:90872166-90872188 CCGCACACCTGTGCGGCCAGGAC 0: 1
1: 0
2: 0
3: 19
4: 206
Right 1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 164
1131257603_1131257620 24 Left 1131257603 15:90872162-90872184 CCGCCCGCACACCTGTGCGGCCA 0: 1
1: 0
2: 0
3: 22
4: 138
Right 1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 164
1131257599_1131257620 27 Left 1131257599 15:90872159-90872181 CCCCCGCCCGCACACCTGTGCGG 0: 1
1: 0
2: 2
3: 9
4: 136
Right 1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 164
1131257612_1131257620 4 Left 1131257612 15:90872182-90872204 CCAGGACTCGGGTGCGGGATCCG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 164
1131257601_1131257620 26 Left 1131257601 15:90872160-90872182 CCCCGCCCGCACACCTGTGCGGC 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 164
1131257602_1131257620 25 Left 1131257602 15:90872161-90872183 CCCGCCCGCACACCTGTGCGGCC 0: 1
1: 0
2: 1
3: 9
4: 174
Right 1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 164
1131257609_1131257620 13 Left 1131257609 15:90872173-90872195 CCTGTGCGGCCAGGACTCGGGTG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 164
1131257605_1131257620 21 Left 1131257605 15:90872165-90872187 CCCGCACACCTGTGCGGCCAGGA 0: 1
1: 0
2: 0
3: 14
4: 180
Right 1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131257620 Original CRISPR CGCCGGCGGCCGGCGCAGGT AGG Intronic
900032438 1:381235-381257 GCCAGGCGGCCGGCGCACGTGGG + Intergenic
900032534 1:381643-381665 GCCTGGCGGCCGGCGCACGTGGG + Intergenic
900053290 1:610705-610727 GCCTGGCGGCCGGCGCACGTGGG + Intergenic
900195647 1:1374357-1374379 CATCGCCGGCCGGCCCAGGTAGG - Exonic
900366592 1:2314295-2314317 CCTCAGCGGCCAGCGCAGGTCGG - Intergenic
901089934 1:6634483-6634505 GGCTGGAGGCCGGCGCAGCTTGG + Exonic
901641428 1:10694873-10694895 CGCCGGCGGCCGGCAAGAGTGGG - Intronic
905308492 1:37034418-37034440 GCCCGGCAGCCGGGGCAGGTGGG - Intergenic
905416698 1:37808703-37808725 CGCCGGCGCCCGGAGCCGGCTGG + Exonic
906805645 1:48776838-48776860 CGCCGGGGGCGGGCCCCGGTCGG + Exonic
911707042 1:101025919-101025941 CGCCGGCTGCTGGGGCAGGGCGG + Intronic
912561685 1:110555719-110555741 CGCCGGCAGCCGGGGCGGGACGG + Intergenic
912619399 1:111140047-111140069 CGCCAGCGGCCAGCGCTAGTCGG - Intronic
913209507 1:116571067-116571089 CGCCGGCTGCCAGCCCAGGGCGG - Intergenic
914803163 1:150974762-150974784 CGCCGGCGGCTGGCGGAGGAGGG - Exonic
916107008 1:161440295-161440317 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
916108569 1:161447709-161447731 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
916110157 1:161455090-161455112 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
916111742 1:161462500-161462522 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
916113329 1:161469881-161469903 CGCCGACGCCCGGGGCAGGCCGG + Intergenic
921930238 1:220748673-220748695 CGCCGGCGGCTGCAGCAGGTGGG + Exonic
922134837 1:222814902-222814924 CGCCGGCGGCGGGCGACGGGCGG - Intergenic
922958529 1:229625751-229625773 CGCCGGCGGGCGGTGGGGGTGGG - Intronic
922958609 1:229625976-229625998 CTCCGACGGCCGGCTCAGCTGGG + Exonic
1070835596 10:79445299-79445321 CGCCGGCGGTCGGCTCGGGCCGG + Exonic
1072757743 10:98031477-98031499 CGCAGGCGGCAGGAGCGGGTGGG - Intergenic
1075375419 10:121974804-121974826 CCCCCGCGCCCGGCGCAGGGCGG + Intronic
1076638866 10:131900866-131900888 CGCCTGCGCCCGGCGCCGCTCGG - Exonic
1077404652 11:2377626-2377648 CGCCGGGGGCCGGGGCGGGAGGG + Intronic
1078174969 11:8963817-8963839 GGCTGGCGGAGGGCGCAGGTGGG + Intronic
1081854584 11:46295568-46295590 CGCGGGCCGTCGGCGCAGGCCGG + Intronic
1085266790 11:75242125-75242147 CGCGGGCGCGCGGCGCGGGTCGG - Exonic
1086437947 11:86800372-86800394 CGCCTGCGGCCGGAGCAGGGTGG - Exonic
1089262423 11:117232197-117232219 CGCGGGCGGCCTACGCAGGCAGG + Exonic
1089740320 11:120577786-120577808 TGCTGGCGGCAGGGGCAGGTGGG + Intronic
1090824409 11:130374225-130374247 CGCCCGCTGCAGGCTCAGGTAGG - Intergenic
1091558603 12:1594211-1594233 CGGCGGCGGCCGGAGCCGGAAGG - Intronic
1092810510 12:12267382-12267404 CGCCGCCGGCAGGGCCAGGTGGG + Intergenic
1101409506 12:104457110-104457132 CGCCGGCGGCCGCCGCTGCCTGG - Exonic
1101640006 12:106581067-106581089 CGGCAGCGGCCGGGGCAGGAAGG + Intronic
1101701647 12:107179518-107179540 CTCCGGCGGCAGGTGCAGGGTGG + Intergenic
1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG + Intronic
1104602407 12:130162510-130162532 CGGCCGAGGCCGGCGCAGGGAGG + Exonic
1104930965 12:132339297-132339319 CGCCGGAGGCTGGCCCAGGTGGG - Intergenic
1116657979 14:47675013-47675035 GGCCGGCGGCGGGCGCGGGCAGG + Intergenic
1117547998 14:56808959-56808981 CGCCCGCGCCCGGCGCTGGCAGG + Intronic
1119309568 14:73634490-73634512 CGCAGGCGCGCGGCGCAGCTCGG - Intergenic
1119318316 14:73713952-73713974 CGACGGCGGGCGGCGAAGGCAGG + Exonic
1121355026 14:93207096-93207118 AGCCCGCGTCCGGCGCAGGCGGG + Exonic
1122543280 14:102509430-102509452 CGCAGGTGGCCGGCGCAGCGAGG + Intronic
1122543372 14:102509716-102509738 CGCCGGCGGCGGGCGGCGGGCGG + Exonic
1202848502 14_GL000225v1_random:1282-1304 CCCCGCCTGCCGGGGCAGGTTGG - Intergenic
1125485604 15:40108812-40108834 CGGCGGCGGCGGGCACAGGCCGG + Exonic
1126736702 15:51737807-51737829 CGCGGGCGCCCGGGGCAGGCAGG - Exonic
1127867122 15:63042284-63042306 CGCCGGGGGACGGCACAGGGGGG + Intergenic
1128111279 15:65077685-65077707 CGCCGGCGGCCGGCTGCGGCAGG - Exonic
1128264275 15:66253600-66253622 GGCCGGCCGCGGGAGCAGGTAGG - Exonic
1130390231 15:83447992-83448014 CGCCGGTGGCCGGTGGAGGATGG - Intronic
1131257620 15:90872209-90872231 CGCCGGCGGCCGGCGCAGGTAGG + Intronic
1132739271 16:1403317-1403339 CCCCGTCGTCCGGTGCAGGTAGG + Exonic
1132741287 16:1414564-1414586 CGCCCGCGCCCGGTGCAGCTCGG - Intronic
1134492205 16:14703598-14703620 CCGCGGCGGCCGGAGCAGGGTGG - Intergenic
1134497586 16:14742720-14742742 CCGCGGCGGCCGGAGCAGGGTGG - Intronic
1136153020 16:28364637-28364659 CGGCGGCGGCCGGAGCAGGGTGG + Intergenic
1136210063 16:28750636-28750658 CGGCGGCGGCCGGAGCAGGGTGG - Intergenic
1139664819 16:68448180-68448202 CGCCGGAGGTCGGAGCAGCTTGG - Intronic
1141054750 16:80804559-80804581 GGCCGGCGGCGGGCGCCGGGCGG - Intergenic
1141900815 16:86989104-86989126 TGCCGGGGGCCGGGGGAGGTCGG - Intergenic
1142156233 16:88533929-88533951 CGCGGGCGGCCGGGGCAGCGAGG + Exonic
1142189381 16:88710831-88710853 AGGCGGCGGCCCGCGCAGGGAGG + Intronic
1142265681 16:89063076-89063098 CGCCGGCGGTGGGGGCAGGTGGG - Intergenic
1142299206 16:89247051-89247073 CGAGGGCGGCCCGCGCCGGTTGG - Intergenic
1146445257 17:32928018-32928040 CCCCGGCGGCCGGGGCAGCTGGG - Exonic
1148826353 17:50397162-50397184 GGCCAGCGCCCGGCGAAGGTGGG + Intronic
1149993554 17:61395839-61395861 CACCGCCGCCCGTCGCAGGTGGG + Intergenic
1150407949 17:64919109-64919131 CGGCAGCAGCCGGGGCAGGTGGG - Intronic
1150747273 17:67825856-67825878 CGGCAGCAGCCGGGGCAGGTGGG + Exonic
1152542044 17:80981437-80981459 AGCCGGCGGCCCTCGCAGCTGGG - Intergenic
1152625652 17:81386930-81386952 CGCCCCCGGCCGGCGCAAGTGGG - Intergenic
1152709051 17:81861122-81861144 CGGCGGCGGCCGTGGAAGGTGGG + Intergenic
1152947422 17:83205607-83205629 GCCTGGCGGCCGGCGCACGTGGG - Intergenic
1152947454 17:83205743-83205765 GCCTGGCGGCCGGCGCACGTGGG - Intergenic
1160242063 18:77131849-77131871 CGGCTGCGGGCGGCGCACGTGGG + Intronic
1160910209 19:1470610-1470632 TGACGGCGCCCGCCGCAGGTGGG + Exonic
1161242170 19:3228596-3228618 CGCTGGGGGACGGTGCAGGTGGG + Intronic
1161333825 19:3700430-3700452 CGGCGGCGGCGGTCGCAGCTCGG - Exonic
1161388144 19:4007803-4007825 CGGCGCCGGCCGGGGCAAGTGGG + Intronic
1162932037 19:13962254-13962276 AGCCCCGGGCCGGCGCAGGTGGG - Exonic
1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG + Exonic
1165233848 19:34404798-34404820 CACCGGCGGTGCGCGCAGGTAGG + Exonic
1165961657 19:39539894-39539916 TGCCGGCGGCCAGGGAAGGTCGG - Exonic
1166389615 19:42401777-42401799 TGACGGAGGCCGGCGCAGATGGG + Exonic
925265685 2:2564873-2564895 CCCCAGGGGCCGGCGCAGTTAGG + Intergenic
927213238 2:20651241-20651263 CGCCGTCGGCCTGCGCTGCTCGG + Intergenic
928025928 2:27738475-27738497 AGCTGGCGGCCGGAGCATGTCGG - Intergenic
931052272 2:58428387-58428409 GGCCGGCGGTCGGCGCAGCCCGG - Intergenic
931728185 2:65130518-65130540 TGCCGGCGGCCGACGGAGGCTGG + Intergenic
932616439 2:73234427-73234449 GGCCGGTGGCCGGCGCCGCTCGG + Intronic
934728109 2:96638139-96638161 GGCCGGCTGCCGGTGCTGGTCGG - Intronic
935265159 2:101387420-101387442 GGCCGGCGGCCGGCGCGGCCGGG - Exonic
937261135 2:120587376-120587398 TGCCCGCGGCCGGCGGAGGTGGG + Intergenic
938038138 2:128053515-128053537 CGGCGGCGGCGGGGGCGGGTAGG - Intergenic
941508424 2:166376083-166376105 CTCCTGCGGGCGGCGCAGGGCGG + Intergenic
948602455 2:239115191-239115213 CCCCGGCAGCCGGTCCAGGTAGG + Exonic
1169164217 20:3408012-3408034 CGCTGGAGGCCGGGGCTGGTCGG - Intergenic
1169204543 20:3732535-3732557 CGGCGGAGGCCCGCGCAGGCAGG + Intergenic
1171122431 20:22578505-22578527 GCCCGCCGGCCGCCGCAGGTAGG - Intergenic
1172118637 20:32585218-32585240 CGCGGGCGGCCGGGGGAGGCGGG + Intronic
1174359667 20:50020160-50020182 CAGCGGCGGCCAGGGCAGGTAGG + Intergenic
1175273163 20:57749085-57749107 CTCAGGCGGCCGGAGCACGTGGG - Intergenic
1175927115 20:62476303-62476325 CGGCGGGGGCCGGGGCAGGGAGG - Intergenic
1175962262 20:62643009-62643031 CAGCAGCGGCCGCCGCAGGTGGG - Exonic
1178992775 21:37368115-37368137 GGCCGGGCGCCGGCGAAGGTCGG + Intronic
1179243759 21:39612835-39612857 GGCCGGCGGGCCGCGCAGGGCGG - Intronic
1180086341 21:45509531-45509553 CGCCGGCCGCAGGTGCACGTAGG - Exonic
1180558971 22:16601137-16601159 CGCGGGCGCCCGGCGCAGCCCGG - Intergenic
1180960700 22:19761080-19761102 CCCCGGCGGCCGGCGCAAACGGG - Exonic
1181902720 22:26169469-26169491 CGCCCGCGCCCGGCGCAGCTCGG + Intronic
1182445462 22:30387152-30387174 AGCCGGCGGCCGGGGCGGGGCGG - Exonic
1183299468 22:37051814-37051836 CGCAGGCGGCTGGGGCAAGTGGG + Exonic
1183548504 22:38468024-38468046 GGGCGGCCGCCGGCGCAGGGTGG - Intergenic
1185047517 22:48536432-48536454 CACCGGGAGCCGGCGCGGGTGGG + Intronic
1185337155 22:50275854-50275876 CCCCGGGGGCGGGGGCAGGTGGG - Intronic
950549103 3:13655551-13655573 GGCAGGCGGCCGGCGCGGATGGG - Intergenic
954156092 3:48685634-48685656 CACCTGCAGGCGGCGCAGGTAGG + Exonic
955911599 3:63864018-63864040 CGGCCGCGGCCGGCGCGAGTTGG + Intergenic
960902224 3:122564434-122564456 CGGGGACGGCGGGCGCAGGTGGG - Exonic
966711825 3:182980177-182980199 TGCCGGGGCCCGGCGCGGGTGGG - Intronic
968674734 4:1871421-1871443 CGGCGGCGGCGGGCGCAGCGCGG - Intronic
970188192 4:13484392-13484414 GGCCGCCGGTCGGCGCGGGTTGG - Intergenic
972675760 4:41257752-41257774 TGCCGGCGGCCGGCGCATCCTGG - Intronic
975801068 4:78059115-78059137 CGGCGGCGGCGGGCGCAGGGCGG + Intronic
983904650 4:173169861-173169883 AGCCGGCAGCCGGCGCGGGGCGG - Intronic
984639401 4:182144954-182144976 CTCCGGCCGCCGGCTCAGGTGGG + Intronic
988595418 5:32585954-32585976 CGGCGGCGGCCTGCCTAGGTGGG + Intronic
991587591 5:68215936-68215958 AGCCGGCGGGCGGGGTAGGTAGG + Exonic
997302277 5:132814331-132814353 CGACAGCTGCCGGCGCAGGCCGG - Exonic
998292196 5:140926514-140926536 CGCTGGCTGCGGGCGCAGGGCGG - Intronic
999758489 5:154682743-154682765 CTCCCGCGGCCGGCTGAGGTTGG - Intergenic
1002741286 5:181437225-181437247 GCCTGGCGGCCGGCGCACGTGGG - Intergenic
1002741382 5:181437633-181437655 GCCAGGCGGCCGGCGCACGTGGG - Intergenic
1003603665 6:7541478-7541500 CGCGGGCGGCGGGCGCAGGTGGG + Intergenic
1006319598 6:33312741-33312763 CGCCGGGTGTGGGCGCAGGTGGG + Intronic
1007630255 6:43269525-43269547 CGCCGGCGTCCCGGGCAAGTGGG - Intronic
1011517020 6:88166177-88166199 CGCCGGCGGTCGGAGCAGCGGGG - Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013514850 6:110875766-110875788 TGCCCGCGGCCGCCGCGGGTGGG - Intronic
1015525855 6:134175135-134175157 CGCCGGCGGAGGGCGCGGGGAGG + Intronic
1019246420 6:170712990-170713012 GCCTGGCGGCCGGCGCACGTGGG - Intergenic
1019666971 7:2256845-2256867 AGACGGCGGCCGGAGCAGGGCGG + Intronic
1020034938 7:4959085-4959107 CGGCGGCGGCAGCAGCAGGTTGG + Exonic
1020106235 7:5423496-5423518 CCCCGGCTCCCGGCGCAGCTAGG + Exonic
1020201262 7:6081678-6081700 GGACGGCGGCCTGCGGAGGTCGG + Intergenic
1021452776 7:20798056-20798078 CGCCCGCGGCCGCCGCAGCCCGG - Intergenic
1022363317 7:29684848-29684870 CGGCGGCGGCCGGCACCGGCCGG - Intergenic
1025829645 7:65038265-65038287 CGGCGGCGGCCGCGGCAGCTGGG + Intergenic
1026853649 7:73739312-73739334 TGCCGGGGGCCCGGGCAGGTTGG + Intergenic
1032345169 7:131110060-131110082 CGGCGGCGGCCGGAGCTGGAGGG + Intergenic
1034455497 7:151167808-151167830 CGGCGGCGGCGGGCGGAGGGAGG - Intronic
1035501623 8:94563-94585 GCCAGGCGGCCGGCGCACGTGGG + Intergenic
1035717208 8:1763664-1763686 CGACGGCGGCGGGCGCGGGAGGG - Intronic
1038484137 8:27921684-27921706 CGCCTGCGCCTGGCGCACGTAGG - Exonic
1041108942 8:54467462-54467484 CCCCGGCGTCGGGCGCAGCTGGG - Intergenic
1041690295 8:60680114-60680136 CGCCGGGGGTCAGCGCCGGTGGG + Intronic
1042155564 8:65841540-65841562 GGCCGGCGGCCGCGGCAGGGCGG - Exonic
1042617757 8:70669122-70669144 CGCCGGCGGGCGGCTGAGGCGGG - Exonic
1045269441 8:100649549-100649571 CACCGCCCGCCGCCGCAGGTCGG - Exonic
1049585464 8:143430695-143430717 GGCCGGCCGGCGGCGCGGGTGGG - Intergenic
1049812615 8:144582243-144582265 CCCTGGCGGCCGGCGCAGACTGG + Intronic
1050873971 9:10612891-10612913 AGCCGGCGGCCGGAGCGCGTGGG - Intergenic
1050873979 9:10612906-10612928 CGCCGGCTGCGGGCGCGGCTGGG + Intergenic
1056592514 9:87974762-87974784 CGCCGGGGGCGGGGGCAGATAGG - Intergenic
1060849265 9:126860889-126860911 GGCAGGCGGCCGGCGCGGGCGGG + Intronic
1061490018 9:130939452-130939474 CGTCGGGGTCCGGCGCAGGGAGG - Intergenic
1062452613 9:136621876-136621898 CAGCGCCGGCCGCCGCAGGTGGG + Intergenic
1062467316 9:136687019-136687041 GGCCGGCGGCAGGCACAGGAGGG - Intronic
1203607197 Un_KI270748v1:68441-68463 GCCTGGCGGCCGGCGCACGTGGG - Intergenic
1203607293 Un_KI270748v1:68849-68871 GCCAGGCGGCCGGCGCACGTGGG - Intergenic
1194977680 X:100410212-100410234 CGGCGGCGGCTGGCGCAGCGCGG - Exonic
1199724753 X:150568908-150568930 GGCCGGCGGCGGGCGAAGGTCGG + Intronic