ID: 1131260259

View in Genome Browser
Species Human (GRCh38)
Location 15:90884254-90884276
Sequence TGCGGGGCGCGGGCGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 243}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131260252_1131260259 -8 Left 1131260252 15:90884239-90884261 CCGGGCCCTGGGGCCTGCGGGGC 0: 1
1: 1
2: 8
3: 83
4: 673
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260233_1131260259 26 Left 1131260233 15:90884205-90884227 CCTTGCGCCCCTTCCCGGTGTTC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260237_1131260259 19 Left 1131260237 15:90884212-90884234 CCCCTTCCCGGTGTTCCCGGGGC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260241_1131260259 12 Left 1131260241 15:90884219-90884241 CCGGTGTTCCCGGGGCGCTGCCG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260240_1131260259 13 Left 1131260240 15:90884218-90884240 CCCGGTGTTCCCGGGGCGCTGCC 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260231_1131260259 30 Left 1131260231 15:90884201-90884223 CCCACCTTGCGCCCCTTCCCGGT 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260239_1131260259 17 Left 1131260239 15:90884214-90884236 CCTTCCCGGTGTTCCCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260238_1131260259 18 Left 1131260238 15:90884213-90884235 CCCTTCCCGGTGTTCCCGGGGCG 0: 1
1: 0
2: 1
3: 3
4: 64
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260244_1131260259 4 Left 1131260244 15:90884227-90884249 CCCGGGGCGCTGCCGGGCCCTGG 0: 1
1: 0
2: 2
3: 59
4: 464
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260246_1131260259 3 Left 1131260246 15:90884228-90884250 CCGGGGCGCTGCCGGGCCCTGGG 0: 1
1: 0
2: 6
3: 54
4: 563
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243
1131260232_1131260259 29 Left 1131260232 15:90884202-90884224 CCACCTTGCGCCCCTTCCCGGTG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131260259 Original CRISPR TGCGGGGCGCGGGCGGCTCT TGG Intronic