ID: 1131260364

View in Genome Browser
Species Human (GRCh38)
Location 15:90884563-90884585
Sequence CCAGCTCCCACCGCTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 438}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131260364_1131260371 -7 Left 1131260364 15:90884563-90884585 CCTGGAGGAGCGGTGGGAGCTGG 0: 1
1: 0
2: 3
3: 54
4: 438
Right 1131260371 15:90884579-90884601 GAGCTGGGGGCGCGGCAGGCAGG 0: 1
1: 0
2: 11
3: 85
4: 699
1131260364_1131260376 15 Left 1131260364 15:90884563-90884585 CCTGGAGGAGCGGTGGGAGCTGG 0: 1
1: 0
2: 3
3: 54
4: 438
Right 1131260376 15:90884601-90884623 GGGCAGAGCAGGCGTTCCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 104
1131260364_1131260373 -5 Left 1131260364 15:90884563-90884585 CCTGGAGGAGCGGTGGGAGCTGG 0: 1
1: 0
2: 3
3: 54
4: 438
Right 1131260373 15:90884581-90884603 GCTGGGGGCGCGGCAGGCAGGGG 0: 1
1: 0
2: 8
3: 129
4: 852
1131260364_1131260372 -6 Left 1131260364 15:90884563-90884585 CCTGGAGGAGCGGTGGGAGCTGG 0: 1
1: 0
2: 3
3: 54
4: 438
Right 1131260372 15:90884580-90884602 AGCTGGGGGCGCGGCAGGCAGGG 0: 1
1: 0
2: 5
3: 54
4: 565
1131260364_1131260375 14 Left 1131260364 15:90884563-90884585 CCTGGAGGAGCGGTGGGAGCTGG 0: 1
1: 0
2: 3
3: 54
4: 438
Right 1131260375 15:90884600-90884622 GGGGCAGAGCAGGCGTTCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 175
1131260364_1131260374 4 Left 1131260364 15:90884563-90884585 CCTGGAGGAGCGGTGGGAGCTGG 0: 1
1: 0
2: 3
3: 54
4: 438
Right 1131260374 15:90884590-90884612 GCGGCAGGCAGGGGCAGAGCAGG 0: 1
1: 0
2: 6
3: 108
4: 992

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131260364 Original CRISPR CCAGCTCCCACCGCTCCTCC AGG (reversed) Intronic
900173466 1:1281642-1281664 CCACCCCCCTCCCCTCCTCCCGG - Intronic
900191435 1:1353890-1353912 CCAGCTCCGCCCTCTCCTTCAGG + Exonic
900245367 1:1633878-1633900 GCAGCCCCCACAGCTCGTCCTGG - Exonic
900255766 1:1697658-1697680 CCAAGTCCCACGGCTCCTGCGGG - Intronic
900256598 1:1701037-1701059 GCAGCCCCCACAGCTCGTCCTGG - Intronic
900438547 1:2642501-2642523 CCTGCCCCCCCCACTCCTCCCGG + Intronic
900438851 1:2643525-2643547 CCAGCACAGACCCCTCCTCCTGG + Intronic
900601045 1:3502726-3502748 CCAGCACCCACGGCTCTGCCAGG - Intronic
900890620 1:5447235-5447257 CCAGTTTGCACTGCTCCTCCAGG + Intergenic
901226083 1:7613743-7613765 CCTGCTCCCCCTACTCCTCCGGG - Intronic
901593337 1:10365200-10365222 CCAGCTCCCACTGGTGCTCAAGG - Exonic
902232143 1:15034925-15034947 CCAGCTCCCACCTCCCCTGCTGG + Intronic
902836930 1:19053530-19053552 CCAGCCCCCAGCCCTCCTGCCGG + Intergenic
903016602 1:20365999-20366021 CCATCTCTCCACGCTCCTCCAGG + Intergenic
903888498 1:26554961-26554983 CGCGCCCCCACCGCTGCTCCTGG + Intronic
904619375 1:31766169-31766191 CCAGCCCCCTCCTCTCCTACAGG + Intergenic
904753170 1:32753894-32753916 CCAGGCCCCGCCCCTCCTCCGGG + Intronic
905643678 1:39609796-39609818 CCTGCAGCCCCCGCTCCTCCCGG - Intergenic
905753726 1:40489126-40489148 CCAGCTGCCCCCACTCTTCCTGG - Exonic
905797565 1:40824154-40824176 CCGGCGCCCGCCGCACCTCCAGG - Exonic
906549636 1:46653170-46653192 TAAGCTCCCACCCCTCCTTCAGG + Intronic
906608568 1:47187308-47187330 GCAGCACTCACGGCTCCTCCTGG + Exonic
906901568 1:49842203-49842225 CCAGCTGCCTCCACTCCTCCTGG - Intronic
907268181 1:53275360-53275382 CCAGCCCCCACCACTTGTCCAGG - Intronic
912736601 1:112154503-112154525 CCAACTCCCTCCCCTCCTTCAGG - Intergenic
913473938 1:119218430-119218452 CCAGCTCTTCCCCCTCCTCCTGG + Intergenic
915530213 1:156498919-156498941 CCAGCTCCCACGGCCCTGCCTGG - Intronic
915722824 1:157996496-157996518 CCAGCCCCCAGAGCTCCCCCTGG + Intronic
915727774 1:158030913-158030935 CCAGCTCCATCTGCTCATCCTGG + Intronic
915735877 1:158084591-158084613 CCAGCTCCCCCAGCTCCTCCTGG + Intronic
918068040 1:181114785-181114807 CCAGCTACAGCAGCTCCTCCTGG - Intergenic
919745186 1:201004359-201004381 CAAGCTCACTCGGCTCCTCCAGG - Exonic
919914977 1:202133670-202133692 CCAGCTCCCGCCCCTCCCCAGGG - Exonic
920646389 1:207807166-207807188 CCAGCTCCCCCACCTCCCCCAGG + Intergenic
923108100 1:230869197-230869219 TCAGCTCCCGCCGCCCCTCGGGG + Intronic
923191755 1:231626834-231626856 CCAGCTCCTCCCGCTCCGCCTGG - Exonic
923400752 1:233614021-233614043 CCCGCCCGCCCCGCTCCTCCGGG - Exonic
924272607 1:242349382-242349404 CCAGCTCCCACTTCTCATCATGG + Intronic
1062886382 10:1019654-1019676 GCAGCTCCCACAGCTCCTCCTGG + Exonic
1062949014 10:1482513-1482535 CGAACTCCCACTTCTCCTCCTGG - Intronic
1063449624 10:6142812-6142834 CCAGCTCCCAGCCCCCATCCTGG + Intergenic
1064768464 10:18698751-18698773 CCCTCCCCCACCCCTCCTCCTGG + Intergenic
1065549844 10:26860108-26860130 CCCGCTTCCTCCTCTCCTCCGGG + Intronic
1066048961 10:31618180-31618202 CCACCTCCCACCCTTCCTGCAGG + Intergenic
1067061958 10:43082196-43082218 CTTGTTCCCACAGCTCCTCCTGG + Intronic
1067123579 10:43496054-43496076 CCAGATGCTACCACTCCTCCTGG - Intergenic
1067529804 10:47061929-47061951 CCATCTCCTTCCCCTCCTCCAGG + Intergenic
1069900163 10:71702369-71702391 CCAGCTCCCTCCGTTCCCTCAGG - Intronic
1069960019 10:72073995-72074017 CCAGCTCCCAGAGCCCCTCCTGG - Intronic
1070724467 10:78778783-78778805 CCAGCTCCCATCTGTCCTCCTGG - Intergenic
1070822049 10:79363145-79363167 CAAGCGCCCACCACTACTCCCGG - Intergenic
1071360260 10:84839381-84839403 CCAGCCTCCACCTCTCCACCCGG + Intergenic
1071598243 10:86943199-86943221 CCAGCTGCCGCCGCTCGTCCAGG + Exonic
1071731587 10:88253791-88253813 CCCCCTCCCTCCCCTCCTCCTGG + Intergenic
1071857874 10:89644696-89644718 CCAGCGCCTCCCGCTCCTGCCGG - Exonic
1074483828 10:113854183-113854205 CCAGCTGCATCCGCTCCTCCCGG + Intronic
1074569970 10:114615365-114615387 CCAGCTCCCTCTCCTCCTTCTGG + Intronic
1074878457 10:117632607-117632629 CCTCCACCCATCGCTCCTCCAGG + Intergenic
1075264642 10:120990134-120990156 CCCGCTCCCCCCTCCCCTCCTGG + Intergenic
1075635439 10:124027254-124027276 TCCCATCCCACCGCTCCTCCAGG - Intronic
1076298702 10:129407275-129407297 CAACCTTCCACCTCTCCTCCAGG + Intergenic
1076330066 10:129657624-129657646 CCAGCTCCAGCTCCTCCTCCAGG - Intronic
1076673264 10:132134652-132134674 CCAGCTCCCAGCCCTCTGCCTGG - Intronic
1076848265 10:133080567-133080589 CCAGCCCCCACCGCACCCCTCGG - Intronic
1077111255 11:863188-863210 CCAGCCCCCACCTCGCCTCGGGG + Intronic
1077112947 11:869932-869954 CCAGCTCCAGCCGCACCTGCAGG + Exonic
1077384306 11:2261798-2261820 CCAGCTCCCAGCACCCCACCGGG + Intergenic
1077435143 11:2535342-2535364 TCAGCTGCCAAGGCTCCTCCCGG + Intronic
1077533294 11:3107259-3107281 TCACCTCCCCCAGCTCCTCCTGG + Exonic
1077698961 11:4422098-4422120 CCAGCTACCAACGCTTGTCCTGG + Intergenic
1078519803 11:12053732-12053754 CCACCCCCCACAGCCCCTCCAGG - Intergenic
1078712663 11:13809972-13809994 CCAGCTCCCTCACCTCCTTCAGG - Intergenic
1078856523 11:15209872-15209894 CCAACTCCCACCCCTCATCAGGG - Intronic
1080036507 11:27718352-27718374 CCACCCCCCCCCGCCCCTCCCGG + Intronic
1080588263 11:33700308-33700330 CCAGCTCGCAGAGCTCCTCCGGG + Exonic
1081253317 11:40861963-40861985 CCAGGTCCCACCTCTCCTATGGG + Intronic
1081567342 11:44268213-44268235 CCAGCTCCTGTCCCTCCTCCAGG - Intronic
1081634527 11:44712094-44712116 CCGGCTCCCAGCCCTACTCCAGG + Intergenic
1081640936 11:44753821-44753843 GCAGCTCCCACCTCTCATGCAGG + Intronic
1081705523 11:45180535-45180557 CCCTCTCCCACCGCCCCGCCCGG + Intronic
1081810941 11:45913883-45913905 GCAGCTCCCGCCGCTCCCTCCGG + Exonic
1081851461 11:46277836-46277858 CCACCTCCTCCTGCTCCTCCTGG - Exonic
1083597365 11:63924597-63924619 CCTTCTCCCACTGCCCCTCCTGG + Intergenic
1083639365 11:64136910-64136932 CCAGCCCTCCCCGCTGCTCCCGG - Intronic
1083661258 11:64252612-64252634 CCAGCTCCCACGCCTACCCCGGG - Intronic
1083737316 11:64688826-64688848 CCAGCTCCCAGACCTCCTCTGGG + Intronic
1083822764 11:65182115-65182137 CCAGCCCCCACCCCTGCTCCAGG - Intronic
1084214107 11:67638484-67638506 CCAGCACCCCCCTCTGCTCCAGG - Intronic
1084308678 11:68303011-68303033 TCAGCTGCCTCCGCTCCTCAAGG - Intergenic
1085468262 11:76738864-76738886 CCAGCTCTCATCTTTCCTCCAGG - Intergenic
1085642416 11:78200718-78200740 CCAGCTCCGCCAGCTGCTCCAGG - Exonic
1088590042 11:111395375-111395397 CCTGCTCCCATCCCTGCTCCCGG + Intronic
1088619861 11:111671028-111671050 TCAGCTGCCCCAGCTCCTCCAGG - Intronic
1088630102 11:111766309-111766331 CCATCTCCACCCGCTGCTCCTGG + Exonic
1088757292 11:112896315-112896337 CCACCTCCCACTCCTGCTCCTGG + Intergenic
1089654186 11:119935134-119935156 CCAGCTTCCACCTATCCTCAGGG + Intergenic
1089757411 11:120696731-120696753 TCAGCTCCCACCTCTCCCTCCGG - Intronic
1090406635 11:126479703-126479725 CCTGCTCCCTTCGCTCCCCCGGG + Intronic
1091593631 12:1860255-1860277 CCAGCCCCCACCTCGCCCCCAGG + Intronic
1091779042 12:3202311-3202333 CCTGCCCCCAGTGCTCCTCCTGG - Intronic
1092241907 12:6840726-6840748 CCTGCCCCCAACCCTCCTCCCGG + Intronic
1092282759 12:7109802-7109824 CCTGCTCTCACCGCTCCCCGAGG + Intergenic
1094473506 12:30824063-30824085 GCACCTCGCACAGCTCCTCCCGG + Intergenic
1096242791 12:49968185-49968207 CCAGGTCTCTCCGCTCCTCTTGG + Intronic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1097450663 12:59733723-59733745 CAAGCTCCCATCTCACCTCCAGG + Intronic
1098143434 12:67474047-67474069 CCAACTCCTACTGCTCCTCCAGG - Intergenic
1098331171 12:69355066-69355088 CCAGCTGAAACTGCTCCTCCAGG + Intergenic
1098981720 12:76963257-76963279 GCAGCTCCTACCACTCATCCTGG + Intergenic
1101698125 12:107146022-107146044 CCACCTTCCACCTCTTCTCCAGG + Intergenic
1102149377 12:110678210-110678232 CCAGCTCCCCCTCCTCCTGCGGG + Intronic
1103488283 12:121297018-121297040 CCAGCCGCCTCCGATCCTCCCGG - Intronic
1103918099 12:124386250-124386272 CCAGGCCCCACCTCTCCTGCTGG + Intronic
1103942152 12:124506939-124506961 CCAGGTCCCACCGCCTCTCCAGG - Intronic
1103963447 12:124623362-124623384 CCCCGTCCCACCTCTCCTCCAGG - Intergenic
1104641668 12:130471137-130471159 CCAGCCCCGGCCCCTCCTCCAGG - Intronic
1104807053 12:131596359-131596381 CCAAGTCCCATCGCTCTTCCTGG + Intergenic
1105241471 13:18612583-18612605 CCTGCCCCAACCCCTCCTCCTGG + Intergenic
1105851555 13:24340290-24340312 CCAGCTCCTCCCGCTGCTACCGG - Intergenic
1106387305 13:29300387-29300409 CAAGCTCCCATAGCTCCTCAAGG - Intronic
1107935408 13:45341522-45341544 CCAGCTCCCAGCACCTCTCCAGG - Intergenic
1111072219 13:83184039-83184061 CCTGCTCCCACCCCTGCTCCAGG - Intergenic
1113037767 13:106070091-106070113 CCTGCCCCCACATCTCCTCCAGG + Intergenic
1113677074 13:112214784-112214806 CCATCTCCCTCCTCCCCTCCAGG - Intergenic
1113677109 13:112214895-112214917 CCATCTCCCTCCTCCCCTCCAGG - Intergenic
1113812890 13:113153210-113153232 CCCGCTCCCGCCCGTCCTCCTGG - Intergenic
1113877161 13:113601644-113601666 CGAGCTCCCACGAGTCCTCCTGG - Intronic
1116916591 14:50532073-50532095 CCAGCTCACCCCGCGGCTCCCGG + Exonic
1117081500 14:52156819-52156841 CCACCTGCCACCGCTCTACCTGG - Intergenic
1118480294 14:66158169-66158191 TCAGCTCCCACCTCCTCTCCTGG + Intergenic
1119176690 14:72573713-72573735 CCAGCTCCAACCCCTTCTGCTGG + Intergenic
1119262440 14:73245726-73245748 CCAGCTTCCCCAGCCCCTCCTGG + Intronic
1119787402 14:77323813-77323835 CCACCTCCCAGCAGTCCTCCGGG - Intronic
1120747594 14:88166098-88166120 CCAGCTCCCAAATCTCCCCCAGG + Intergenic
1121109562 14:91303315-91303337 CCAGGCTCCACCTCTCCTCCAGG + Intronic
1121109623 14:91303502-91303524 CCAGGCCCCACCCCTCCTCCAGG + Intronic
1121232105 14:92365520-92365542 CCAGCACCCGGGGCTCCTCCTGG - Intronic
1121473570 14:94174663-94174685 CCACCACCCTCCCCTCCTCCGGG + Intronic
1122271493 14:100570315-100570337 CCAGCCCCCACTGCTCCACCAGG - Intronic
1122478545 14:102029631-102029653 CCAGCTCGCTCCGCTTCTCGTGG - Exonic
1122534462 14:102452518-102452540 CCAGCGCCCACAGCGCATCCTGG - Exonic
1122620660 14:103056397-103056419 CCAGCTCTAACGGCCCCTCCTGG - Intronic
1123047738 14:105526912-105526934 CCCCCTCCCGCCCCTCCTCCCGG + Intronic
1123062046 14:105598819-105598841 CCAGATCCAAACGCTCCCCCCGG - Intergenic
1123062298 14:105599801-105599823 CCTCCTCCCACCGCCTCTCCTGG + Intergenic
1123062314 14:105599843-105599865 CCTCCTCCCACTGCCCCTCCTGG + Intergenic
1123086789 14:105720550-105720572 CCAGATCCAAACGCTCCCCCCGG - Intergenic
1123087056 14:105721571-105721593 CCTCCTCCCACTGCCCCTCCTGG + Intergenic
1123489884 15:20772566-20772588 CCTGCCCCAACCCCTCCTCCTGG - Intergenic
1123546383 15:21341653-21341675 CCTGCCCCAACCCCTCCTCCTGG - Intergenic
1123762059 15:23440887-23440909 CCTGCCCCCACATCTCCTCCTGG + Exonic
1124513533 15:30347724-30347746 CCAGCTCCCACTGCCACACCTGG + Intergenic
1124584245 15:30991168-30991190 CCAGCTCCCAAGGCTCCCCTGGG + Intronic
1124729388 15:32183041-32183063 CCAGCTCCCACTGCCACACCTGG - Intergenic
1125395727 15:39245524-39245546 CCACCTCCTACCCCTCCTCTTGG + Intergenic
1125609354 15:40960316-40960338 CCAGCTCCTGCCTTTCCTCCAGG - Intergenic
1125726006 15:41868451-41868473 CCTGCTGCCACAGCTTCTCCCGG + Exonic
1126499998 15:49335043-49335065 CCAGCTGCCACCCCAGCTCCAGG + Intronic
1127313156 15:57770214-57770236 CCAACTCCCACTGGTCCTCTGGG + Intronic
1128457170 15:67837993-67838015 CCATCACCCTCCTCTCCTCCAGG + Intergenic
1128706110 15:69838433-69838455 CCAGCTCCCACCCCTAACCCTGG + Intergenic
1129182832 15:73887754-73887776 CAAGCTACCACCCCTGCTCCTGG + Intronic
1129523203 15:76198577-76198599 CCAGCCTCCACCCCTACTCCAGG - Intronic
1129941976 15:79506042-79506064 CCAGCTCCCTTCTCTCTTCCAGG + Intergenic
1130613351 15:85380901-85380923 GCAGCCCCCGCCCCTCCTCCGGG - Intronic
1130911593 15:88274759-88274781 CCAGCTGCCACCTCTCCCCCAGG + Intergenic
1130985570 15:88842534-88842556 ACAGTGCCCACAGCTCCTCCAGG + Intronic
1131157679 15:90085023-90085045 CCAGCTTCCCCCGGTGCTCCAGG + Exonic
1131160591 15:90102429-90102451 CGAGCGCGCGCCGCTCCTCCCGG + Exonic
1131260364 15:90884563-90884585 CCAGCTCCCACCGCTCCTCCAGG - Intronic
1132150038 15:99452742-99452764 CCACCTCCCACCTCACCACCTGG + Intergenic
1202954710 15_KI270727v1_random:68868-68890 CCTGCCCCAACCCCTCCTCCTGG - Intergenic
1132623765 16:880340-880362 CAAGTTCCCACCCTTCCTCCTGG - Intronic
1132643872 16:989988-990010 ACAGCTCCCACAGCCCATCCTGG - Intergenic
1132747952 16:1444757-1444779 CCTGCTCCCAGCGTCCCTCCCGG - Intergenic
1132881580 16:2163940-2163962 CCCGCTACAACCGCTTCTCCGGG + Exonic
1132887645 16:2189614-2189636 CCAGCACCCCCCTATCCTCCAGG - Intronic
1133014706 16:2933983-2934005 CCAGCTCCCAGCCCACCCCCAGG - Intronic
1134090258 16:11387764-11387786 CCAGCGCCCACCGCAACACCCGG + Intronic
1134411320 16:14004881-14004903 CCAGCTCCCATCTGTCCACCTGG + Intergenic
1134666616 16:16023619-16023641 CCACCTTCCATCTCTCCTCCAGG - Intronic
1136110817 16:28062947-28062969 CCAGCTCCCAGCGCTCCGCCTGG - Intronic
1136399638 16:30010518-30010540 CCAGCTCCTTCCTCTCCTCCGGG + Intronic
1136403889 16:30032181-30032203 TCAGGTCCCACAGCTCCACCCGG - Intronic
1136611795 16:31371091-31371113 CGGGCTCCCAGCTCTCCTCCAGG + Exonic
1136618493 16:31412845-31412867 CCAGCTCCCAGCTCTCCCCCAGG + Exonic
1138343525 16:56306387-56306409 CAAGCTGCCCCCGCTCCTTCAGG + Intronic
1138497363 16:57416521-57416543 CCAGCTGGCCCGGCTCCTCCTGG + Intergenic
1139466476 16:67156650-67156672 CCAGCTGCCATCTCACCTCCTGG + Exonic
1139664869 16:68448387-68448409 GCAGCGCACCCCGCTCCTCCCGG + Exonic
1140376301 16:74447990-74448012 CCCGCTCCCTCTGCTCCACCAGG - Intergenic
1141064476 16:80902762-80902784 ACAGCTCCCACCCAGCCTCCTGG + Intergenic
1141211836 16:81988092-81988114 CCAGCTCCCACCCCTACCCCAGG - Intergenic
1141693060 16:85607250-85607272 CCAGCTCCTGCCTCTCCTACTGG - Intergenic
1142589560 17:996592-996614 CCACCTCTCACCGCACCTTCCGG + Intergenic
1143417221 17:6758855-6758877 CCAGATCCCATCTCTCCTGCAGG - Intronic
1143514955 17:7414891-7414913 CCAACTCCCCCCTCTCCTTCAGG + Intronic
1144573677 17:16416024-16416046 CCAGCCCCCACCCCACCTCCTGG - Intronic
1145041034 17:19578858-19578880 CCAGCTCCCAACACCCTTCCTGG + Exonic
1146793189 17:35764438-35764460 CCAGCACGCACGGCTCCTCCGGG - Exonic
1146915067 17:36673118-36673140 CCAGCCCCAGCCACTCCTCCAGG - Intergenic
1147044228 17:37741966-37741988 CCAGCTCTCCCGGCTCTTCCCGG - Intronic
1147326069 17:39670188-39670210 CCAGGTACCACGACTCCTCCAGG - Exonic
1147820411 17:43238228-43238250 CCAGCGTCCACCCATCCTCCTGG + Intergenic
1147822523 17:43250120-43250142 CCAGCGTCCACCCATCCTCCTGG + Intergenic
1147823456 17:43255573-43255595 CCAGCGTCCACCCATCCTCCTGG + Intergenic
1147825040 17:43264915-43264937 CCAGCGTCCACCCATCCTCCTGG + Intergenic
1147828160 17:43282435-43282457 CCAGCGTCCACCCATCCTCCTGG + Intergenic
1147829270 17:43288599-43288621 CCAGCGTCCACCCATCCTCCTGG + Intergenic
1148582197 17:48751987-48752009 CCAGCCCCCACCCTTCCTTCAGG - Intergenic
1148816594 17:50332381-50332403 CAAGGTCCCTTCGCTCCTCCAGG - Intergenic
1149459143 17:56813115-56813137 CCAGCTCCCCCAGCCCCTGCCGG + Intronic
1150216838 17:63476019-63476041 CCACCTCCCACTGCGCCGCCGGG + Intergenic
1151766956 17:76137712-76137734 CCAGCTCACCCTGCTCCTCCGGG + Exonic
1152046792 17:77942010-77942032 CCAGCTCCCACGGCTACTTGTGG - Intergenic
1152162031 17:78674869-78674891 CCAGCTCACACAGCGCCTGCAGG + Exonic
1152285698 17:79411489-79411511 CCTTCTCCCACCTCCCCTCCAGG + Intronic
1152559426 17:81070600-81070622 CCAGCTCCCACAGCTGCAGCGGG - Intronic
1152686572 17:81696612-81696634 CCAGCTGCCTCTGCACCTCCAGG - Exonic
1152974172 18:197208-197230 CCAGCTCCCTCACCTCCTTCAGG + Intronic
1153525619 18:5992215-5992237 CCAGCTCAAACCTCCCCTCCCGG - Intronic
1154416306 18:14177772-14177794 CCCGCCCCCACCGCTGCTGCGGG - Intergenic
1156975753 18:43219978-43220000 CCTGCTTCCACAGCTCCCCCAGG + Intergenic
1157856580 18:51110318-51110340 CCAGCTCCCTCCGCCCCACAAGG - Intergenic
1158557220 18:58485460-58485482 CCAGCTGCCCCTCCTCCTCCTGG + Intronic
1160196262 18:76758182-76758204 CCAGGTCCCCCTGCTCCTCTCGG + Intergenic
1160217703 18:76947526-76947548 GCAGTTCCCAGCGCTCCTCACGG + Exonic
1160878425 19:1308590-1308612 CCAGCTCCGACTGCCCCGCCGGG + Intergenic
1160908772 19:1465278-1465300 CCAGGTCCCACAGCAGCTCCTGG - Exonic
1161298857 19:3533156-3533178 CCAGCATCCCCTGCTCCTCCTGG + Intronic
1161417115 19:4153576-4153598 GCAGCTCCCAGCCCACCTCCAGG - Intergenic
1161581831 19:5085437-5085459 TCAGCTCCGACAGCACCTCCAGG - Intronic
1161593228 19:5138049-5138071 CCAGCTTCCACCGCTGCTCGGGG - Exonic
1161668472 19:5590896-5590918 CCACCTCCCACCTCTCCACCAGG + Intronic
1161781998 19:6299025-6299047 CCAGCACCCTCCCCTGCTCCTGG - Intergenic
1161978730 19:7619822-7619844 CCAGCTCTGCCAGCTCCTCCCGG + Exonic
1162021150 19:7869211-7869233 CCACCACCCTCCGCACCTCCTGG + Exonic
1162588503 19:11576212-11576234 CCAGCTCCCACCCCACCCACAGG + Intronic
1162902839 19:13805543-13805565 CCAGCCCTCACCACGCCTCCTGG - Intronic
1163008237 19:14409525-14409547 CTCGCACTCACCGCTCCTCCTGG + Exonic
1163442939 19:17330660-17330682 CCAACTTCCACCTCTCCCCCTGG + Intronic
1163484365 19:17577287-17577309 CCAGCCCCCGCCCCGCCTCCAGG - Intronic
1163509148 19:17725108-17725130 GCAGCTCCCCCGTCTCCTCCAGG - Exonic
1163581493 19:18141953-18141975 TGCGCTCCCACCCCTCCTCCCGG - Exonic
1164157360 19:22604749-22604771 CCAGCACTCACTTCTCCTCCTGG - Intergenic
1164648083 19:29873553-29873575 CCTCCTCCCTCCGCTCCCCCGGG - Intergenic
1164803613 19:31098799-31098821 GCAGCTCCAACTGCTCCTCTGGG - Intergenic
1165058889 19:33195235-33195257 CCAGCCCCCACCCCAACTCCGGG - Intronic
1165430030 19:35767229-35767251 CCAGCTCCCACGGGTTCTTCTGG + Intronic
1165782322 19:38441690-38441712 CCAGCCCCTGCCCCTCCTCCAGG - Intronic
1166853577 19:45771521-45771543 CCACCTCCTCCCGGTCCTCCGGG + Intronic
1167071922 19:47226778-47226800 TCAGCACCCACCACCCCTCCAGG + Intronic
1167295117 19:48645307-48645329 CCAGCTCCCTCCTCCCCCCCAGG - Intronic
1167587815 19:50384640-50384662 CCAGTCCCCCCAGCTCCTCCCGG - Intronic
1167600311 19:50451123-50451145 CCAGGAGCCACCCCTCCTCCCGG - Intronic
1167649371 19:50721092-50721114 CCAGCTCCAACAGCACCTCCAGG + Intergenic
1167709910 19:51104236-51104258 GCAGCTCCCAGCGCGCCGCCTGG + Exonic
1167728463 19:51235319-51235341 CCAGCCCTCACAGCCCCTCCAGG - Intronic
1168152421 19:54456197-54456219 CCCGCTCCCGCTCCTCCTCCAGG + Exonic
1168322200 19:55517301-55517323 CCAGGTCCCTCCGCCTCTCCGGG + Exonic
1168467349 19:56613850-56613872 CCAGCTGCTGCCACTCCTCCTGG - Intronic
1168545133 19:57243961-57243983 CCAGCTGGCCCCACTCCTCCTGG - Exonic
1168549958 19:57284589-57284611 CCAACTGCCCCCACTCCTCCTGG - Exonic
1168581093 19:57556297-57556319 CCAGCTGTCTCCACTCCTCCCGG + Exonic
1168646398 19:58061618-58061640 TCAGCTGCCCCCACTCCTCCTGG - Exonic
1168666990 19:58211598-58211620 CCAGCAGCCCCCACTCCTCCCGG - Exonic
1168676975 19:58285755-58285777 CCAGCTGCCCCCATTCCTCCTGG - Exonic
925010525 2:481766-481788 TCAGCTCCCACCCCTGCTGCTGG + Intergenic
925412897 2:3650280-3650302 GGAGCTCCCACTGCTCCTCCTGG + Intergenic
925466206 2:4108961-4108983 CCAGCTCTCAAGGCTCCACCGGG + Intergenic
925947330 2:8877891-8877913 CCTGCTCCCACCTCTTCCCCCGG - Intronic
926276070 2:11404081-11404103 CCCGCTCTCTCTGCTCCTCCAGG + Intergenic
927639962 2:24840083-24840105 CCAGCTGCCCCTGCTCCTGCAGG + Intronic
927946810 2:27139603-27139625 CCAGCCCCCACCTCTACTCTTGG + Intergenic
928396676 2:30947975-30947997 CCAGCTGCCACAGTTCCTCTGGG + Intronic
929578113 2:43065336-43065358 GCAGCTCCCAAGGCTACTCCAGG + Intergenic
929699654 2:44150988-44151010 CCTGCTCCCACAGCTCCACTAGG - Intergenic
930011508 2:46941339-46941361 GCAGCTCCCAGCGCACCGCCCGG - Exonic
930017187 2:46979018-46979040 CCAGTTCCCACCAATCCTCTTGG - Intronic
930762336 2:55050135-55050157 CCAGCACCTCCAGCTCCTCCAGG + Exonic
932423582 2:71615286-71615308 CCAGCTCCCACCAGTGCTGCTGG - Intronic
932449536 2:71800689-71800711 CCACCTCCCAACTCTGCTCCGGG + Intergenic
932568583 2:72924755-72924777 CCGGCTCCCAAAGCTCCTCACGG + Intronic
932734952 2:74247998-74248020 GCAGCTCCCATCACTACTCCAGG - Intronic
934543636 2:95196520-95196542 CCAGCTGCCACGGCTGCGCCTGG - Intergenic
934566926 2:95346457-95346479 CCGGCTCCCTCCGCCCTTCCCGG + Intronic
935132462 2:100270901-100270923 CCAGCTCCAACCCCCACTCCTGG + Intergenic
935217836 2:100988749-100988771 CAGGCCCCCACTGCTCCTCCAGG + Intronic
935217843 2:100988767-100988789 CCAGGTCTCCCTGCTCCTCCAGG + Intronic
935217855 2:100988804-100988826 CCAGGTCTCCCTGCTCCTCCAGG + Intronic
935217860 2:100988822-100988844 CCAGGTCCCCCTGCTCCTCCAGG + Intronic
935217867 2:100988841-100988863 CAGGCCCCCACTGCTCCTCCAGG + Intronic
935217894 2:100988915-100988937 CCAGGTCCCCCTGCTCCTCCAGG + Intronic
935217914 2:100988970-100988992 CCAGGCCCCCCTGCTCCTCCAGG + Intronic
935217922 2:100988989-100989011 CAGGCCCCCACTGCTCCTCCAGG + Intronic
935625361 2:105168230-105168252 TCAGCACCCAGCCCTCCTCCAGG + Intergenic
936343383 2:111657122-111657144 CCATCACCCACCGCTGCTCCCGG + Intergenic
936566143 2:113584044-113584066 CCACCTCCGCCCGCGCCTCCGGG - Intergenic
937510873 2:122593756-122593778 CCAGCACACACCACTCCACCTGG + Intergenic
937953965 2:127408679-127408701 CCACCACCCCCAGCTCCTCCTGG + Intergenic
938778166 2:134560095-134560117 CCTGCTCCCTCCCCTCCTTCAGG + Intronic
939322833 2:140646556-140646578 CCAGCTGCCTCCTCTACTCCAGG + Intronic
941164940 2:162074300-162074322 CCCTCCCCCACGGCTCCTCCGGG - Exonic
941476091 2:165953597-165953619 CGAGCTCCCTCCGCGCCCCCGGG + Intronic
941812442 2:169768197-169768219 CCGACTCCTACCGCTTCTCCAGG - Intronic
942222116 2:173780513-173780535 CAAGGTCCCACCCCTCCCCCGGG - Intergenic
943280439 2:185925303-185925325 CAAGCGCCCACCGCTGCGCCCGG + Intergenic
943524864 2:189003997-189004019 CCAGGTCCCAGCGGTTCTCCAGG + Exonic
944428059 2:199604098-199604120 CCGCCTCCCACCGCGCCTCCCGG + Intergenic
946178332 2:217935434-217935456 CCAGCCCCCACCCCTCACCCTGG + Intronic
946200411 2:218068080-218068102 CCAGCCCCCTGCCCTCCTCCAGG - Intronic
946239367 2:218344587-218344609 CCTGCCCACACAGCTCCTCCTGG - Intronic
946332750 2:219019473-219019495 CCAGCCCCCACCCCCACTCCAGG + Intronic
946407956 2:219502125-219502147 CCAGCTCCCACACCAACTCCCGG - Intronic
948046742 2:234951619-234951641 CCATCTCCCACCCCTTCTCCGGG - Intergenic
948265347 2:236631927-236631949 CCAGCTCCTTCCGATCCTTCTGG - Intergenic
948408251 2:237739260-237739282 CCAGCTCCCGCGCCTCCTCCAGG + Intronic
948727422 2:239943708-239943730 TCAGCACCGACCGCCCCTCCTGG + Intronic
948810175 2:240470989-240471011 CCAGCTCCCAGCCCTCACCCAGG - Intergenic
1171405235 20:24908335-24908357 CCACCTCCCACCCCTCCAACAGG - Intergenic
1172183940 20:33019949-33019971 CCAGCTCCCCCTCCTCTTCCAGG + Intronic
1172764991 20:37346370-37346392 CCAATTCCCACCCCCCCTCCGGG + Intronic
1174148918 20:48472397-48472419 ACAGCACCACCCGCTCCTCCGGG + Intergenic
1175750713 20:61495343-61495365 CTCCCTCCCACAGCTCCTCCTGG - Intronic
1175830857 20:61965086-61965108 CCAGCACCGACCGCATCTCCAGG - Intronic
1175872791 20:62216408-62216430 CCAGCTCCGGCAGCTCCTCGAGG - Exonic
1175979179 20:62728370-62728392 CCAGCTCCACCCCCTCCTCAGGG - Intronic
1176041504 20:63068347-63068369 CCAGCTCCCACCTCTGCCTCTGG - Intergenic
1176088185 20:63307471-63307493 CCCGCTCCCACCGCCCCAGCCGG + Exonic
1176135832 20:63521608-63521630 CTTTCTCCCCCCGCTCCTCCAGG + Intronic
1176167571 20:63682062-63682084 CCAGCTCACACCTGCCCTCCAGG - Intronic
1176221920 20:63973799-63973821 CCAGCTCCCTCAGGGCCTCCTGG - Intronic
1176448712 21:6843344-6843366 CCTGCCCCAACCCCTCCTCCTGG + Intergenic
1176668908 21:9713596-9713618 TCAGCTCCCAGCCCTCCTCTAGG - Intergenic
1176826882 21:13708367-13708389 CCTGCCCCAACCCCTCCTCCTGG + Intergenic
1178521143 21:33289373-33289395 CCAGCCCCCACCGCTGCTGCTGG + Intronic
1178992673 21:37367800-37367822 CTCGCGCCCGCCGCTCCTCCGGG - Intronic
1179557247 21:42187648-42187670 CCAGCTCTCACCTCTACACCAGG - Intergenic
1179580866 21:42343323-42343345 CTGGCTCCCTGCGCTCCTCCAGG - Intergenic
1179831586 21:44000442-44000464 CCAGCTCCCACCTCTGTCCCAGG - Intergenic
1180576891 22:16785172-16785194 CAAGCTCCCACCACTACGCCCGG - Intronic
1180707496 22:17818394-17818416 ACAGCTCCCTGCGCTCCTCCTGG + Exonic
1181014738 22:20062421-20062443 CCATCTCCCACTCCTCCCCCTGG + Intronic
1181937436 22:26448979-26449001 CCTGAACCCACCGCTGCTCCTGG - Intronic
1182295988 22:29311488-29311510 CCCGCTCCCGCCGCTACTCCGGG + Intronic
1182909043 22:33965185-33965207 ACAGGTCCCACCCTTCCTCCAGG + Intergenic
1183184838 22:36285896-36285918 CCAGCTCATCCCGCTCCTGCTGG + Exonic
1183186329 22:36293549-36293571 CCAGCTCCTCCCTCTCCTCAAGG - Intronic
1183265814 22:36824366-36824388 CCTCCTCCCTCGGCTCCTCCAGG - Intergenic
1183572180 22:38661883-38661905 CGACCTCTCACTGCTCCTCCTGG - Intronic
1184114679 22:42415654-42415676 CCAGCTCCCACCCCATCTCCTGG + Intronic
1184470328 22:44692327-44692349 CCTCCTCCCAGGGCTCCTCCTGG + Intronic
1184663325 22:45975602-45975624 CCTGCTTCCACCTCTCCGCCTGG + Intronic
1184693344 22:46127334-46127356 GCAGCCCCTACCCCTCCTCCAGG + Intergenic
952316757 3:32238658-32238680 CCCGCCCCCTCCCCTCCTCCGGG + Exonic
953141843 3:40236421-40236443 TCAACACCCACCCCTCCTCCAGG - Intronic
953884629 3:46708369-46708391 CCAGCTCCATCCCCTCCTCTAGG + Intronic
953930230 3:47002307-47002329 CCAGCCCCCACTCCTCTTCCTGG - Intronic
954293329 3:49661113-49661135 CCAGCTCCTGCCTTTCCTCCTGG + Exonic
954686907 3:52376030-52376052 CCAGAGCCCAGGGCTCCTCCTGG - Intronic
960952718 3:123010087-123010109 CCAGCCACCTCCGGTCCTCCAGG - Intronic
961406755 3:126685112-126685134 CCTGCTCCCACAGCTCCACCAGG - Intergenic
961446536 3:126983920-126983942 ACAGCTGCCACCGCTCCCACTGG + Intergenic
961582704 3:127895571-127895593 CCATCGCCCACCCCTCCTGCAGG - Intergenic
961665897 3:128492939-128492961 CCTGCTCCCAGCTCTACTCCAGG - Exonic
962318569 3:134373685-134373707 CCAGCGGCCACCGGTGCTCCAGG - Intronic
964479674 3:157128793-157128815 CCAGCTCTCAGGACTCCTCCAGG + Intergenic
965290799 3:166876793-166876815 CCAGCAGCCACCCCACCTCCTGG - Intergenic
965788004 3:172356640-172356662 CCAGTTCCGACTCCTCCTCCAGG + Intronic
967867846 3:194204597-194204619 CCGGCCCCCGCCGCCCCTCCCGG + Intergenic
968471252 4:783424-783446 CCAGCTCCCACCTGGCATCCAGG + Intergenic
968474330 4:795859-795881 CCACCGCCCACCCCACCTCCCGG + Intronic
968501025 4:950158-950180 CCAGCCCCCACCCCTTCTCCAGG - Intronic
968645982 4:1740709-1740731 CCACTGCCCACCTCTCCTCCTGG + Intronic
968737123 4:2303404-2303426 CCGGCTCCCACGGCTCCTGGTGG + Intronic
968742425 4:2338000-2338022 CCAGCTCCCAGGGCTCACCCTGG + Intronic
969442923 4:7227869-7227891 CCTGAGCCCACCGCACCTCCAGG - Intronic
970147387 4:13051214-13051236 CCACTTCCCACCTCTCCTTCAGG - Intergenic
970637155 4:18021899-18021921 CCCCCTCCCACCGCTCCCTCAGG + Intergenic
973820716 4:54659153-54659175 CCATCTCCCACCCCACCCCCAGG - Intronic
973862113 4:55076216-55076238 ACAGCTCTCACCTCTCCTGCTGG + Intergenic
976184416 4:82430239-82430261 CCAGCCCCCGCCCCTCCTCCCGG - Intergenic
977709563 4:100109610-100109632 ACAGGTCTCACAGCTCCTCCAGG + Intergenic
979205487 4:118033406-118033428 CCAGTTCCGACCGCCCCTCCCGG - Intergenic
981348153 4:143699520-143699542 TCAGCTCCCTCAGCTCCTGCTGG + Exonic
981741514 4:148007038-148007060 CTAACTCCCACCGCACCTACAGG - Intronic
982176537 4:152710321-152710343 CCAGCTTCAACTGCTCCTCCAGG + Intronic
982649254 4:158065898-158065920 CCAGTTCCCACCCCTGTTCCTGG - Intergenic
982651830 4:158096425-158096447 CCATCTCCCACCTCTGCTCCTGG - Intergenic
983757409 4:171357198-171357220 CCAGAACGCACCGTTCCTCCCGG + Intergenic
985075367 4:186208816-186208838 CCAGCCCCCACTGCTCTTTCAGG + Intronic
985405875 4:189637917-189637939 TCAGCTCCCAGCCCTCCTCTAGG + Intergenic
985784651 5:1887388-1887410 ACAGCTCCCAGCGCCCCTGCTGG - Intergenic
986062133 5:4201889-4201911 CCAGAGCCCACCTCTCCACCTGG - Intergenic
986861452 5:11931602-11931624 CCGCCTCCCACCGCACCTCGGGG + Intergenic
987266617 5:16262613-16262635 CCAGCACCCCCTGCCCCTCCAGG + Intergenic
989104324 5:37846735-37846757 CAAGCTCCCACAGCTTCTCAGGG - Intergenic
997299977 5:132796320-132796342 ACAGCTCTCAGCTCTCCTCCTGG - Intronic
997673430 5:135695001-135695023 CCATCACCCACCTCTCCTCCTGG + Intergenic
998874858 5:146588927-146588949 GCAGCACCCTCCCCTCCTCCTGG - Intronic
999707351 5:154285691-154285713 CCAGCCTCCACCCCTCCTCTTGG + Intronic
1000408946 5:160917935-160917957 CCAGCAGCCACAGCTCTTCCAGG + Intergenic
1001840608 5:174873198-174873220 CCAGCCCCCACTGCTCCTTCTGG + Intergenic
1001937472 5:175715570-175715592 ACACTTCCCTCCGCTCCTCCAGG + Intergenic
1002988628 6:2216901-2216923 CCAACTCCCATGGCTCCTCACGG + Intronic
1003624581 6:7729323-7729345 CCCGCCCCCACCCCGCCTCCAGG + Intronic
1003874829 6:10426162-10426184 CCAGCGGCCACCGCACCGCCGGG - Intergenic
1004171606 6:13299691-13299713 CCAGCTCCTTCCCCTCCACCTGG - Intronic
1004199212 6:13532448-13532470 CCAACTCCCATGGCTCCTTCTGG - Intergenic
1004864384 6:19838312-19838334 CCCCCTCCCCCTGCTCCTCCGGG + Intronic
1005932472 6:30493835-30493857 CCTGCTCCCAGCGCTCCACAAGG - Exonic
1006335782 6:33419980-33420002 GCAGCCCCCACCCCTACTCCGGG - Intergenic
1007729966 6:43939719-43939741 CCAGCGCCCACTTCCCCTCCTGG - Intergenic
1007754030 6:44087319-44087341 CCAGCTCCCTCCCCTGGTCCTGG - Intergenic
1007821972 6:44567167-44567189 CAAGTTCCCATCACTCCTCCTGG + Intergenic
1008030420 6:46688212-46688234 CCAGCCCCCACAGCTGCACCGGG - Exonic
1008189256 6:48433970-48433992 CCAGCACCCAGTGCTCCTGCAGG - Intergenic
1011706152 6:90003344-90003366 CCAGCTCCCTCACCTGCTCCAGG + Intronic
1013225538 6:108117687-108117709 CCAGCTCCCGCCTCACCCCCAGG - Intronic
1013556230 6:111259651-111259673 CCCGGTCCCACCGCTCTGCCAGG - Exonic
1015199939 6:130568140-130568162 CCACCTCCCACCCATCCACCCGG + Intergenic
1017265622 6:152442131-152442153 CCAGCTTCCGCAGCTCCTCGTGG + Exonic
1017726661 6:157281057-157281079 CCAGGTCTCACAGCACCTCCAGG - Intergenic
1018488974 6:164272384-164272406 CCAAGTCCCACAGCTCCTGCTGG + Intergenic
1019014683 6:168871304-168871326 CCCGCGCCAACCGCTCCTCCTGG + Intergenic
1019129846 6:169865627-169865649 CCAGCTCCCTCCTCTGCCCCTGG + Intergenic
1019282629 7:207995-208017 GCAGCTCCCGCCGCTCCGCAAGG - Intronic
1019463695 7:1174969-1174991 CCCGCTCCCACCTCACTTCCAGG + Intergenic
1019533296 7:1514404-1514426 CCAGCACCCACCTTTCCTCCTGG - Intergenic
1019704136 7:2489452-2489474 CTTTCTCCCACCCCTCCTCCAGG - Intergenic
1019780835 7:2938738-2938760 CCAGCTCCTGCCTGTCCTCCAGG + Exonic
1020037679 7:4974486-4974508 CCGCCTCCCGCCGCTCCTCCAGG - Intergenic
1020047942 7:5057333-5057355 CCAGCTGCTGCCACTCCTCCTGG - Exonic
1020103150 7:5406954-5406976 CCAGCCCCCAGCGTTCCTGCAGG + Intronic
1020162139 7:5781138-5781160 CCGCCTCCCGCCGCTCCTCCAGG + Intronic
1022443839 7:30454101-30454123 CCAGCTTCCACAGCCCCTGCAGG - Intronic
1022631828 7:32092602-32092624 CCAGATCCCACTGCTCAGCCAGG + Intronic
1023658156 7:42447180-42447202 CCTGTTCCCACCACTCCTCCAGG + Intergenic
1023746275 7:43325749-43325771 CCGGATCCCACCTCACCTCCCGG + Intronic
1023771468 7:43560500-43560522 CCAGCACCCATTCCTCCTCCTGG - Intronic
1023820230 7:43976802-43976824 CCACCTCCCACCCCTTCTCCTGG - Intergenic
1024270075 7:47635495-47635517 CCTCCTCCCAGCGCTGCTCCTGG - Intergenic
1024672366 7:51607866-51607888 CCACCTCCCGCAGCTCCTCGAGG + Intergenic
1025094631 7:56087658-56087680 GCAGCTCCCGCACCTCCTCCGGG + Exonic
1026206698 7:68263885-68263907 CCAGATCCCACTCCCCCTCCCGG - Intergenic
1026728442 7:72890665-72890687 CCAGTTGCCACCACTCCTCCTGG - Exonic
1027115391 7:75475128-75475150 CCAGTTGCCGCCACTCCTCCTGG + Exonic
1027120575 7:75516160-75516182 CCAGTTGCCGCCACTCCTCCTGG + Intergenic
1027286517 7:76650822-76650844 CCAGTTGCCGCCACTCCTCCTGG + Intergenic
1029748518 7:102530323-102530345 CCACCTCCCACCCCTTCTCCTGG - Intergenic
1029766465 7:102629407-102629429 CCACCTCCCACCCCTTCTCCTGG - Intronic
1032013057 7:128359527-128359549 CCAGGTCACAGTGCTCCTCCTGG + Exonic
1032193986 7:129779532-129779554 CCAGCGCCCAGCGCTGTTCCCGG - Intergenic
1032478546 7:132228441-132228463 ACCGCTCACACCGCTCCTTCCGG + Exonic
1033242260 7:139690044-139690066 CCCGCCCCCACCGCTTCTCATGG - Intronic
1034201353 7:149285036-149285058 CCAGCTGCCACCGCCCCGCACGG - Intronic
1034308012 7:150061790-150061812 CCAGCTCACACACCACCTCCTGG + Intergenic
1034348103 7:150399209-150399231 CCAGTTCCCTCCTCTCCTCTGGG - Intronic
1034798841 7:154038881-154038903 CCAGCTCACACACCACCTCCTGG - Intronic
1035158753 7:156935521-156935543 CCAGCTTCTTCCCCTCCTCCAGG - Intergenic
1035731959 8:1859893-1859915 CCAGCTCCATCCTCACCTCCTGG - Exonic
1037881022 8:22573580-22573602 CCAGCTCCCTCATTTCCTCCAGG - Intronic
1037922547 8:22817550-22817572 GCAGTTCCCACCTCTCATCCAGG - Intronic
1041104415 8:54427321-54427343 CCCGCTCCCCCCGCTCCCCTGGG + Intergenic
1041326169 8:56667662-56667684 CCAGCTCCAGCTGCTACTCCTGG + Intergenic
1044087619 8:87959748-87959770 CCAACTCCCACTGCCCCTTCAGG + Intergenic
1047827717 8:128595617-128595639 CCAGATCCCCCAGGTCCTCCTGG + Intergenic
1049346022 8:142139097-142139119 CCCGGTTCCACCCCTCCTCCTGG - Intergenic
1049569139 8:143360156-143360178 CCGCCTCCCACCCCACCTCCTGG - Intergenic
1049731392 8:144180362-144180384 CCAGCGCCCCGTGCTCCTCCTGG - Intronic
1053035803 9:34826084-34826106 GCAGCACCCACCCCTCCTTCTGG + Intergenic
1056941691 9:90961618-90961640 GCAGCTCCCAGCTCTCCTGCTGG - Intergenic
1057424930 9:94940751-94940773 ACAGCCCCCACTGCCCCTCCTGG + Intronic
1057547266 9:96027625-96027647 CCAGCGCCCACCCGTCCCCCCGG + Intergenic
1058472869 9:105299002-105299024 CCTACTCCCACCCCTCTTCCTGG - Intronic
1059176611 9:112174830-112174852 CCAGCCCCCACCCCGCCTCCTGG + Intronic
1060667038 9:125438137-125438159 CCAGCCACCGCCCCTCCTCCTGG + Exonic
1061028785 9:128067381-128067403 CCGCCTCCCAGCGCTTCTCCGGG + Intronic
1061044920 9:128159990-128160012 CGGTCTCCCGCCGCTCCTCCCGG + Intergenic
1061362658 9:130153633-130153655 CCAGCTTCTCCCGCTCCTCGTGG - Intergenic
1061843682 9:133375491-133375513 CGAGCTCCCAGCCCGCCTCCGGG + Intronic
1062053628 9:134459581-134459603 CCAACCCCAACCCCTCCTCCAGG + Intergenic
1062400508 9:136370578-136370600 GCAGCTCCCACAGCAGCTCCTGG + Exonic
1062482734 9:136759940-136759962 CCAGCTACCACTGCTGCCCCAGG + Intronic
1062733509 9:138121836-138121858 CCAACTCGGGCCGCTCCTCCAGG + Exonic
1203520477 Un_GL000213v1:41173-41195 CCTGCCCCAACCCCTCCTCCTGG - Intergenic
1203656958 Un_KI270753v1:7339-7361 TCAGCTCCCAGCCCTCCTCTAGG + Intergenic
1186220392 X:7343753-7343775 CCAGCACCCCCCGCCCCTCCCGG + Intronic
1192451952 X:71250256-71250278 TCAGCTTCCGCCCCTCCTCCAGG + Intronic
1192590614 X:72356652-72356674 GCAGCTTCCACCTCCCCTCCCGG + Intronic
1195894680 X:109733335-109733357 CCCGCTCCGCCCGCCCCTCCGGG - Exonic
1197706486 X:129638178-129638200 TCAGCTCCCACTTCACCTCCAGG + Intergenic
1198302433 X:135344961-135344983 CCACCGCCCACCACTCCTTCCGG - Intronic
1200032798 X:153310095-153310117 CCAGCACCCACCATTCCTCATGG + Intergenic
1200049100 X:153419282-153419304 CAAGCTGCCCCAGCTCCTCCCGG - Intronic
1201921539 Y:19239308-19239330 CCAGCTACCACCACACCCCCAGG + Intergenic