ID: 1131261333

View in Genome Browser
Species Human (GRCh38)
Location 15:90889569-90889591
Sequence GAGGGTGAACCGCTGGAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1239
Summary {0: 1, 1: 0, 2: 1, 3: 75, 4: 1162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131261326_1131261333 13 Left 1131261326 15:90889533-90889555 CCACCCTGTGTCACGTTCGATGA 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1131261333 15:90889569-90889591 GAGGGTGAACCGCTGGAGCCTGG 0: 1
1: 0
2: 1
3: 75
4: 1162
1131261325_1131261333 14 Left 1131261325 15:90889532-90889554 CCCACCCTGTGTCACGTTCGATG 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1131261333 15:90889569-90889591 GAGGGTGAACCGCTGGAGCCTGG 0: 1
1: 0
2: 1
3: 75
4: 1162
1131261323_1131261333 27 Left 1131261323 15:90889519-90889541 CCGCACCTGACGTCCCACCCTGT 0: 1
1: 0
2: 2
3: 15
4: 209
Right 1131261333 15:90889569-90889591 GAGGGTGAACCGCTGGAGCCTGG 0: 1
1: 0
2: 1
3: 75
4: 1162
1131261328_1131261333 9 Left 1131261328 15:90889537-90889559 CCTGTGTCACGTTCGATGAGTCA 0: 1
1: 0
2: 0
3: 3
4: 24
Right 1131261333 15:90889569-90889591 GAGGGTGAACCGCTGGAGCCTGG 0: 1
1: 0
2: 1
3: 75
4: 1162
1131261324_1131261333 22 Left 1131261324 15:90889524-90889546 CCTGACGTCCCACCCTGTGTCAC 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1131261333 15:90889569-90889591 GAGGGTGAACCGCTGGAGCCTGG 0: 1
1: 0
2: 1
3: 75
4: 1162
1131261327_1131261333 10 Left 1131261327 15:90889536-90889558 CCCTGTGTCACGTTCGATGAGTC 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1131261333 15:90889569-90889591 GAGGGTGAACCGCTGGAGCCTGG 0: 1
1: 0
2: 1
3: 75
4: 1162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131261333 Original CRISPR GAGGGTGAACCGCTGGAGCC TGG Exonic
900018678 1:171833-171855 GAGGGGGAACAGCATGAGCCAGG + Intergenic
900235202 1:1585853-1585875 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
900571189 1:3359131-3359153 GAGGGAGGATCGCTTGAGCCCGG - Intronic
900606624 1:3526489-3526511 CAGGGAGAACCGCTTGAACCTGG - Intronic
900699292 1:4034155-4034177 GAGGGTGAAGCGCTGCAGAGAGG - Intergenic
901445739 1:9307019-9307041 GAGGGAGAATCACTGGAACCTGG - Intronic
901521699 1:9789883-9789905 GTGGGAGAATCGCTTGAGCCTGG + Intronic
901574535 1:10190296-10190318 GTGGGAGGATCGCTGGAGCCTGG - Intergenic
902224849 1:14990314-14990336 GTGGGAGAACTGCTTGAGCCTGG - Intronic
902228715 1:15013659-15013681 GCGGGAGAATCGCTTGAGCCTGG + Intronic
902510023 1:16961365-16961387 GAGGGAGGACCACTTGAGCCCGG - Intronic
902523856 1:17041034-17041056 GTGGGAGAATCGCTTGAGCCTGG + Intronic
902570838 1:17346202-17346224 CAGGCTGAACCCCAGGAGCCCGG - Intronic
902591034 1:17474875-17474897 GCGGGAGAATCGCTGGAACCCGG - Intergenic
903034568 1:20485753-20485775 GAGGGCGCACCCCGGGAGCCGGG + Exonic
903062560 1:20680076-20680098 GTGGGCGAATCGCTTGAGCCTGG - Intronic
903628350 1:24746893-24746915 GTGGGAGAACTGCTTGAGCCCGG + Intronic
903790753 1:25891440-25891462 GAGGGAGAAATGATGGAGCCAGG + Intronic
903860037 1:26359594-26359616 GCAGGAGAACCGCTTGAGCCCGG - Intergenic
903940983 1:26931169-26931191 GTGGGAGAACTGCTGGAACCTGG - Intronic
904018902 1:27446685-27446707 GTGGGTGGATCGCTTGAGCCTGG + Intronic
904076618 1:27847635-27847657 GTGGGAGAATCGCTGGAACCGGG + Intronic
904114812 1:28153958-28153980 GTGGGAGGATCGCTGGAGCCCGG + Intronic
904178096 1:28645552-28645574 GAAGGAGAATCGCTGGAACCCGG + Intergenic
904233723 1:29099417-29099439 GTGGGAGAACTGCTTGAGCCTGG - Intronic
904259098 1:29277910-29277932 GTGGGAGAATCGCTGGAACCAGG - Intronic
904516679 1:31061229-31061251 CAGGGAGAATCGCTTGAGCCAGG + Intronic
904587662 1:31588960-31588982 GCGGGCGGGCCGCTGGAGCCGGG - Intergenic
904980455 1:34496727-34496749 GAAGGAGAACCGCTTGAACCCGG + Intergenic
905074786 1:35260877-35260899 GCAGGTGAACCGCTTGAACCCGG + Intergenic
905096864 1:35479807-35479829 GTGGGAGAATCGCTTGAGCCTGG + Intronic
905157428 1:35997183-35997205 GTGGGAGAATCGCTGGAACCTGG + Intronic
905396727 1:37671054-37671076 GAGGGAGAACCACTTGAGCCTGG + Intergenic
905634100 1:39537791-39537813 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
905699078 1:39998487-39998509 GAAGGAGAATCGCTTGAGCCCGG - Intergenic
905708588 1:40081441-40081463 GAGGGAGAATCGCTTGAACCTGG + Intronic
905791737 1:40793229-40793251 GTGGGAGGATCGCTGGAGCCAGG - Intronic
905805515 1:40874219-40874241 GATGGTAAGCCACTGGAGCCAGG + Intergenic
906026586 1:42679281-42679303 GAGGGAGAATCGCTTGAACCCGG - Intergenic
906067304 1:42991147-42991169 GAGGCAGAACCGCTTGAACCCGG - Intergenic
906397970 1:45483502-45483524 GAGGGAGAACTGCTTGAACCCGG + Intronic
906403524 1:45522836-45522858 GCGGGAGAATCGCTTGAGCCCGG - Intronic
906428227 1:45732266-45732288 CAGGGAGAACCGCTTGAACCCGG + Intronic
906538692 1:46568026-46568048 GTGGGAGAACCACTTGAGCCTGG + Intronic
907005843 1:50911941-50911963 GTGGGAGAAACGCTTGAGCCTGG + Intronic
907210320 1:52815524-52815546 GTGGGAGAATCGCTTGAGCCTGG + Intronic
907346478 1:53785664-53785686 GGGGGAGAACCGCTTGAACCCGG - Intronic
907384991 1:54120574-54120596 CAGGGTGAAGCGCTCCAGCCTGG - Intergenic
907475342 1:54701661-54701683 GTGGGAGAACTGCTTGAGCCAGG - Intronic
907608150 1:55840321-55840343 GCAGGAGAATCGCTGGAGCCTGG - Intergenic
908124867 1:61020680-61020702 GAGGGAGAATCACTTGAGCCTGG + Intronic
908286366 1:62607986-62608008 GCAGGAGAATCGCTGGAGCCTGG + Intronic
908996190 1:70158005-70158027 GTGGGGGAATCGCTTGAGCCAGG + Intronic
909012881 1:70354332-70354354 GAAGGGGACCTGCTGGAGCCCGG - Exonic
909997991 1:82305111-82305133 GAGGTTGCACCACTGGACCCCGG - Intergenic
909998459 1:82311389-82311411 GCAGGTGAATCGCTTGAGCCTGG - Intergenic
910218122 1:84863166-84863188 GTGGGAGAACCGCTTGAACCCGG - Intronic
910914350 1:92273537-92273559 GAGGGTGGATTGCTTGAGCCTGG - Intronic
911349961 1:96741488-96741510 GCGGGAGAACTGCTTGAGCCTGG - Intronic
911445331 1:97985142-97985164 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
912324989 1:108748736-108748758 GTGGGAGGATCGCTGGAGCCTGG + Intronic
912349530 1:108998406-108998428 GATGGTGAATCGCTTGAACCTGG + Intronic
912368697 1:109156049-109156071 GAGGGAGAATCACTTGAGCCTGG + Intronic
912539560 1:110403517-110403539 TTGGGTGAATCGCTTGAGCCCGG + Intronic
912955233 1:114151120-114151142 GAGGCGGAACAGCTGGGGCCTGG + Intronic
912998828 1:114559391-114559413 GAGGGAGAATCACTTGAGCCCGG + Intergenic
913136443 1:115894029-115894051 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
913270177 1:117085457-117085479 GTGGGAGAATCGCTTGAGCCTGG + Intronic
913461500 1:119090800-119090822 GTGGGAGAACTGCTTGAGCCTGG + Intronic
914235071 1:145801879-145801901 GTGGGAGAATCTCTGGAGCCTGG - Intronic
914266243 1:146040671-146040693 GAGGGAGAATCGCTTGAACCCGG - Intergenic
914313855 1:146489951-146489973 GAAGGAGAATCGCTGGAACCCGG + Intergenic
914344517 1:146787091-146787113 GCGGGTGGACTGCTTGAGCCCGG - Intergenic
914399178 1:147300192-147300214 GTGGGTGGACCACTTGAGCCTGG + Intergenic
914500495 1:148243429-148243451 GAAGGAGAATCGCTGGAACCCGG - Intergenic
915329193 1:155099183-155099205 GTGGGTGGACTGCTTGAGCCTGG - Intergenic
915435815 1:155905288-155905310 GTGGGAGAATCACTGGAGCCTGG - Intronic
915508284 1:156371251-156371273 GCGGGTGAATCGCTTGAACCTGG - Intronic
915780387 1:158543420-158543442 GTGGGAGAATCGCTTGAGCCAGG - Intergenic
916024929 1:160825112-160825134 GTGGGAGGACCGCTTGAGCCGGG + Intronic
916807679 1:168275157-168275179 GAGGGAGGACCGCTTGAGCCTGG - Intergenic
916920607 1:169462279-169462301 GAGGCTGAATCGCTTGAACCTGG - Intergenic
917067528 1:171113032-171113054 GAGGGTGGACCACTGGATCTGGG + Intronic
917748745 1:178035997-178036019 GTGGGAGAACTGCTTGAGCCTGG + Intergenic
918222177 1:182444970-182444992 GCGGGAGAACTGCTTGAGCCAGG - Intergenic
918426368 1:184414222-184414244 GAGGGAGGATCGCTTGAGCCTGG - Intronic
919706072 1:200677208-200677230 GGGGGAGAACCGCTTGAACCCGG - Intergenic
919996872 1:202760220-202760242 GTGGGAGAACTGCTTGAGCCAGG + Intronic
920096300 1:203488424-203488446 GCGGGAGAATCGCTTGAGCCGGG + Exonic
920220868 1:204399464-204399486 GCAGGAGAATCGCTGGAGCCTGG + Intergenic
920221118 1:204401825-204401847 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
920458578 1:206118938-206118960 GAGGGAGAATCGCTTGAGCCTGG - Intergenic
920552442 1:206874019-206874041 GTGGGTGGACTGCTTGAGCCAGG + Intergenic
920853128 1:209642570-209642592 GCGGGAGAATCGCTTGAGCCTGG - Intronic
920905814 1:210166470-210166492 GTGGGAGAATCGCTGGAGCCTGG + Intronic
921186471 1:212674150-212674172 GTGGGTGGATCGCTTGAGCCTGG - Intergenic
921703388 1:218291929-218291951 GTGGGAGAACTGCTTGAGCCTGG - Intronic
923595399 1:235357360-235357382 GCGGGAGAATCGCTGGAACCTGG + Intergenic
923657132 1:235926854-235926876 GTGGGAGAATCGCTTGAGCCCGG + Intergenic
923786269 1:237071821-237071843 CAGGGAGAAAGGCTGGAGCCGGG - Intronic
923964578 1:239123006-239123028 GCGGGAGAATCGCTGGAACCTGG + Intergenic
924128404 1:240880268-240880290 GCGGGAGAACTGCTGGAGCCCGG - Intronic
924226357 1:241925138-241925160 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
924703235 1:246475233-246475255 GAGGGAGAACTGCTTGAACCCGG + Intronic
924838222 1:247677147-247677169 GCAGGAGAATCGCTGGAGCCTGG + Intergenic
1062872538 10:918538-918560 GAGGGAGGACCGCTTGAGACTGG + Intronic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1063353859 10:5380395-5380417 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1063554729 10:7067551-7067573 GTGGGAGGATCGCTGGAGCCCGG - Intergenic
1063674764 10:8130944-8130966 GTGGGAGGATCGCTGGAGCCCGG - Intergenic
1063735011 10:8743232-8743254 GTGGGAGGACCGCTTGAGCCAGG - Intergenic
1063834460 10:9996511-9996533 GAGGGAGAATCGCTTGAACCTGG + Intergenic
1063994610 10:11607590-11607612 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1064036426 10:11916994-11917016 GAGGGAGAATCACTTGAGCCTGG + Intergenic
1064414390 10:15136125-15136147 GAGGGAGAATCGCTTGAACCTGG + Intronic
1064435685 10:15309299-15309321 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1064538220 10:16379702-16379724 GTGGGAGGACCGCTTGAGCCTGG - Intergenic
1064741106 10:18435590-18435612 GAGGGAGGATCGCTTGAGCCTGG - Intronic
1064983514 10:21187605-21187627 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1065042287 10:21709829-21709851 GTGGGAGAACTGCTTGAGCCTGG - Intronic
1065077976 10:22100048-22100070 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1065081975 10:22138171-22138193 GCGGGAGAATCGCTTGAGCCCGG - Intergenic
1065959479 10:30722795-30722817 GAGGGAGAATCACTTGAGCCAGG + Intergenic
1066330885 10:34421076-34421098 GAGGTGGAACTGCTTGAGCCTGG + Intronic
1066415446 10:35217094-35217116 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1067033419 10:42896175-42896197 GAAGGAGAATCGCTTGAGCCTGG + Intergenic
1067112445 10:43409598-43409620 GCGGGAGAATCGCTTGAGCCCGG + Intergenic
1067502005 10:46814112-46814134 GCAGGAGAACCGCTTGAGCCCGG + Intergenic
1067672923 10:48342195-48342217 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1067892372 10:50148028-50148050 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1068080275 10:52310763-52310785 GTGGAAGAACCGCTTGAGCCTGG + Intergenic
1068582092 10:58753260-58753282 GTGGGGGAACCGCTTAAGCCTGG - Intronic
1068772494 10:60837538-60837560 GCAGGAGAATCGCTGGAGCCTGG + Intergenic
1069378432 10:67818109-67818131 GTGGGAGAACTGCTTGAGCCTGG + Intronic
1069498293 10:68927004-68927026 GTGGGAGAACCACTGGAGCCTGG - Intronic
1069718762 10:70537199-70537221 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1069912513 10:71768031-71768053 GAGGGTGGCTGGCTGGAGCCGGG - Intronic
1069983705 10:72269794-72269816 GTAGGAGAATCGCTGGAGCCTGG - Intergenic
1070080832 10:73185453-73185475 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1070124507 10:73609748-73609770 GAAGGAGAAGCGCTTGAGCCTGG + Intronic
1070277081 10:75017518-75017540 GAAGGAGAATCGCTTGAGCCTGG + Intronic
1070301772 10:75209495-75209517 GAGGGAGGATCGCTTGAGCCTGG - Intergenic
1071109936 10:82143934-82143956 GTAGGAGAATCGCTGGAGCCTGG + Intronic
1071834352 10:89404866-89404888 GTGAGTGGACTGCTGGAGCCAGG + Intronic
1071847343 10:89534733-89534755 GAGGGAGGATCGTTGGAGCCGGG + Intronic
1072037192 10:91574423-91574445 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1072568787 10:96640749-96640771 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1072598261 10:96896515-96896537 GCGGGAGAATCGCTTGAGCCTGG - Intronic
1073152145 10:101319416-101319438 GAGGGAGAGCCACAGGAGCCAGG - Intergenic
1073329062 10:102659086-102659108 GTGGGAGAACTGCTTGAGCCTGG + Intergenic
1073478915 10:103773128-103773150 GCAGGTGAATCGCTTGAGCCTGG + Intronic
1074514863 10:114157275-114157297 GTGGGTGGATCACTGGAGCCGGG - Intronic
1074783641 10:116820050-116820072 GTGGGTGAATTGCTTGAGCCTGG - Intergenic
1074850534 10:117435897-117435919 GTGGGAGAACCACTTGAGCCTGG + Intergenic
1075039551 10:119097105-119097127 GCAGGAGAACCGCTGGAACCCGG + Intergenic
1075129322 10:119725526-119725548 GGGGATGAACCCCTGTAGCCAGG + Intergenic
1075313593 10:121434279-121434301 GAGTGTGAGCCGCTGGGGCCTGG - Intergenic
1075335806 10:121608315-121608337 GAGGCAGAACTGCTTGAGCCCGG + Intergenic
1075605542 10:123803189-123803211 GTGGGTGAATTGCTTGAGCCTGG - Intronic
1075626400 10:123967140-123967162 GAGGAGGAGCCGCTGGAGCTGGG - Intergenic
1075691144 10:124395073-124395095 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1075751873 10:124779223-124779245 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1075819872 10:125297697-125297719 GAGGGAGAACTGCTTTAGCCTGG + Intergenic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1077041039 11:523120-523142 GAGGGAGAATCGCTTGAACCTGG - Intergenic
1077341278 11:2027483-2027505 GAGGGTGAAGCCCGTGAGCCTGG - Intergenic
1077583934 11:3435978-3436000 GTGGGAGAACTGCTTGAGCCCGG - Intergenic
1077707387 11:4499960-4499982 GAGGGTGGATCACTTGAGCCCGG - Intergenic
1077777460 11:5287344-5287366 GTGGGAGGACCGCTTGAGCCTGG + Intronic
1078164590 11:8871167-8871189 GAGGGTGGGCTGCTGGAGCCCGG + Intronic
1078250232 11:9610632-9610654 GAGGCTGAATCGCTTGAACCCGG + Intergenic
1078524662 11:12091184-12091206 GTGGGAGAACTGCTTGAGCCTGG - Intergenic
1078542202 11:12221706-12221728 GATGGTGAAGAGCTGGAACCAGG + Exonic
1080645852 11:34186911-34186933 GAGGGTGAGACCCCGGAGCCGGG - Intronic
1081470579 11:43366410-43366432 GTGGGAGAATCGCTTGAGCCCGG + Intronic
1081619333 11:44609752-44609774 GAGGAAGAGCAGCTGGAGCCTGG + Intronic
1081633192 11:44703090-44703112 GAGGATGAAACTCTGTAGCCAGG + Intergenic
1081698333 11:45134603-45134625 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1081948133 11:47017266-47017288 GTGGGAGAACCGCTTGAACCTGG - Intronic
1082027707 11:47585067-47585089 GGGGGAGAACCGCTTGGGCCTGG - Intergenic
1082040545 11:47681236-47681258 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1083035748 11:59635769-59635791 GTGGGAGAACTGCTTGAGCCTGG + Intergenic
1083220099 11:61246668-61246690 CAGGGAGAATCGCTTGAGCCTGG + Intronic
1083306307 11:61763769-61763791 GTGGGAGAATCGCTGGAACCTGG + Intronic
1083359326 11:62094929-62094951 GTGGGAGAACCGCTTGAGCCTGG + Intergenic
1083360116 11:62101087-62101109 GTGGGAGAACCGCTTGAGCCTGG - Intergenic
1083391853 11:62357341-62357363 GCAGGAGAACCGCTTGAGCCTGG - Intronic
1083558841 11:63655539-63655561 GTGGGAGAATCGCTGGAACCCGG - Intronic
1084373859 11:68763075-68763097 GCGGGTGGATCGCTTGAGCCAGG - Intronic
1084391773 11:68882060-68882082 GAGGGAGGATCGCTTGAGCCAGG - Intergenic
1084618002 11:70249312-70249334 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
1084698571 11:70771016-70771038 GTGGGTGTATCGCTTGAGCCTGG - Intronic
1085092218 11:73726653-73726675 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1085104682 11:73831844-73831866 GCGGGAGAATCGCTTGAGCCGGG + Intronic
1085188540 11:74597552-74597574 GAGGGAGAATCACTTGAGCCTGG - Intronic
1085319980 11:75568193-75568215 GTGGGAGGATCGCTGGAGCCTGG + Intronic
1085464398 11:76714006-76714028 GTGGGAGGACCGCTTGAGCCCGG + Intergenic
1085628795 11:78095329-78095351 GTGGGTGGACTGCTTGAGCCAGG + Intergenic
1086007452 11:82054517-82054539 GAGAGTGAACAGCTGGAGAATGG - Intergenic
1086202501 11:84220872-84220894 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1086357851 11:86024034-86024056 AAGGGAGGACCGCTTGAGCCAGG + Intronic
1086386846 11:86317709-86317731 GTGGGAGAATCGCTTGAGCCAGG + Intronic
1087093758 11:94300734-94300756 GTGGGAGAATCGCTGGAACCCGG + Intergenic
1087535693 11:99442261-99442283 GAGGGAGAATCGCTAGAACCCGG - Intronic
1088172819 11:107017803-107017825 GAGGGTGCAGCGCCGGAGGCGGG - Exonic
1088290607 11:108232954-108232976 GCGGGAGAATCGCTTGAGCCCGG - Intronic
1088551567 11:111018909-111018931 GCGGGAGAATCGCTGGAACCTGG - Intergenic
1088628774 11:111753718-111753740 GAGGCTGAAGTGCTTGAGCCTGG - Intronic
1088630824 11:111772330-111772352 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1089265806 11:117260746-117260768 GAAGGAGAACCGCTTGAACCTGG - Intronic
1089373129 11:117975657-117975679 CAGGGAGACCCCCTGGAGCCTGG + Intergenic
1090768539 11:129897602-129897624 GTGGGAGAATCGCTTGAGCCAGG + Intergenic
1202824263 11_KI270721v1_random:82672-82694 GAGGGTGAAGCCCGTGAGCCTGG - Intergenic
1091495340 12:967696-967718 GAGGGAGGATCGTTGGAGCCAGG - Intronic
1091735571 12:2918632-2918654 GCGGGAGAATCGCTTGAGCCTGG - Intronic
1091742981 12:2973297-2973319 GCGGGTGGACTGCTTGAGCCAGG - Intronic
1091935538 12:4431802-4431824 GAAGGAGAATCGCTTGAGCCTGG + Intronic
1092121727 12:6049099-6049121 GAGGGTGAAATGCTGTGGCCTGG - Intronic
1092240922 12:6836126-6836148 GTGGGAGGACCTCTGGAGCCTGG + Intronic
1092411072 12:8253225-8253247 GTGGGAGAACTGCTTGAGCCCGG - Intergenic
1092791304 12:12072978-12073000 GGGGGAGAATCGCTTGAGCCTGG - Intronic
1092809111 12:12255662-12255684 GAGGGAGAATCGCTTGAACCTGG - Intronic
1092954299 12:13535260-13535282 GGGGGTGCTCAGCTGGAGCCAGG - Intergenic
1093018466 12:14178842-14178864 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1093059465 12:14588212-14588234 GTGGGAAAATCGCTGGAGCCTGG - Intergenic
1093448176 12:19284160-19284182 GAAGGAGAATCGCTTGAGCCCGG - Intronic
1093730875 12:22564258-22564280 GAGGGAGGATCGCTTGAGCCCGG - Intergenic
1094205313 12:27833372-27833394 GTGGGAGAATCGCTGGAACCTGG + Intergenic
1094250003 12:28348815-28348837 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1094600424 12:31904313-31904335 CAGGGAGAATCGCTGGAACCCGG - Intergenic
1094650139 12:32368269-32368291 GAGGATCAATCGCTTGAGCCTGG + Intronic
1094668060 12:32541457-32541479 GAAGGAGAACCGCTTGAACCCGG - Intronic
1095426102 12:42076139-42076161 GTGGGAGAATCGCTTGAGCCCGG - Intergenic
1095607407 12:44086305-44086327 GCGGGGGAATCGCTGGAACCTGG - Intronic
1095767178 12:45909991-45910013 GTGGGAGGACCGCTTGAGCCTGG - Intergenic
1096015596 12:48271339-48271361 GCAGGAGAACCGCTTGAGCCTGG - Intergenic
1096131029 12:49159180-49159202 GCAGGAGAATCGCTGGAGCCTGG - Intergenic
1096649469 12:53054766-53054788 GTGGGAGAATCGCTTGAGCCCGG - Intronic
1097164223 12:57074383-57074405 GTGGGAGAATCGCTGGAACCTGG - Intronic
1097768708 12:63554964-63554986 GAGGGAGGATCGCTTGAGCCTGG - Intergenic
1097966116 12:65583164-65583186 GTGGGTGAATCGCTTGAGCCTGG + Intergenic
1098354492 12:69599177-69599199 GAAGGAGAACTGCTTGAGCCAGG - Intronic
1098391401 12:69973287-69973309 ATGGGAGAATCGCTGGAGCCTGG - Intergenic
1099177634 12:79440122-79440144 GAGGGAGAATCGCTTGAACCTGG + Intronic
1099456106 12:82864593-82864615 GTAGGTGAATCGCTGGAACCCGG - Intronic
1100365521 12:93916793-93916815 GCGGGAGAATCGCTTGAGCCTGG + Intergenic
1101459220 12:104872634-104872656 GAGGCAGAACTGCTTGAGCCTGG + Intronic
1101464364 12:104932529-104932551 GTGGGAGAAGCACTGGAGCCTGG + Intronic
1101917318 12:108905703-108905725 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
1101917790 12:108909420-108909442 GAGGGAGAATCGCTTGAACCTGG + Intergenic
1101958109 12:109228240-109228262 GAGGGAGAACTGCTCGAACCCGG + Intronic
1101990536 12:109480555-109480577 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1102135671 12:110572345-110572367 GAGGGAGAATCGCTTGAACCCGG + Intronic
1102382843 12:112482504-112482526 GTGGGTGGATCGCTTGAGCCGGG + Intronic
1102537643 12:113593047-113593069 GCAGGAGAATCGCTGGAGCCCGG + Intergenic
1102644170 12:114393212-114393234 GAGGGGGAACTGCAGGAGCTGGG - Intronic
1102787554 12:115616999-115617021 GCGGGAGAATCGCTGGAACCCGG - Intergenic
1103082082 12:118032559-118032581 GTGGGAGAACTGCTCGAGCCTGG - Intronic
1103095971 12:118132669-118132691 GTGGGAGGACCGCTGGAGCCGGG + Intronic
1103247329 12:119469355-119469377 GAGGGAGAATCACTGGAACCCGG - Intronic
1103366367 12:120386689-120386711 GTGGGAGAATCGCTGGAACCTGG + Intergenic
1103681645 12:122699053-122699075 GAAGGAGAACCGCTTGAGCCCGG + Intergenic
1103696728 12:122821541-122821563 GTGGGAGGACCGCTGGAGCCTGG - Intronic
1103771440 12:123329285-123329307 GTGGGAGAACTGCTTGAGCCTGG + Intronic
1103955699 12:124575612-124575634 GAAGGTGAATCGCTTGAACCCGG + Intergenic
1104186037 12:126432584-126432606 GAGGGGGATCAGCTTGAGCCTGG - Intergenic
1104235682 12:126934283-126934305 GTGGGAGAACTGCTTGAGCCTGG + Intergenic
1104249855 12:127081953-127081975 GAATGAGAACCGCTTGAGCCTGG - Intergenic
1104690840 12:130825128-130825150 GTGGGAGAATCGCTGGAACCTGG - Intronic
1104864631 12:131945588-131945610 GAAGGAGAATCGCTTGAGCCCGG - Exonic
1104957152 12:132472529-132472551 TAGGGAGAGCAGCTGGAGCCGGG + Intergenic
1105015922 12:132786847-132786869 GGGGGTGATGGGCTGGAGCCAGG - Intronic
1105518461 13:21111210-21111232 GCTGGTGAATCGCTGGAACCGGG - Intergenic
1105563387 13:21517681-21517703 GCAGGAGAATCGCTGGAGCCCGG + Intronic
1105916360 13:24920712-24920734 GTGGGTGAATCGCTTGAACCCGG - Intronic
1106070711 13:26408205-26408227 GCAGGAGAACCGCTTGAGCCTGG - Intergenic
1106103629 13:26715369-26715391 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1106275601 13:28203054-28203076 GAGGGAGCATCGCTTGAGCCTGG - Intronic
1106481501 13:30140496-30140518 GCGGGTGAAGCGCAGGAGTCAGG - Intergenic
1106624965 13:31410983-31411005 GCAGGTGAATCGCTGGAACCCGG - Intergenic
1106649072 13:31669689-31669711 GAAGGAGAATCGCTGGAACCTGG - Intergenic
1106903801 13:34383608-34383630 GTAGGAGAACCGCTTGAGCCTGG + Intergenic
1107123691 13:36821430-36821452 GAGGGAGGATCGCTTGAGCCCGG + Intronic
1107134899 13:36933098-36933120 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
1107537505 13:41350166-41350188 GTGGGAGAACCACTTGAGCCTGG + Intronic
1107759280 13:43659394-43659416 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1107848983 13:44551176-44551198 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1107887602 13:44886665-44886687 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1108580382 13:51823170-51823192 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1109997878 13:70153771-70153793 GTGGGTGGATCGCGGGAGCCTGG - Intergenic
1110426082 13:75368948-75368970 GCAGGAGAACCGCTTGAGCCTGG + Intronic
1110475554 13:75909373-75909395 CAGGGTGAATTGCTGGAACCCGG - Intergenic
1110861895 13:80353506-80353528 GCGGGAGAATCGCTGGAACCCGG + Intergenic
1111973557 13:94941843-94941865 GTGGGTGAACCACTTGAACCTGG + Intergenic
1112177299 13:97038544-97038566 GTGGGTGGACTGCTTGAGCCTGG + Intergenic
1112277392 13:98034055-98034077 GTGGGGGAACCGTTTGAGCCCGG - Intergenic
1112551750 13:100428158-100428180 GTGGGAGGATCGCTGGAGCCTGG - Intronic
1112797449 13:103071948-103071970 GTGGGAGAACTGCTTGAGCCTGG - Intergenic
1113707175 13:112442457-112442479 GCAGGAGAACCACTGGAGCCTGG + Intergenic
1114315843 14:21509244-21509266 GTGGGAGGATCGCTGGAGCCCGG + Intronic
1114461966 14:22892172-22892194 GAGGCTGAATCGCTTGAACCTGG + Intergenic
1115217656 14:31028403-31028425 GTGGGTGGACCACTTGAGCCAGG - Intronic
1115461852 14:33670007-33670029 GCAGGAGAATCGCTGGAGCCTGG - Intronic
1115568766 14:34647824-34647846 GTGGGAGAATCGCTTGAGCCCGG + Intergenic
1115817739 14:37180988-37181010 GCGGGAGAACTGCTTGAGCCCGG - Intergenic
1116468634 14:45262009-45262031 GAGGGTGGATCGCTGGAGCCTGG - Intergenic
1116754201 14:48925488-48925510 GAGGGTGGATCACTGGAGGCCGG + Intergenic
1117131166 14:52688090-52688112 GTGGGAGAATCGCTTGAGCCAGG + Intronic
1117299675 14:54412289-54412311 GTGGGGGAACTGCTTGAGCCTGG + Intronic
1117346401 14:54837011-54837033 GCGGGAGAACCGCTTGAACCTGG + Intergenic
1117371091 14:55078966-55078988 GAGGGAGTATCGCTTGAGCCAGG - Intergenic
1117668038 14:58077511-58077533 GTGGGGGGACCGCTTGAGCCTGG + Intronic
1118022788 14:61736203-61736225 GCGGGTGGATCGCTTGAGCCTGG - Intronic
1118038641 14:61894189-61894211 GAAGGAGAATCGCTTGAGCCCGG + Intergenic
1118186131 14:63540335-63540357 AAGGGAGAACCGCTTGAACCTGG + Intronic
1118203645 14:63701210-63701232 GCGGGTGAATTGCTTGAGCCCGG - Intronic
1118225850 14:63898496-63898518 GCGGGTGGATCGCTTGAGCCAGG - Intronic
1118289098 14:64504155-64504177 GAGGCCGAGCCGCGGGAGCCTGG + Intronic
1118291666 14:64530511-64530533 GCGGGAGAACCGCTTGAACCTGG + Intronic
1118293485 14:64547480-64547502 GTGGGAGAATCGCTTGAGCCCGG + Intergenic
1118297086 14:64580205-64580227 GTGGGAGAACTGCTTGAGCCAGG + Intronic
1118712380 14:68531887-68531909 GAGGGAGAATTGCTTGAGCCTGG + Intronic
1118993748 14:70819168-70819190 GTGGGAGAACCGCTTGAGCCCGG - Intergenic
1119240429 14:73055021-73055043 GTGGGAGAATCGCTGGAGCCTGG + Intergenic
1119297872 14:73547790-73547812 GTGGGTGAATCGCTTGAACCTGG + Intronic
1119300020 14:73564202-73564224 GCAGGTGAATCGCTGGAACCCGG + Intergenic
1119302167 14:73580002-73580024 GTGGGTGAATCGCTTGAACCTGG + Intergenic
1119497688 14:75094684-75094706 GAAGGTGAACCACTTGAACCTGG + Intronic
1119507314 14:75184063-75184085 GTGGGAGAATCGCTTGAGCCAGG - Intergenic
1119546706 14:75477269-75477291 GAGGGAGGATCACTGGAGCCCGG - Intergenic
1119742139 14:77020808-77020830 GAGGGAGAATCGCTTGAACCTGG - Intergenic
1119828469 14:77678907-77678929 GAGGGAGGATCGCTTGAGCCTGG - Intronic
1120294682 14:82624684-82624706 GAGGGAGAATCTCTTGAGCCTGG - Intergenic
1120485592 14:85109761-85109783 GAGGGAGGATCGCTTGAGCCTGG + Intergenic
1120572469 14:86138506-86138528 GAGGCAGAATCACTGGAGCCCGG + Intergenic
1121175550 14:91888203-91888225 GAGGGAGAATCACTTGAGCCTGG + Intronic
1121382767 14:93489033-93489055 GAAGGAGAATCGCTTGAGCCAGG - Intronic
1121395209 14:93615626-93615648 GCAGGTGAATCGCTGGAACCTGG + Intronic
1121426419 14:93855271-93855293 GCAGGAGAACCGCTGGAACCTGG + Intergenic
1122349328 14:101078339-101078361 AGAGGTGAACAGCTGGAGCCAGG - Intergenic
1122495167 14:102148444-102148466 GTGGGAGAATTGCTGGAGCCTGG + Intronic
1122554633 14:102571015-102571037 GAGGATCAATCGCTTGAGCCTGG + Intergenic
1122711095 14:103658749-103658771 GCAGGAGAATCGCTGGAGCCCGG - Intronic
1122927258 14:104910784-104910806 GTGGGAGAATCGCTGGAACCTGG - Intergenic
1124010613 15:25835723-25835745 GTGGGAGGACCGCTTGAGCCCGG - Intronic
1124578923 15:30934607-30934629 GCAGGTGAACTGCTTGAGCCTGG - Intronic
1124898299 15:33798180-33798202 GCAGGAGAACCGCTTGAGCCTGG - Intronic
1125550807 15:40543046-40543068 GAGGGAGGACAGCTTGAGCCCGG + Intronic
1125652638 15:41330182-41330204 GAGGGAGAATCGCTTGAACCCGG - Intronic
1125971565 15:43916044-43916066 GAGTGTGAACCACCGGTGCCTGG - Intronic
1126014019 15:44332461-44332483 GCAGGAGAACCGCTTGAGCCTGG + Intronic
1126034071 15:44531246-44531268 GCGGGAGAATCGCTGGAACCCGG - Intergenic
1126129824 15:45329608-45329630 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1126167909 15:45669261-45669283 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1126314367 15:47353657-47353679 GAAGATAAACTGCTGGAGCCTGG + Intronic
1126783300 15:52156635-52156657 GTGGGAGAACTGCTTGAGCCCGG + Intronic
1127281656 15:57498341-57498363 GTGGGAGAATCGCTTGAGCCCGG - Intronic
1127422948 15:58826321-58826343 GAAGGAGAATCGCTTGAGCCTGG - Intronic
1127467173 15:59255486-59255508 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1127470054 15:59282615-59282637 GAGGGAGGACTGCTTGAGCCCGG + Intronic
1128002516 15:64206511-64206533 GTAGGAGAACCGCTGGAACCTGG + Intronic
1128334410 15:66776941-66776963 GAGGGAGAATCGCTTGAGCCTGG + Intronic
1128559956 15:68658254-68658276 GAGAGGGAACAGCTGGGGCCAGG + Intronic
1128856082 15:71017014-71017036 GAGGGAGAATCACTTGAGCCTGG + Intronic
1129278597 15:74465103-74465125 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1129676084 15:77632955-77632977 GCGAGTGAGCCGCGGGAGCCGGG + Intronic
1129846480 15:78770067-78770089 GAAGGAGAATCGCTGGAGCCTGG + Intronic
1130530001 15:84739877-84739899 GAAGGAGAATCGCTTGAGCCCGG - Intergenic
1130767396 15:86884716-86884738 GTGGGAGAACCGCTTGAACCTGG + Intronic
1130978521 15:88795799-88795821 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1131028944 15:89170187-89170209 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1131142234 15:89986482-89986504 GAGGGAGAATCGCTTGAGCCCGG + Intergenic
1131261333 15:90889569-90889591 GAGGGTGAACCGCTGGAGCCTGG + Exonic
1131300474 15:91195249-91195271 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1131301903 15:91207113-91207135 GAGGGAGGATCACTGGAGCCCGG - Intronic
1131474779 15:92728706-92728728 GTGGGAGGATCGCTGGAGCCTGG - Intronic
1131690557 15:94822937-94822959 GAGGGAGGACCACTTGAGCCTGG + Intergenic
1131848131 15:96509829-96509851 GCAGGAGAATCGCTGGAGCCTGG - Intergenic
1132514548 16:360086-360108 GAGGGGGAACCGCTGGGCACTGG - Intergenic
1132735037 16:1381524-1381546 GAGGGAGAATCGCTTGAACCCGG + Intronic
1132756832 16:1489487-1489509 GAAGGAGAATCGCTTGAGCCGGG - Intergenic
1132871523 16:2117661-2117683 GCGGGTGCACCGCTGGAGACCGG + Exonic
1132914625 16:2337004-2337026 GAGGGAGGATCGCTTGAGCCTGG - Intronic
1133040174 16:3056491-3056513 GCAGGAGAATCGCTGGAGCCCGG - Intronic
1133143960 16:3769962-3769984 GCGGGAGAATCGCTTGAGCCTGG - Intronic
1133158115 16:3890073-3890095 GTGGGAGAACTGCTTGAGCCTGG - Intergenic
1133273154 16:4620943-4620965 GAAGGAGAACCGCTTGAACCTGG + Intronic
1133800097 16:9078272-9078294 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1133821045 16:9236872-9236894 GTGGGAGGACCGCTTGAGCCTGG + Intergenic
1133940515 16:10305365-10305387 GAGGGAGAATCGCTTGAGCCTGG + Intergenic
1133996177 16:10750336-10750358 GAGGCAGAACTGCTTGAGCCCGG - Intronic
1134080967 16:11324745-11324767 GAGGGAGGACTGCTTGAGCCCGG - Intronic
1134183934 16:12068392-12068414 GTGGGAGGACCACTGGAGCCTGG + Intronic
1134474089 16:14556250-14556272 GCGGGTGAATCGCTGGAACCTGG - Intronic
1134478470 16:14596650-14596672 GAGGGAGGATCGCTTGAGCCCGG + Intronic
1134521006 16:14919234-14919256 GCGGGTGCACCGCTGGAGACCGG - Intronic
1134550566 16:15136739-15136761 GCGGGTGCACCGCTGGAGACCGG + Intronic
1134676301 16:16092893-16092915 GTGGGGGAATCGCTTGAGCCTGG + Intronic
1134682301 16:16134728-16134750 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1134684421 16:16148678-16148700 GTGGGAGAATCGCTTGAGCCCGG + Intergenic
1134708682 16:16317885-16317907 GCGGGTGCACCGCTGGAGACCGG - Intergenic
1134715895 16:16357918-16357940 GCGGGTGCACCGCTGGAGACCGG - Intergenic
1134958861 16:18394241-18394263 GCGGGTGCACCGCTGGAGACCGG + Intergenic
1135074720 16:19383364-19383386 GAGGGTGCACGGAGGGAGCCGGG - Intergenic
1135148677 16:19986246-19986268 AAGGGCCAACAGCTGGAGCCTGG - Intergenic
1135679043 16:24441297-24441319 GAGGGAGGATCGCTTGAGCCTGG - Intergenic
1135688661 16:24518953-24518975 GTGGGAGAATCGCTGGAACCCGG - Intergenic
1136180397 16:28547921-28547943 GAGGGAGGATCGCTTGAGCCGGG + Intergenic
1136632022 16:31494420-31494442 GAGGCTGAACTGCTTGAGCCTGG + Intronic
1137644283 16:50060579-50060601 GATGGTCAACCCCTGGGGCCTGG - Intergenic
1137661103 16:50207273-50207295 GTGGGAGAATCGCTTGAGCCCGG - Intronic
1138644021 16:58409799-58409821 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1138699983 16:58852328-58852350 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
1138812722 16:60169830-60169852 GTGGGAGAACAGCTTGAGCCTGG - Intergenic
1139298391 16:65922670-65922692 GTGGGAGGACCGCTTGAGCCTGG + Intergenic
1139399264 16:66667229-66667251 GAAGGAGAATCGCTGGAACCTGG + Intronic
1139457909 16:67097137-67097159 GTGGGAGAATCGCTTGAGCCGGG + Intronic
1139627646 16:68203537-68203559 GTGGGAGGATCGCTGGAGCCTGG + Intronic
1139788598 16:69414018-69414040 GAGGGAGAATCGCTTGAACCCGG - Intergenic
1139871198 16:70110030-70110052 GAAGGAGAATCGCTTGAGCCTGG + Intergenic
1139989476 16:70928232-70928254 GCGGGTGGACTGCTTGAGCCCGG + Intronic
1140068254 16:71627408-71627430 GAGGGAGAATCGCTTGAACCCGG + Intronic
1140171112 16:72605947-72605969 GCGGGAGAATCGCTGGAGCCTGG + Intergenic
1140202212 16:72903903-72903925 GAGGAGGAAGCGATGGAGCCTGG - Intronic
1140204063 16:72919250-72919272 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1140375668 16:74443860-74443882 GAAGGAGAATCGCTTGAGCCTGG - Intergenic
1140404267 16:74697723-74697745 GCGGGAGAATCGCTTGAGCCTGG + Intronic
1140501778 16:75439552-75439574 GCAGGTGAATCGCTGGAACCCGG - Intronic
1140508491 16:75490077-75490099 GAGGGAGAATCGCTTGAACCCGG + Intronic
1140737664 16:77912509-77912531 GAGGGAGGACCGCTTGAGCCTGG - Intronic
1140810498 16:78572507-78572529 GAGGGAGGACCTCTTGAGCCGGG + Intronic
1141528744 16:84630770-84630792 GTGGGTGAATTGCTCGAGCCTGG - Intergenic
1141547893 16:84784462-84784484 GAGGGAGAATCGCTTGAACCCGG - Intergenic
1141554087 16:84825660-84825682 GGAGGAGAACCGCTTGAGCCTGG + Intronic
1141606162 16:85154544-85154566 GAGGGAGAATCACTTGAGCCAGG - Intergenic
1141971332 16:87485132-87485154 AAGGGTGAACGGCTGGGTCCAGG + Intronic
1142222929 16:88864291-88864313 AAGGGTGCCCCCCTGGAGCCTGG + Exonic
1142266451 16:89066099-89066121 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1142578966 17:928740-928762 GAGGGAGAATCGCTTGAACCCGG + Intronic
1142591381 17:1007550-1007572 GATGGTGAACTGCCAGAGCCAGG + Intronic
1142632762 17:1236119-1236141 GAGGGAGGACTGCTTGAGCCTGG - Intergenic
1142645176 17:1307106-1307128 GAAGGTGTCCAGCTGGAGCCAGG + Intergenic
1142720167 17:1770686-1770708 GCGGGTGGATCGCTTGAGCCCGG - Intronic
1142739285 17:1921321-1921343 GAGGGTGAAACGAAGGAGTCCGG + Intergenic
1142790024 17:2256679-2256701 GTGGGAGAACTGCTGGAGCCTGG + Intronic
1142887680 17:2922970-2922992 GCAGGAGAATCGCTGGAGCCTGG - Intronic
1142897244 17:2989424-2989446 GTGGGAGAATCGCTGGAACCCGG - Intronic
1143170329 17:4925777-4925799 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1143380845 17:6495549-6495571 GAGCGTGAACCCTTGCAGCCAGG + Intronic
1143493215 17:7295569-7295591 GAGGGAGAATCGCTTGAACCCGG - Intergenic
1143605230 17:7980453-7980475 GAGGGTGGATCACTTGAGCCTGG - Intergenic
1143610562 17:8015520-8015542 GAGGGAGATGGGCTGGAGCCTGG - Intronic
1144203968 17:12966060-12966082 ACGGGTGAACCCCTTGAGCCTGG + Intronic
1144328222 17:14202316-14202338 GAGGGAGGATCGCTTGAGCCTGG - Intronic
1144727890 17:17511000-17511022 GAGGTTGGACCGATGGAGCCAGG - Intronic
1144755321 17:17676752-17676774 GTGGGAGAATCGCTTGAGCCAGG - Intergenic
1144866969 17:18342408-18342430 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1144940718 17:18938160-18938182 GAGGGAGGATCGCTTGAGCCTGG - Intergenic
1145145938 17:20479716-20479738 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1145229027 17:21157598-21157620 GTGGGAGAACTGCTTGAGCCTGG + Intronic
1145762933 17:27437061-27437083 GAGGGAGAATCGCTTCAGCCTGG + Intergenic
1145840724 17:27992056-27992078 GAGGGAGGATCACTGGAGCCTGG - Intergenic
1146070197 17:29673474-29673496 GAGGGAGAATCGCTTGAACCTGG + Intronic
1146400988 17:32499867-32499889 GTGGAAGAATCGCTGGAGCCTGG + Intronic
1146774427 17:35600173-35600195 GCAGGAGAACCGCTTGAGCCTGG - Intronic
1146939101 17:36831623-36831645 GTGGGAGAATCGCTTGAGCCGGG + Intergenic
1147190827 17:38737035-38737057 GTGGGAGAATCGCTTGAGCCCGG + Intronic
1147285984 17:39402485-39402507 GGGGGTGCAGGGCTGGAGCCGGG + Intronic
1147341134 17:39753946-39753968 GAGGGTGGCTCGGTGGAGCCTGG - Intergenic
1147501199 17:40965280-40965302 GAGGGAGAATCGCTTGAACCTGG + Intronic
1147587570 17:41661067-41661089 GAGGGTGGAGCCATGGAGCCTGG + Intergenic
1147634163 17:41952830-41952852 GAGGGAGAATCACCGGAGCCTGG - Intronic
1147729666 17:42590576-42590598 GTGGGAGAATTGCTGGAGCCCGG + Intronic
1147738193 17:42654256-42654278 GAGGGAGGACCGCTTGAGCCCGG + Intergenic
1147774509 17:42891117-42891139 GTGGGAGAACCACTTGAGCCAGG - Intergenic
1147796591 17:43048122-43048144 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1147812611 17:43183590-43183612 GTGGGAGAACTGCTTGAGCCTGG - Intronic
1147860515 17:43519577-43519599 GAGGGAGAATCGCTTGAGTCCGG - Intronic
1147871021 17:43587596-43587618 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1148017502 17:44532573-44532595 GAAGGAGAACTGCTGGAACCTGG - Intergenic
1148072890 17:44918580-44918602 GTGGGTGGATCGCTTGAGCCAGG - Intergenic
1148162541 17:45459032-45459054 GCGGGAGAATCGCTTGAGCCAGG + Intronic
1148253332 17:46105775-46105797 GAGGGAGGATCGCTTGAGCCTGG + Intronic
1148382225 17:47208338-47208360 GTGGGAGAATCGCTTGAGCCAGG + Intronic
1148453144 17:47794064-47794086 CAGGGAGAACCGCTTGAACCTGG + Intergenic
1148489090 17:48011912-48011934 GAGAGGGGACCGCTGGAGCCTGG - Intergenic
1148532360 17:48406495-48406517 GTGGGTGAATCACTTGAGCCCGG - Intronic
1148662632 17:49347469-49347491 GTGGGAGGACCGCTGGAGCCTGG + Intronic
1148696716 17:49564483-49564505 GAGGGAGAATGGCTTGAGCCTGG + Intergenic
1148992232 17:51676281-51676303 GAGGGTGAACATCTAGAGCCAGG + Intronic
1149462360 17:56840467-56840489 GCGGGTGAATCACTTGAGCCTGG - Intronic
1149484390 17:57030653-57030675 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1149692508 17:58589791-58589813 GTGGGAGGATCGCTGGAGCCTGG - Intronic
1149759871 17:59219616-59219638 AAGGGTGGATCGCTTGAGCCCGG - Intergenic
1149993521 17:61395702-61395724 GAGGCGGCACAGCTGGAGCCCGG + Intergenic
1150100416 17:62418466-62418488 GCAGGTGAAACGCTTGAGCCTGG - Intergenic
1150393769 17:64805696-64805718 GAGTGAGAATCGCTTGAGCCAGG + Intergenic
1150575219 17:66424841-66424863 GCGGGAGAATCGCTTGAGCCCGG - Intronic
1150922294 17:69496363-69496385 GCGGGAGAATCGCTGGAACCCGG - Intronic
1151408519 17:73904861-73904883 GTGGGTGAATCGCTGGAACCCGG + Intergenic
1151531165 17:74705821-74705843 GTGGGTGGATCGCTTGAGCCCGG - Intronic
1152030104 17:77837074-77837096 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1152175412 17:78783561-78783583 GTGGGAGAACTGCTTGAGCCTGG - Intergenic
1152343908 17:79740102-79740124 GTGGGAGGATCGCTGGAGCCCGG + Intronic
1152368797 17:79872365-79872387 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1152433541 17:80261921-80261943 GCGGGAGAATCGCTAGAGCCCGG + Intronic
1152522304 17:80863824-80863846 GCGGGAGAATCGCTTGAGCCCGG + Intronic
1152722654 17:81930432-81930454 GTGGGAGAATCGCTTGAGCCCGG + Intergenic
1152728114 17:81957651-81957673 GAGGGTGAGAGGCTGGAGCTGGG - Intronic
1152889000 17:82869424-82869446 GAGGGAGGATCGCTTGAGCCTGG + Intronic
1153270005 18:3311177-3311199 GTGGGAGAATCGCTTGAGCCCGG - Intergenic
1153558694 18:6347139-6347161 GAGGGTGAAATGATGGTGCCGGG + Intronic
1153622042 18:6988711-6988733 GAGGGAGAATCGCTTGAACCCGG + Intronic
1153887447 18:9479243-9479265 GTGGGAGGATCGCTGGAGCCTGG - Intronic
1153984900 18:10343238-10343260 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1154092506 18:11378631-11378653 GCGGGAGAATCGCTGGAGCCTGG - Intergenic
1155356979 18:24962387-24962409 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1155466492 18:26141778-26141800 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1156246029 18:35299551-35299573 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1156903116 18:42324242-42324264 GAGGGAGGATCGCTTGAGCCGGG + Intergenic
1157557423 18:48621914-48621936 GTGGATGAACCGCTGGGGGCTGG - Intronic
1158237979 18:55340488-55340510 GTGGGAGGACCGCTTGAGCCTGG + Intronic
1158489936 18:57900837-57900859 GAAGGAGAATCGCTGGAACCTGG + Intergenic
1158518837 18:58153431-58153453 GCAGGAGAACCGCTGGAACCTGG - Intronic
1158550083 18:58428507-58428529 GCGGGAGAATCGCTTGAGCCCGG + Intergenic
1158567979 18:58571247-58571269 GTGGGTGAATCACTTGAGCCAGG - Intronic
1158809648 18:61017580-61017602 GACGGTGAACCTCTGGATGCTGG - Intergenic
1159379850 18:67643239-67643261 GAGGTTGAACCCCTGCAGCTTGG + Intergenic
1159402842 18:67959695-67959717 GAAGGAGAATCGCTTGAGCCCGG + Intergenic
1159597208 18:70394141-70394163 GTGGGAGAATCGCTTGAGCCCGG + Intergenic
1160136386 18:76275010-76275032 GTGGGTGCACCGGTGGATCCTGG - Intergenic
1160799093 19:959503-959525 GCGGGTGAATCGCTTGAGCCCGG - Intronic
1160985011 19:1834505-1834527 GCGGGAGGATCGCTGGAGCCGGG - Intronic
1161286853 19:3472750-3472772 GAGGGTGGATTGCTTGAGCCTGG + Intergenic
1161291496 19:3496103-3496125 GCGGGAGAATCGCTGGAGCCCGG - Intronic
1161366928 19:3885458-3885480 GCGGGAGAATCGCTTGAGCCTGG + Intronic
1161412960 19:4127105-4127127 GTGGGAGAATCGCTTGAGCCAGG - Intergenic
1161745269 19:6055515-6055537 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1161822703 19:6540296-6540318 GTGGGAGAATCGCTTGAGCCCGG - Intergenic
1161863465 19:6816868-6816890 GTGGGAGAACCGCTTGAACCTGG + Intronic
1161956423 19:7498302-7498324 GCGGGAGAACCGCTTGAACCTGG - Intronic
1161996246 19:7713537-7713559 GAGGGAGAATCGCTTGAACCTGG + Intergenic
1162171145 19:8790042-8790064 GCGGGTGGATCGCTTGAGCCCGG - Intergenic
1162271189 19:9616953-9616975 GTGGGAGAATCGCTGGAGCCTGG - Intronic
1162276288 19:9657917-9657939 GTGGGAGAATCGCTGGAGCCTGG - Intronic
1162407388 19:10483397-10483419 GAAGGAGAACCGCTTGAACCCGG - Intergenic
1162428641 19:10613149-10613171 GTGGGAGAATCGCTTGAGCCCGG - Intronic
1162472422 19:10880437-10880459 GAGGGAGAATCCCTTGAGCCTGG - Intronic
1162484079 19:10947946-10947968 GCAGGAGAATCGCTGGAGCCTGG + Intergenic
1162583638 19:11545870-11545892 GTGGGAGGATCGCTGGAGCCTGG + Intronic
1162586577 19:11563025-11563047 GTGGGAGGACTGCTGGAGCCTGG - Intronic
1162651332 19:12091210-12091232 GAGGTTGGACCTCAGGAGCCTGG + Intergenic
1162654222 19:12116688-12116710 GTGGTTGGACCTCTGGAGCCTGG + Intronic
1162748999 19:12816779-12816801 GCAGGAGAATCGCTGGAGCCCGG - Intronic
1162855208 19:13462851-13462873 GTGGGTGGATCGCTTGAGCCTGG - Intronic
1162918507 19:13886872-13886894 GAGGATCAACTGCTTGAGCCCGG + Intronic
1163113320 19:15174665-15174687 GCGGGAGAATCGCTGGAACCGGG - Intronic
1163132684 19:15285469-15285491 GAGGGAGGATCGCTTGAGCCTGG + Intronic
1163134539 19:15300149-15300171 GAGGGAGGACCGCTTGAACCCGG + Intronic
1163247896 19:16108622-16108644 GTGGGAGAATCACTGGAGCCTGG + Intergenic
1163249400 19:16117576-16117598 GCGGGTGAACAGTGGGAGCCTGG + Intronic
1163534594 19:17869963-17869985 GCGGGAGAATCGCTTGAGCCCGG - Intergenic
1163684641 19:18704315-18704337 GAGGGTGGATCACTTGAGCCTGG - Intronic
1164614191 19:29656391-29656413 GTGGGAGAACCGCTTGAACCCGG - Intergenic
1164614794 19:29660691-29660713 GAGGGAGGATCGCTTGAGCCTGG - Intergenic
1164630474 19:29758568-29758590 GCGGGAGAATCGCTTGAGCCTGG + Intergenic
1164676103 19:30102838-30102860 GATGGTGAGAAGCTGGAGCCTGG - Intergenic
1165144759 19:33724198-33724220 GTGGGGTAACCGGTGGAGCCTGG - Intronic
1165223231 19:34334947-34334969 GCAGGAGAACCGCTTGAGCCTGG + Intronic
1165301668 19:34973727-34973749 GAGGGAGAATCGCTTGAACCCGG - Intergenic
1165385883 19:35510509-35510531 GGGTGGGAACCCCTGGAGCCCGG + Intronic
1165449293 19:35872951-35872973 GAAGGGGAATCGCTGGAGCCCGG - Intronic
1165559110 19:36663756-36663778 GTGGGAGAATCGCTGGAGTCTGG - Intronic
1165646022 19:37438170-37438192 GTGGGAGAACTGCTTGAGCCTGG + Intronic
1165712663 19:38023239-38023261 GAGGGTGAGGCGGTGGGGCCGGG + Intronic
1165743015 19:38214758-38214780 GTGGGAGGATCGCTGGAGCCTGG - Intronic
1165836012 19:38756521-38756543 GTGGGTGTATTGCTGGAGCCTGG + Intronic
1165889875 19:39105107-39105129 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1165892614 19:39123284-39123306 GAGGGAGAATCGCTTGAGCCCGG + Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166134470 19:40767238-40767260 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1166341872 19:42142790-42142812 GAGGGAGGATCGCTTGAGCCCGG - Intronic
1166514396 19:43435315-43435337 GAGGGAGCACCTCTTGAGCCTGG + Intergenic
1166683157 19:44780564-44780586 GCAGGAGAATCGCTGGAGCCCGG - Intronic
1166795278 19:45422051-45422073 AAGGGTGAAACGCTGGTGGCTGG - Intronic
1166998910 19:46733369-46733391 GACGGGGAACTGCTGGAGCGAGG - Intronic
1167214153 19:48153099-48153121 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1167288206 19:48610682-48610704 GGGGGTGAACCCCTGGAACACGG - Exonic
1167302966 19:48690010-48690032 GAGGGAGAATCGCTTGAACCCGG - Intergenic
1167322099 19:48803432-48803454 GCAGGTGGATCGCTGGAGCCTGG + Intronic
1167330291 19:48851520-48851542 GTGGGTGAATCGCTTGAGCCCGG + Intronic
1167333612 19:48871410-48871432 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1167512185 19:49901288-49901310 GCGGGAGAATCGCTCGAGCCTGG + Intronic
1167700501 19:51041419-51041441 GCGGGAGAACCGCTTGAACCCGG + Intergenic
1167880123 19:52450778-52450800 GCAGGTGAATCGCTTGAGCCTGG - Intronic
1167976811 19:53233971-53233993 GCAGGAGAACCGCTTGAGCCTGG + Intergenic
1168050329 19:53824991-53825013 GTGGGAGAATCGCTGGAACCTGG - Intergenic
1168665088 19:58198947-58198969 GTGGGAGAATTGCTGGAGCCAGG + Intronic
926188960 2:10712921-10712943 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
926251710 2:11158724-11158746 GCAGGAGAACCGCTGGAACCCGG + Intronic
926852325 2:17213667-17213689 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
927024119 2:19048014-19048036 GTAGGAGAACCGCTTGAGCCTGG + Intergenic
928391932 2:30916981-30917003 GAAGGAGAATTGCTGGAGCCTGG + Intronic
928500079 2:31882048-31882070 GTGGGAGAATCGCTTGAGCCCGG + Intronic
928530037 2:32181772-32181794 GTGGGAGAATCGCTTGAGCCTGG + Intronic
928630815 2:33189931-33189953 GCAGGAGAACCACTGGAGCCTGG + Intronic
928697641 2:33865727-33865749 GCAGGAGAATCGCTGGAGCCCGG + Intergenic
928735592 2:34284704-34284726 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
929609361 2:43258426-43258448 GTGGGAGAATCGCTTGAGCCTGG + Intronic
929640253 2:43571160-43571182 GAGGAAGAATCGCTTGAGCCTGG + Intronic
929912347 2:46100960-46100982 GAGGGAGAATCGCTTGAACCTGG - Intronic
930896575 2:56453258-56453280 GCGGGAGAATCGCTGGAACCCGG - Intergenic
931447492 2:62338861-62338883 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
931725203 2:65103225-65103247 GTGGGAGAACAGCTTGAGCCTGG + Intronic
931757998 2:65390992-65391014 GTGGGAGAATCGCTTGAGCCTGG + Intronic
932041722 2:68306206-68306228 GTGGGAGAACCGCTTGAGTCTGG + Intronic
932269916 2:70400151-70400173 GAGGGCAAATCGCTTGAGCCCGG + Intergenic
932787921 2:74623763-74623785 GAGAGAGAATCGCTTGAGCCTGG - Intronic
932895405 2:75634703-75634725 ATGGGAGAACCCCTGGAGCCCGG + Intergenic
933232347 2:79823422-79823444 GTGGGAGAATCGCTTGAGCCTGG + Intronic
933254972 2:80070621-80070643 GAGGGAGGATCGCTTGAGCCTGG + Intronic
933710674 2:85323470-85323492 GAGGGAGAACTGCTTGAACCCGG + Intronic
933866907 2:86527865-86527887 GCGGGCGAATCGCTTGAGCCTGG + Intronic
933890364 2:86762944-86762966 GCGGGAGAATCGCTTGAGCCTGG + Intronic
933989751 2:87625652-87625674 GGGGGTACACCACTGGAGCCTGG + Intergenic
934902455 2:98171589-98171611 GAGGGTGAACCCCTGTACCGCGG - Intronic
935027188 2:99288660-99288682 GCAGGAGAATCGCTGGAGCCTGG - Intronic
935117035 2:100145641-100145663 GCAGGAGAACCGCTGGAGCCTGG + Intergenic
935168640 2:100591900-100591922 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
935211326 2:100941467-100941489 GTGGGAGAATCGCTTGAGCCTGG + Intronic
935965197 2:108465946-108465968 GAGGGAGAACAGCTTGAACCTGG - Intronic
936304093 2:111325174-111325196 GGGGGTACACCACTGGAGCCTGG - Intergenic
937226816 2:120375032-120375054 GGGGGTGAGGCGCTGTAGCCAGG - Intergenic
937419187 2:121740353-121740375 GTGGGAGAACCGCTTGAACCTGG + Intronic
937429834 2:121829097-121829119 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
938458301 2:131481360-131481382 GTGAGAGAATCGCTGGAGCCTGG - Intronic
938839663 2:135147704-135147726 GTGGGAGGACCGCTTGAGCCTGG - Intronic
938881691 2:135596090-135596112 GCAGGAGAATCGCTGGAGCCTGG - Intronic
939128131 2:138202634-138202656 GAGGGAGGATCGCTTGAGCCTGG + Intergenic
939392312 2:141584149-141584171 GAGGGAGGATCACTGGAGCCCGG + Intronic
939534806 2:143414833-143414855 GAGGCAGAACCGCTAGAACCTGG + Intronic
940129096 2:150361273-150361295 GAGGGAGAATCGCTTGAACCTGG + Intergenic
940737752 2:157472401-157472423 GAGGGAGGATCGCTTGAGCCTGG + Intronic
940865230 2:158811110-158811132 GAGGGGGAAATGCTGAAGCCTGG + Intronic
940968692 2:159870221-159870243 GAAGGTGAATCGCTTGAGCCAGG + Intronic
942167607 2:173257068-173257090 GTGGGAGAATCGCTGGAGCTTGG + Intronic
942206149 2:173621411-173621433 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
943157435 2:184201238-184201260 GCGGGAGAACTGCTGGAGGCCGG + Intergenic
943294592 2:186120865-186120887 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
943614241 2:190073946-190073968 GAGGCTGAATCGCTTGAACCTGG + Intronic
944210179 2:197198697-197198719 GCAGGTGAATCGCTTGAGCCCGG + Intronic
944246846 2:197539410-197539432 GAGGGAGAACTGCTTGAACCTGG - Intronic
944252230 2:197589998-197590020 GTGGGGGGATCGCTGGAGCCTGG - Intronic
944447365 2:199805087-199805109 GAGAAAGAACAGCTGGAGCCTGG + Intronic
944572846 2:201062009-201062031 GAGGGAGGACTGCTTGAGCCTGG + Intronic
944966549 2:204941278-204941300 GGAGGAGAATCGCTGGAGCCCGG + Intronic
945410512 2:209500804-209500826 GAGGGTGGATCACTTGAGCCCGG + Intronic
945880355 2:215318972-215318994 GTGGGAGAACTGCTTGAGCCTGG - Intronic
946299866 2:218816240-218816262 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
946356412 2:219188333-219188355 GTGGGAGAACCGCTTGAACCCGG + Intergenic
946588688 2:221219178-221219200 GAAGGAGAACCGCTTGAACCCGG + Intergenic
946860787 2:223998620-223998642 GTGGGAGGATCGCTGGAGCCTGG + Intronic
947428807 2:230007691-230007713 GAGGGAGAATCGCTTGAACCTGG - Intronic
947486292 2:230552392-230552414 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
947628873 2:231638676-231638698 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
947629625 2:231643644-231643666 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
947778266 2:232732856-232732878 GTGGGTGGATCGCTTGAGCCCGG - Intronic
948686372 2:239672472-239672494 GCGGGAGAATCGCTGGAGCCTGG - Intergenic
948917304 2:241040969-241040991 GTGGGTGAGCCTCTGGAGGCAGG - Intronic
948938561 2:241184458-241184480 GCGGGAGAATCGCTTGAGCCCGG - Intergenic
948970818 2:241425111-241425133 GAAGGAGAACCGCTTGAGCCTGG + Intronic
948984330 2:241510926-241510948 GTGGGAGAACTGCTTGAGCCTGG - Intergenic
948997982 2:241593778-241593800 GTGGGAGAATCGCTTGAGCCTGG - Intronic
949058051 2:241939952-241939974 CCAGGTGAACCTCTGGAGCCCGG + Intergenic
1169022586 20:2340715-2340737 GAGGGGGATGTGCTGGAGCCTGG - Exonic
1169295946 20:4399152-4399174 GTGGGAGAACTGCTTGAGCCTGG - Intergenic
1169369864 20:5020382-5020404 GAAGGAGAATCGCTTGAGCCCGG + Intergenic
1169449364 20:5698239-5698261 GAGGGAAAACTGCTTGAGCCAGG - Intergenic
1170230078 20:14036755-14036777 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1170558603 20:17536320-17536342 GCGGGTGGACTGCTTGAGCCCGG + Intronic
1170620764 20:17994044-17994066 GAGGGAGGATCGCTTGAGCCTGG + Intronic
1170780925 20:19424592-19424614 GAGGCAGAATCGCTTGAGCCTGG + Intronic
1171479292 20:25440715-25440737 GCAGGAGAACCGCTTGAGCCTGG + Intronic
1171541086 20:25957061-25957083 GAAGGAGAATCGCTTGAGCCTGG - Intergenic
1171980051 20:31621469-31621491 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
1172169976 20:32924145-32924167 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1172551908 20:35807444-35807466 CAGGGAGAACTGCTTGAGCCTGG - Intronic
1172566840 20:35937372-35937394 GAGGGAGAATCGCTTGAACCTGG + Intronic
1172589444 20:36106894-36106916 GAAGGAGAATCGCTTGAGCCTGG - Intronic
1172670995 20:36634375-36634397 GTGGGAGAATCGCTGGAGCTCGG - Intronic
1172763625 20:37339064-37339086 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1172770537 20:37379800-37379822 GCAGGAGAACCGCTGGAACCCGG + Intronic
1172774744 20:37400477-37400499 GTGGGAGAACTGCTTGAGCCTGG - Intronic
1172886271 20:38233026-38233048 GTGGGAGAATCGCTTGAGCCGGG + Intronic
1173203608 20:40972991-40973013 GCAGGAGAACCGCTGAAGCCTGG - Intergenic
1173240490 20:41291947-41291969 GCTGGAGAACCGCTTGAGCCAGG + Intronic
1173282774 20:41644034-41644056 GAAGGTGAGCTGCTGGAGCAAGG + Intergenic
1174455090 20:50643213-50643235 GCGGGAGAATCACTGGAGCCTGG - Intronic
1174492627 20:50912238-50912260 GTGGGAGAATCGCTGGAACCTGG - Intronic
1174546197 20:51327118-51327140 GTGGGAGGATCGCTGGAGCCTGG - Intergenic
1174610367 20:51793392-51793414 GCAGGAGAACCGCTTGAGCCTGG + Intronic
1174616354 20:51838480-51838502 GAGGGAGAATCGCTTGAACCCGG - Intergenic
1175132734 20:56801723-56801745 GTGGGAGGACTGCTGGAGCCTGG - Intergenic
1175837059 20:62002721-62002743 GTGGGAGAATCGCTTGAGCCCGG - Intronic
1176005379 20:62859812-62859834 GCGGGAGAATCGCTTGAGCCTGG - Intronic
1176310911 21:5148374-5148396 GAGGGTGAGCCGCTGGTCCCAGG - Intronic
1177136220 21:17307597-17307619 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1177717457 21:24857330-24857352 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1178021090 21:28409272-28409294 GAGGCTGAATCGCTTGAACCTGG - Intergenic
1178280410 21:31277549-31277571 GCGGGAGAATCGCTGGAACCCGG + Intronic
1178538261 21:33428313-33428335 GTGGGTGGACTGCTTGAGCCGGG - Intronic
1178727973 21:35071989-35072011 GAGGGAGAATTGCTTGAGCCAGG + Intronic
1178949660 21:36975677-36975699 GCGGGAGAACTGCTGGAGCCCGG + Intronic
1179103754 21:38379917-38379939 GCGGGTGGATCGCTTGAGCCCGG - Intergenic
1179846144 21:44113661-44113683 GAGGGTGAGCCGCTGGTCCCAGG + Intronic
1180139537 21:45884652-45884674 GTGGGAGGACGGCTGGAGCCTGG - Intronic
1180218039 21:46338872-46338894 GCGGGAGAACCCCTTGAGCCTGG - Intronic
1180237035 21:46468333-46468355 CAGGGAGAACCGCTTGAACCTGG + Intronic
1180342010 22:11627496-11627518 GGGGGGGAACGGGTGGAGCCAGG - Intergenic
1180682869 22:17640758-17640780 GAGGGAGGACTGCTTGAGCCCGG + Intronic
1180795449 22:18602269-18602291 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1181226291 22:21393043-21393065 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1181252359 22:21541813-21541835 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1181272181 22:21665641-21665663 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1181314607 22:21963241-21963263 CAGGGTGAACTGCTTGAACCTGG + Intronic
1181719551 22:24763392-24763414 GCAGGAGAATCGCTGGAGCCCGG - Intronic
1181807020 22:25380984-25381006 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1181925657 22:26356546-26356568 GCGGGAGAATCGCTGGAACCCGG + Intronic
1181962905 22:26635872-26635894 GTGGGAGGACTGCTGGAGCCCGG - Intergenic
1182361214 22:29747597-29747619 GAGGGTGACTGGCAGGAGCCAGG - Intronic
1182365352 22:29775227-29775249 GAGGCAGAACTGCTGGAACCCGG - Intergenic
1182526001 22:30920124-30920146 GTGGGAGAATCGCTTGAGCCCGG - Intergenic
1182610397 22:31542532-31542554 GAAGGAGAACCGCTTGAACCCGG + Intronic
1182633125 22:31702907-31702929 GAGGGAGAATTGCTTGAGCCCGG - Intronic
1182759481 22:32710537-32710559 GCGGGAGAACTGCTTGAGCCTGG + Intronic
1182831023 22:33304522-33304544 GAGGGTGAGCCGCGGGACCTGGG + Intronic
1183393489 22:37559327-37559349 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1183693808 22:39407575-39407597 GAAGGAGAATCGCTGGAACCCGG - Intronic
1183698615 22:39437384-39437406 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1183820716 22:40343965-40343987 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1183879878 22:40818610-40818632 GTGGGCGGATCGCTGGAGCCCGG + Intronic
1183881371 22:40833775-40833797 GCAGGAGAACCGCTTGAGCCCGG + Intronic
1184029259 22:41881976-41881998 GTGGGAGAATCACTGGAGCCTGG + Intronic
1184094567 22:42309526-42309548 GAGGGGGAAGCTCAGGAGCCTGG - Intronic
1184226997 22:43134807-43134829 GAGGCTGGACCGCAGGAACCAGG + Intronic
1184228906 22:43147524-43147546 GAGGGAGAATTGCTTGAGCCCGG + Intergenic
1184244337 22:43228332-43228354 GAGCATGCACTGCTGGAGCCGGG - Intronic
1184273768 22:43399079-43399101 GAGGGTGAGCAGCTGAACCCAGG - Intergenic
1184434770 22:44464371-44464393 GAGGGAGAATCACTTGAGCCTGG - Intergenic
1184452525 22:44591505-44591527 GAGGGTGAGCAGCTTCAGCCCGG - Intergenic
1184462641 22:44648076-44648098 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1184473018 22:44706620-44706642 GTGGGAGGATCGCTGGAGCCTGG - Intronic
1184485717 22:44777787-44777809 GCAGGAGAACCGCTTGAGCCCGG - Intronic
1184794286 22:46722650-46722672 GAGGGAGAATCGCTTGAACCGGG - Intronic
1184881910 22:47311674-47311696 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1184909082 22:47514043-47514065 GAGGTGGAACCACTGGAGCCTGG - Intergenic
1185149271 22:49154689-49154711 CAGGGAGAACCCCTGAAGCCTGG - Intergenic
1185155764 22:49192534-49192556 GAGGGAAAGCCGCAGGAGCCCGG + Intergenic
1185251939 22:49806902-49806924 GTGGGAGAATCGCTTGAGCCCGG + Intronic
1185335602 22:50269771-50269793 GAGGGTCATCCGCTAGACCCCGG + Intronic
949506231 3:4730655-4730677 GAGGGTGAACAGCAAGACCCTGG - Intronic
949545008 3:5065219-5065241 GAAGGAGAACCGCTTGAACCTGG + Intergenic
949547345 3:5083319-5083341 GTGGGAGGACCGCTTGAGCCCGG + Intergenic
949555839 3:5151810-5151832 GTGGGTGGACTGCTTGAGCCTGG - Intronic
949691617 3:6646600-6646622 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
949842777 3:8338142-8338164 GAGGTTTAACAGCAGGAGCCTGG + Intergenic
949891229 3:8734810-8734832 GAGGGAGAATCACTTGAGCCTGG - Intronic
950349404 3:12332935-12332957 GAGGGAGGATCGCTTGAGCCCGG + Intronic
950527239 3:13531777-13531799 GCGGGAGAATCGCTTGAGCCTGG - Intergenic
950692843 3:14674064-14674086 GCAGGAGAATCGCTGGAGCCTGG + Intergenic
950975954 3:17245097-17245119 GTGGGAGAACTGCTTGAGCCTGG + Intronic
951007338 3:17633340-17633362 GAGGGAGAATTGCTGGAACCTGG + Intronic
951206036 3:19926752-19926774 GTGGGTGAATCACTTGAGCCCGG - Intronic
951914740 3:27788534-27788556 GTGGGAGAATTGCTGGAGCCTGG + Intergenic
952232552 3:31447322-31447344 GAAGGAGAATCGCTTGAGCCCGG - Intergenic
952259518 3:31726408-31726430 GAGGGGGAATCGCTTGAACCTGG - Intronic
952295792 3:32060877-32060899 GCGGGAGAACCGCTTGAACCTGG + Intronic
952444033 3:33363132-33363154 GTAGGAGAACCGCTTGAGCCTGG - Intronic
952652332 3:35741006-35741028 GTGGGAGAATCGCTTGAGCCTGG + Intronic
952763667 3:36937001-36937023 GAGGGAGAATTGCTTGAGCCCGG + Intronic
953607764 3:44423032-44423054 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
953667632 3:44937348-44937370 GCGGGAGAATCGCTTGAGCCTGG + Intronic
953924557 3:46975937-46975959 GCAGGAGAACCGCTTGAGCCTGG - Intronic
954155232 3:48681654-48681676 GTGGGTGAGCAGCTGGAGCCTGG + Exonic
954426658 3:50446986-50447008 GAAGGTGAGAAGCTGGAGCCTGG - Intronic
954451957 3:50576491-50576513 GAGGGAGAATTGCTTGAGCCCGG - Intronic
954529461 3:51305931-51305953 GTGGGAGAATCGCTTGAGCCTGG - Intronic
954787625 3:53106002-53106024 GTGGGTGGACTGCTTGAGCCAGG + Intronic
954891374 3:53932847-53932869 GTGGGAGAACCGCTTGAACCCGG + Intergenic
955194752 3:56794950-56794972 GTGGGAGAATTGCTGGAGCCAGG - Intronic
955252980 3:57303503-57303525 GTGGGAGAATCGCTTGAGCCTGG - Intronic
955306643 3:57839695-57839717 GTGGGAGAATCGCTTGAGCCTGG - Intronic
955714579 3:61815314-61815336 GAGGGAGAACCACTTCAGCCTGG + Intronic
956395268 3:68819175-68819197 GTGGGAGAACCACTTGAGCCTGG + Intronic
956617836 3:71190523-71190545 GTGGGAGAATCGCTTGAGCCCGG + Intronic
956690768 3:71875986-71876008 TGGGGTGATCCGGTGGAGCCAGG - Intergenic
959426721 3:106198716-106198738 GCAGGTGAACTGCTTGAGCCTGG + Intergenic
959537165 3:107499612-107499634 GCAGGAGAACCGCTTGAGCCCGG + Intergenic
959586830 3:108032873-108032895 GAGGGTGACCCTCTGGAGAGAGG + Intergenic
959903722 3:111687777-111687799 GATGGAGAACTGCTTGAGCCAGG - Intronic
960125492 3:113993789-113993811 GTGGGAGAATCGCTTGAGCCTGG + Intronic
960944204 3:122954884-122954906 GAGGGAGGATCGCTTGAGCCTGG - Intronic
961570840 3:127797699-127797721 GTGGGAGGACCGCTTGAGCCCGG - Intronic
961593052 3:127995184-127995206 GTGGGAGAATCGCTTGAGCCCGG + Intergenic
961811746 3:129525984-129526006 GAGGGTGGATCGCTTGAGCCAGG + Intergenic
961860812 3:129915800-129915822 GTGGGAGAATCACTGGAGCCTGG + Intergenic
961890504 3:130126792-130126814 GATGGTTTACCGCTGGAGTCGGG + Intergenic
962518051 3:136172037-136172059 GTGGGTGGATCGCTTGAGCCAGG - Intronic
962782340 3:138731344-138731366 GTGGGAGGATCGCTGGAGCCTGG - Intronic
962786431 3:138772549-138772571 GTGGGAGAATTGCTGGAGCCTGG - Intronic
963596073 3:147326535-147326557 GTGGGAGAATCGCTTGAGCCGGG + Intergenic
963659606 3:148108151-148108173 GTGGGAGAACTGCTTGAGCCAGG - Intergenic
963728122 3:148944594-148944616 GAGGGAGGACCACTTGAGCCTGG + Intergenic
963958261 3:151279710-151279732 GAGGAGGAGCCGCTAGAGCCTGG + Intronic
964296705 3:155240957-155240979 GAGTGTGGGCAGCTGGAGCCAGG + Intergenic
964729047 3:159845472-159845494 GTGGGAGAATCGCTGGAACCCGG - Intronic
965723215 3:171684687-171684709 GTGGGAGAATTGCTGGAGCCTGG - Intronic
965907091 3:173722335-173722357 GAAGGAGAATCGCTTGAGCCTGG - Intronic
966118200 3:176490248-176490270 GAGTGTGAATTGCTTGAGCCAGG - Intergenic
966336627 3:178874994-178875016 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
966381615 3:179350057-179350079 GAGGGAGAATCGCTTGAACCTGG + Intronic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
966688693 3:182722918-182722940 CAGCCTGAGCCGCTGGAGCCGGG + Intergenic
966705232 3:182906535-182906557 GTGGGAGGACCGCTTGAGCCCGG - Intronic
966716250 3:183016020-183016042 GTGGGAGAACCGCTTGAACCCGG - Intronic
966727323 3:183119304-183119326 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
966924596 3:184636082-184636104 GAGGGTTCACAGCTGGACCCAGG - Intronic
967022555 3:185535368-185535390 GAGGGAGAATTGCTTGAGCCTGG - Intronic
967869797 3:194220587-194220609 GAGGGAGAATCGCTTGAACCTGG - Intergenic
968011951 3:195288005-195288027 GAGGGAGAATCGCTTGAACCCGG + Intronic
968029131 3:195467713-195467735 GTGGGAGAATCGCTGGAACCTGG + Intergenic
968160653 3:196423981-196424003 GCAGGTGAATCGCTGGAACCCGG - Intronic
968214475 3:196876783-196876805 GAGGGAGGATTGCTGGAGCCTGG + Intronic
968437953 4:604746-604768 GTGGGTGAATTGCTTGAGCCTGG - Intergenic
968463729 4:739292-739314 GTGGGAGAATCACTGGAGCCCGG - Intronic
968572923 4:1351882-1351904 GAGGATGAACTGCTGGACCACGG - Intronic
968719977 4:2194801-2194823 GAGGGAGAATCACTTGAGCCTGG + Intronic
968827674 4:2911538-2911560 GAGGGAGGACTGCTTGAGCCCGG - Intronic
968834556 4:2953997-2954019 GTGGGAGAACTGCTTGAGCCTGG + Intronic
968856494 4:3128024-3128046 GCGGGAGAATCGCTCGAGCCTGG - Intronic
968964361 4:3762039-3762061 GAGGGCTGACCGCAGGAGCCAGG + Intergenic
968999119 4:3965727-3965749 GTGGGAGAACTGCTTGAGCCCGG - Intergenic
969648828 4:8450889-8450911 TAGGGAGAATCGCTTGAGCCCGG - Intronic
969649735 4:8458555-8458577 GAGGCTGAACTGCTTGAACCTGG - Intronic
969754882 4:9142905-9142927 GTGGGAGAACTGCTTGAGCCCGG + Intergenic
969755875 4:9150354-9150376 GCAGGAGAATCGCTGGAGCCCGG + Intergenic
969814783 4:9679188-9679210 GTGGGAGAACTGCTTGAGCCCGG + Intergenic
969843077 4:9897802-9897824 GAGGTTGAATCGCTGGAACTGGG + Intronic
970123874 4:12787813-12787835 GAGGGAGAATCGCTTGAACCTGG - Intergenic
971704609 4:30024088-30024110 GCGGGAGAATCGCTGGAACCCGG + Intergenic
972305321 4:37825142-37825164 GAGGGAGGATCGCTTGAGCCTGG - Intergenic
972590905 4:40485975-40485997 GTGGGAGAACTGCTTGAGCCCGG + Intronic
972608739 4:40637424-40637446 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
973281745 4:48365371-48365393 GAGGGAGAACAGCTTGAACCTGG + Intronic
973605250 4:52580511-52580533 GCGGGAGAATCACTGGAGCCTGG - Intergenic
974027437 4:56746140-56746162 GCGGGTAAACCACTTGAGCCAGG + Intergenic
974064848 4:57068194-57068216 GTGGGAGAATCGCTTGAGCCTGG + Intronic
974382107 4:61154325-61154347 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
974880582 4:67752303-67752325 GTGGGAGAATCGCTTGAGCCTGG - Intronic
975242795 4:72081579-72081601 GTGGGAGAATCGCTTGAGCCTGG - Intronic
975364383 4:73511517-73511539 GAGGGAGAATCGCTTGAACCCGG + Intergenic
975562580 4:75721340-75721362 GTGGGAGGATCGCTGGAGCCTGG - Intronic
976021244 4:80629784-80629806 GCAGGAGAATCGCTGGAGCCAGG + Intronic
976407624 4:84677867-84677889 GTGGGAGAACTGCTTGAGCCTGG + Intronic
976623403 4:87152475-87152497 GTGGGAGAACCACTTGAGCCCGG + Intergenic
976753954 4:88478703-88478725 GTGGGAGAACCGCTTGAGACTGG - Intronic
976929855 4:90552549-90552571 GTGGGAGAATCGCTTGAGCCCGG - Intronic
977208006 4:94185598-94185620 GTGGGAGAACCACTTGAGCCTGG - Intergenic
977815058 4:101405171-101405193 GAGGGAGGATCGCTTGAGCCTGG + Intergenic
978427465 4:108597163-108597185 GCGGGAGAATCGCTGGAACCTGG + Intergenic
979571556 4:122232511-122232533 GCGGGAGAATCGCTGGAACCTGG + Intronic
980140402 4:128909341-128909363 GTGGGAGAACCACTTGAGCCAGG - Intronic
980470783 4:133248883-133248905 GTGGGAGAATCGCTGGAGCCAGG + Intergenic
980668218 4:135968095-135968117 GAGGGAGGACCCCTTGAGCCTGG + Intergenic
982000566 4:151017366-151017388 GCAGGAGAATCGCTGGAGCCCGG - Intergenic
982026529 4:151257813-151257835 GAGGGAGGATCGCTTGAGCCTGG + Intronic
982159525 4:152553751-152553773 GTGGGTGGACTGCTTGAGCCAGG + Intergenic
982161764 4:152577435-152577457 GTGGGAGAATCGCTTGAGCCCGG + Intergenic
982360867 4:154517735-154517757 GTGGGAGAAACGCTTGAGCCTGG + Intergenic
983532420 4:168824913-168824935 GTGGGAGAATCGCTTGAGCCTGG - Intronic
983651215 4:170038691-170038713 GTGGGAGAAACGCTTGAGCCCGG + Intergenic
983957068 4:173710258-173710280 GTGGGAGGACCGCTTGAGCCTGG - Intergenic
984469120 4:180143603-180143625 GTGGGAGAACTGCTTGAGCCCGG - Intergenic
984783082 4:183543641-183543663 CAGAGGGAACCGCTGGGGCCAGG + Intergenic
984972302 4:185202453-185202475 GTGGGAGAATCGCTGGAACCTGG + Intronic
984987504 4:185345695-185345717 GTGGGAGAATCGCTTGAGCCTGG + Intronic
985248411 4:187999154-187999176 GTGGGAGGATCGCTGGAGCCTGG - Exonic
985259925 4:188105943-188105965 GTGGGAGGATCGCTGGAGCCTGG - Intronic
985354084 4:189098380-189098402 GAGGCTGAACCGCTTCAGCTGGG + Intergenic
985649935 5:1102741-1102763 GAGGGTGGCCTGCTGGACCCAGG - Intronic
985709427 5:1419974-1419996 GTGGGTGGGCCGGTGGAGCCAGG - Intronic
988490858 5:31704104-31704126 GAGGGAGGACTGCTTGAGCCTGG - Intronic
989374125 5:40741893-40741915 GCAGGAGAACCGCTTGAGCCTGG + Intronic
989761337 5:45020158-45020180 GTGGGAGAACCGCTTGAACCCGG + Intergenic
990037421 5:51338596-51338618 GTGGGAGGACCGCTTGAGCCCGG - Intergenic
990904816 5:60792636-60792658 GTGGGAGAACTGCTTGAGCCTGG + Intronic
991311938 5:65253114-65253136 GCGGGTGGATCGCTTGAGCCCGG - Intronic
991717966 5:69469613-69469635 GCGGGTGAATCGCTTGAACCTGG - Intergenic
992109464 5:73479245-73479267 GAGGGAGAATCACTTGAGCCTGG - Intergenic
992255052 5:74912915-74912937 GAGGGAGAATCGCTTGAACCCGG - Intergenic
992834284 5:80624626-80624648 GAGGGTGAACTGCTTGAACCCGG + Intergenic
992929596 5:81629078-81629100 GTGGGTGAATCGCTTGAACCTGG - Intronic
993282191 5:85938991-85939013 GAGGGAGAATTGCTGGAACCGGG + Intergenic
993505653 5:88705704-88705726 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
993730397 5:91415408-91415430 GTGGGAGGACCGCTTGAGCCCGG + Intergenic
994879412 5:105468433-105468455 GAGGGAGGATCGCTTGAGCCTGG + Intergenic
995488670 5:112666215-112666237 GACGGAGAATCGCTTGAGCCTGG - Intergenic
995768031 5:115639921-115639943 GAGGGTGGATCGCTTGAGGCCGG + Intergenic
996320675 5:122211689-122211711 GTGGGTGGATCGCTTGAGCCTGG + Intergenic
996562644 5:124847201-124847223 GTGGGAGAATCACTGGAGCCGGG + Intergenic
996924394 5:128806982-128807004 GTGGGAGAATCGCTTGAGCCAGG - Intronic
996939053 5:128981905-128981927 GCAGGTGAATCGCTTGAGCCTGG - Intronic
997179039 5:131808967-131808989 GTGGCAGAATCGCTGGAGCCTGG + Intronic
997294219 5:132759837-132759859 GAGGGTGAGCCCCAGAAGCCAGG + Intronic
997462575 5:134063924-134063946 GAGGGGGAATCGCTTGAGTCTGG - Intergenic
997502003 5:134382678-134382700 GTGGGAGAATTGCTGGAGCCTGG + Intronic
997583739 5:135033048-135033070 GAGGGAGACGCGCAGGAGCCGGG + Intronic
997889670 5:137664254-137664276 GTGGGAGAACTGCTTGAGCCTGG + Intronic
998006825 5:138662582-138662604 TGGGGGGAATCGCTGGAGCCTGG + Intronic
998050566 5:139029725-139029747 GTGGGTGGATCGCTTGAGCCAGG - Intronic
998050607 5:139030087-139030109 GTGGGTGGATCGCTTGAGCCAGG + Intronic
999161989 5:149509151-149509173 GAGGGTGGATCGCTTGAGCCCGG - Intronic
999441375 5:151603573-151603595 GAGGGAGCATCGCTTGAGCCTGG + Intergenic
999482026 5:151957449-151957471 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
1000042173 5:157493010-157493032 GAGGGTGACATGCTGGACCCAGG - Exonic
1000053354 5:157581127-157581149 GAGGGAGGACTGCTTGAGCCCGG - Intergenic
1000483514 5:161809772-161809794 GCGGGAGAATCGCTGGAACCCGG - Intergenic
1000876027 5:166639166-166639188 GTGGGTGCTCCCCTGGAGCCTGG - Intergenic
1001395297 5:171415133-171415155 GTGGGAGAATCGCTGGAACCCGG - Intergenic
1001404315 5:171465002-171465024 GAGGGGGAATCGCTTGAACCGGG - Intergenic
1001790175 5:174449527-174449549 GAAGGGGAATCGCTTGAGCCTGG + Intergenic
1002030186 5:176422746-176422768 GAGGGAGAATCGCTTGAACCTGG - Intergenic
1002048754 5:176557107-176557129 GTGGGAGAACTGCTTGAGCCCGG - Intronic
1002178536 5:177417079-177417101 GAGGGAGAATCGCTTGAACCTGG - Intronic
1002404684 5:179020925-179020947 GTGGGTGAATCACTTGAGCCAGG - Intergenic
1002419310 5:179137478-179137500 CACGGTGAACTGCAGGAGCCCGG + Intronic
1002458587 5:179360771-179360793 GTGGGTTGATCGCTGGAGCCTGG + Intergenic
1002508525 5:179697792-179697814 GAGGGAGAATCGCTTGAACCCGG + Intronic
1002624192 5:180513281-180513303 GAGGGAAAATCGCTGGAGACTGG - Intronic
1002707628 5:181173472-181173494 GCGGGAGGACGGCTGGAGCCCGG - Intergenic
1003678452 6:8228832-8228854 GTGGGTGAATAGCTTGAGCCTGG + Intergenic
1003967609 6:11268121-11268143 GAGGGAGAATCGCCTGAGCCTGG - Intronic
1003990804 6:11484350-11484372 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1004460978 6:15835616-15835638 GAGGTTGAACTTCTTGAGCCTGG + Intergenic
1004685862 6:17942883-17942905 GAAGGAGAACTGCTTGAGCCTGG + Intronic
1004710711 6:18167565-18167587 GTGGGAGAATCGCTTGAGCCCGG - Intronic
1005167071 6:22937182-22937204 GAGGGAGAATCGCTTGAACCTGG - Intergenic
1005508803 6:26493754-26493776 GAGGGAGGATCGCTTGAGCCCGG + Intergenic
1005633890 6:27735067-27735089 GTGGGAGGATCGCTGGAGCCCGG - Intergenic
1005789733 6:29286042-29286064 GAGGGTGAAAAACTGGAGCTGGG - Intergenic
1005925111 6:30437938-30437960 GAGGGTGTATCACTTGAGCCTGG + Intergenic
1006033267 6:31193221-31193243 GTGGGAGGATCGCTGGAGCCCGG - Intergenic
1006105923 6:31716517-31716539 GAGGGAGGATCGCTTGAGCCTGG + Intronic
1006263948 6:32900714-32900736 GAGGGAGGATCGCTGGAGCCTGG + Intergenic
1006304112 6:33208623-33208645 GAGCGCGAACGGCTGGAGCTGGG + Exonic
1006659020 6:35623661-35623683 GTGGGAGGACCGCTTGAGCCTGG - Intronic
1006877839 6:37314114-37314136 GAAGGAGAACCGATAGAGCCTGG - Intronic
1007142320 6:39588440-39588462 GCGGGTGGATCACTGGAGCCAGG - Intronic
1007407355 6:41642675-41642697 GACAGAGAACCTCTGGAGCCAGG - Intronic
1007429753 6:41769931-41769953 GCGGGAGAACTGCTTGAGCCCGG + Intergenic
1007435485 6:41807532-41807554 GTGGGAGAATCGCTTGAGCCCGG - Intronic
1007658963 6:43470513-43470535 GAGGCTGAATCGCTTGAACCCGG + Intergenic
1007784903 6:44274119-44274141 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1008022809 6:46600220-46600242 GAGGCTGAATCGCTTGAACCTGG - Intronic
1008059943 6:46986157-46986179 GAGGGAGGATCGCTTGAGCCTGG + Intergenic
1009333718 6:62458633-62458655 GCGGGAGAATCGCTGGAACCTGG - Intergenic
1010087429 6:71937352-71937374 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1010207376 6:73334988-73335010 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1010436000 6:75831661-75831683 GAGGGCGGATCGCTTGAGCCTGG + Intronic
1010546910 6:77170318-77170340 GAGGGAGAATTGCTTGAGCCTGG - Intergenic
1010563980 6:77385656-77385678 GTGGGAGAACCGCTTGACCCGGG - Intergenic
1011082778 6:83507922-83507944 GCGGGAGAATCGCTTGAGCCTGG + Intergenic
1011293569 6:85803307-85803329 GTGGGAGAATGGCTGGAGCCTGG + Intergenic
1011463618 6:87632068-87632090 GCAGGAGAACCGCTTGAGCCTGG + Intronic
1011785881 6:90844732-90844754 GAGGATGAATCGCTTGAACCTGG - Intergenic
1012365120 6:98429445-98429467 GAGGGAGAATTGCTTGAGCCTGG + Intergenic
1012524009 6:100155804-100155826 CAGGGTGGACCACTGGAACCAGG + Intergenic
1013023399 6:106243432-106243454 GTGGGTGGATCGCTTGAGCCGGG + Intronic
1013069021 6:106711336-106711358 GCGGGAGGATCGCTGGAGCCCGG - Intergenic
1013071468 6:106732988-106733010 GAAGGAGAATCGCTTGAGCCCGG + Intergenic
1013239764 6:108233653-108233675 GTGGGAGAATCGCTTGAGCCCGG + Intronic
1013371408 6:109473851-109473873 GAGGGTGGATCACTTGAGCCAGG + Intronic
1013445081 6:110217011-110217033 GTGGGTGGATCGCTTGAGCCAGG + Intronic
1014137555 6:117907221-117907243 GAGGGTGAACCCGGAGAGCCGGG - Intergenic
1014281101 6:119443300-119443322 GTGGGAGAATCGCTTGAGCCCGG - Intergenic
1014431870 6:121380630-121380652 GTGGGAGAATCGCTGGAACCCGG + Intergenic
1015537396 6:134280504-134280526 GTGGGAGAATCGCTTGAGCCCGG - Intronic
1015744982 6:136499900-136499922 GCGGGAGAACTGCTTGAGCCTGG + Intronic
1016402217 6:143693329-143693351 GCAGGAGAACCGCTGGAACCTGG - Intronic
1016911953 6:149208047-149208069 GAGGGAGAACCGAAGAAGCCAGG + Intergenic
1016912743 6:149215244-149215266 GAGGAAGGAACGCTGGAGCCTGG - Intergenic
1017446509 6:154511140-154511162 GCGGGAGAATCGCTGGAACCTGG - Intergenic
1017693432 6:156990264-156990286 GTGGGAGAATCGCTTGAGCCGGG - Intronic
1017701490 6:157077435-157077457 GAGGGTGAGGCTCCGGAGCCTGG - Intronic
1017831834 6:158137646-158137668 CAGGGTGGACCTCTTGAGCCAGG + Intronic
1017939471 6:159038480-159038502 GCGGGAGAATCGCTTGAGCCCGG - Intronic
1018237353 6:161739312-161739334 GTGGGAGAATCGCTGGAACCTGG + Intronic
1018239277 6:161756346-161756368 GAGGGAGAATCGCTTGAACCTGG + Intronic
1018249738 6:161857133-161857155 GCAGGTGAATCGCTTGAGCCCGG + Intronic
1018447971 6:163875389-163875411 GAGGGTGAAGCTCTGGACCCTGG - Intergenic
1018860536 6:167708039-167708061 GAGGCTGAGCCTCTGCAGCCAGG + Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1019125698 6:169838941-169838963 GAGGGTGAAACGATGGATGCCGG + Intergenic
1019341762 7:511840-511862 GGGGGTGGAGCCCTGGAGCCAGG + Intronic
1019457711 7:1139101-1139123 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
1019528424 7:1491802-1491824 GCGGGAGGACCGCTTGAGCCAGG + Intronic
1019530466 7:1500476-1500498 GAGGGTGGATCGCTGGTCCCTGG - Intronic
1019583125 7:1778887-1778909 GAGGGAGGATCGCTTGAGCCTGG + Intergenic
1019664648 7:2245764-2245786 GAGGGAGGATCGCTTGAGCCTGG - Intronic
1019724056 7:2591157-2591179 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1020005673 7:4782822-4782844 GGGGGTGCACCGCTGGCGCCTGG - Intronic
1020075112 7:5252804-5252826 GCAGGAGAACCGCTTGAGCCCGG - Intergenic
1020110893 7:5447208-5447230 GTGGGAGAATCGCTTGAGCCCGG - Intronic
1020135419 7:5585423-5585445 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1020169379 7:5833207-5833229 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
1020212476 7:6166858-6166880 GAGGAGGAACAGCTGGAGGCTGG - Intronic
1020274047 7:6614510-6614532 GTGGGTGGACCACTTGAGCCCGG - Intergenic
1020289884 7:6715378-6715400 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1020466285 7:8483422-8483444 GTGGGTAGACCGCTTGAGCCTGG - Intronic
1020480601 7:8655289-8655311 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1021119957 7:16788054-16788076 GTGGGAGAACTGCTTGAGCCCGG - Intergenic
1021495353 7:21268391-21268413 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1022403129 7:30060342-30060364 GAGGGAGAATCGCTTGAACCTGG + Intronic
1022462693 7:30626437-30626459 GAGGGAGGAACGCTTGAGCCGGG - Intronic
1023716843 7:43053252-43053274 GTGGGAGAATCACTGGAGCCTGG + Intergenic
1023846655 7:44124584-44124606 GCGGGAGAATCACTGGAGCCTGG - Intergenic
1023911212 7:44558353-44558375 GTGGGAGAACTGCTTGAGCCTGG - Intergenic
1023981872 7:45075115-45075137 GAGCGTGAAGGGCTGGAGGCTGG + Intronic
1024405617 7:48976075-48976097 GAGGTTGTACCTCTGGTGCCTGG + Intergenic
1024636541 7:51295190-51295212 GAGGGAGAATCGCTTGAACCGGG + Intronic
1024983820 7:55179294-55179316 GAGGGTGAAATGCAGGAGACAGG - Intronic
1025104666 7:56161257-56161279 GAGGGTGGATCTCTTGAGCCCGG - Intergenic
1025614205 7:63104380-63104402 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1025828498 7:65030386-65030408 GTGGGAGAATCGCTGGAGCCTGG + Intergenic
1025937386 7:66048086-66048108 GTAGGAGAACCGCTTGAGCCTGG + Intergenic
1025978919 7:66391973-66391995 GAAGGAGAACTGCTTGAGCCTGG + Intronic
1026301091 7:69098650-69098672 GCAGGAGAACAGCTGGAGCCTGG + Intergenic
1026431411 7:70351142-70351164 GAAGGAGAATCGCTTGAGCCTGG - Intronic
1026532217 7:71209587-71209609 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1026599960 7:71769778-71769800 GTGGGAGAATCGCTTGAGCCCGG - Intergenic
1026636112 7:72083105-72083127 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1026747021 7:73021847-73021869 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1026750671 7:73049990-73050012 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1026754320 7:73078100-73078122 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1026757972 7:73106133-73106155 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1026771551 7:73204099-73204121 GCAGGAGAACCGCTTGAGCCTGG + Intergenic
1026778271 7:73245683-73245705 GCGGGTGGATCGCTTGAGCCTGG - Intergenic
1026793090 7:73347736-73347758 GAGGGAGAATTGCTAGAGCCTGG - Intronic
1026852068 7:73730825-73730847 GAGGGAGGATCGCTTGAGCCTGG + Intergenic
1026906624 7:74066471-74066493 GCGGGAGAATCACTGGAGCCTGG + Intronic
1027012417 7:74757495-74757517 GCAGGAGAACCGCTTGAGCCTGG + Intronic
1027019126 7:74799072-74799094 GCGGGTGGATCGCTTGAGCCTGG - Intronic
1027033124 7:74906418-74906440 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1027068901 7:75146867-75146889 GCGGGTGGATCGCTTGAGCCTGG + Intronic
1027075623 7:75188558-75188580 GCAGGAGAACCGCTTGAGCCTGG - Intergenic
1027089431 7:75287351-75287373 GCGGGAGGATCGCTGGAGCCTGG + Intergenic
1027093076 7:75315279-75315301 GCGGGAGGATCGCTGGAGCCTGG + Intergenic
1027096719 7:75343246-75343268 GCGGGAGGATCGCTGGAGCCTGG + Intergenic
1027118986 7:75502167-75502189 GCGGGAGGATCGCTGGAGCCTGG + Intergenic
1027251145 7:76399627-76399649 GAGGGAGGATCGCTGGAGTCTGG - Intronic
1027272836 7:76533441-76533463 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1027322628 7:77024434-77024456 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1027326284 7:77052526-77052548 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1027508891 7:79054100-79054122 GAGGGAGAATCGCTTGAACCCGG + Intronic
1027771546 7:82413414-82413436 GAGAGTGAAGCTCTGCAGCCAGG - Intronic
1028472568 7:91220981-91221003 GTGGGAGAATCGCTTGAGCCCGG - Intergenic
1028510781 7:91624088-91624110 GAGGGAGGATCGCTTGAGCCTGG - Intergenic
1028520799 7:91728731-91728753 GAGGCAGAACTGCTAGAGCCCGG - Intronic
1028538409 7:91915153-91915175 GTGGGAGAACCGCTTGAACCTGG + Intergenic
1029001972 7:97164039-97164061 GAGGGGGAATCGCTTGAACCTGG - Intronic
1029090500 7:98044348-98044370 GTGGGAGAACCACTGTAGCCTGG + Intergenic
1029102151 7:98140235-98140257 GAGGGAGGACTGCTTGAGCCTGG - Intronic
1029137638 7:98385512-98385534 GAGGCTGAATCGCTTGAGTCCGG - Intronic
1029366223 7:100118257-100118279 GTGGGAGAACCGCTTGAACCAGG + Intronic
1029467039 7:100732258-100732280 GTGGGAGAACTGCTTGAGCCTGG + Intergenic
1029526295 7:101096093-101096115 GTGGGAGAATCGCTTGAGCCCGG + Intergenic
1029534497 7:101148460-101148482 GAGGGAGAATCGCTTGAACCTGG + Intergenic
1029594320 7:101528775-101528797 GTGGGTGGATCGCTTGAGCCCGG - Intronic
1029718507 7:102347850-102347872 GCGGGAGGATCGCTGGAGCCTGG - Intergenic
1029754109 7:102561405-102561427 GCGGGAGGATCGCTGGAGCCTGG + Intronic
1029772059 7:102660495-102660517 GCGGGAGGATCGCTGGAGCCTGG + Intronic
1029981338 7:104882339-104882361 GCGGGAGAATCGCTGGAACCTGG - Intronic
1030067178 7:105668808-105668830 GTGGGTGGATCGCTTGAGCCTGG + Intronic
1031054156 7:116975499-116975521 GAAGGAGAACCGCTTGAACCCGG - Intronic
1031109872 7:117595790-117595812 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1031930741 7:127683307-127683329 GTAGGAGAACCGCTTGAGCCTGG - Intronic
1032029555 7:128471310-128471332 GCAGGTGAAACGCTTGAGCCCGG - Intergenic
1032149625 7:129417029-129417051 GAGGCAGAATCACTGGAGCCTGG + Intronic
1032184326 7:129710869-129710891 GAGGGAGAATCACTTGAGCCCGG - Intronic
1032297294 7:130651408-130651430 GCGGGAGAATCGCTGGAGCCTGG - Intronic
1033307939 7:140238771-140238793 AAGGGAGAACCTCTGGATCCTGG - Intergenic
1033396009 7:140974384-140974406 GTGGGTGGATCGCTTGAGCCGGG + Intergenic
1034554047 7:151838611-151838633 GTGGGAGGACCGCTGGAGCCAGG + Intronic
1034616879 7:152425481-152425503 GAAGGAGAATCGCTGGAACCAGG + Intronic
1035411054 7:158642442-158642464 ATGGGAGAATCGCTGGAGCCTGG + Intronic
1036195833 8:6713645-6713667 GTGGGAGGACCGCTTGAGCCCGG - Intronic
1036440485 8:8777442-8777464 GTGGGGGAATCGCTGGAACCTGG - Intergenic
1036768817 8:11565248-11565270 GCGGGTGCACAGGTGGAGCCAGG - Intergenic
1036770678 8:11576432-11576454 CAGGGTCAACCTCTGGACCCTGG + Intergenic
1036851452 8:12204397-12204419 GTGGGAGAACTGCTCGAGCCCGG - Intergenic
1036872817 8:12446671-12446693 GTGGGAGAACTGCTCGAGCCCGG - Intergenic
1037546470 8:19928814-19928836 GTGGGAGAACTGCTTGAGCCTGG + Intronic
1037556934 8:20033966-20033988 GAGGGAGAACTGCTTGAACCTGG + Intergenic
1037964566 8:23124097-23124119 GAGGGAGGATCACTGGAGCCAGG + Intergenic
1038148901 8:24924618-24924640 GTGGGAGAACTGCTTGAGCCTGG + Intergenic
1038450524 8:27636341-27636363 GAGGGAGGATCGCTTGAGCCTGG + Intronic
1038934462 8:32233193-32233215 GTAGGTGAACAGCTTGAGCCTGG - Intronic
1039719261 8:40144434-40144456 GAGGCTGAATCGCTTGAACCCGG - Intergenic
1039868791 8:41528662-41528684 GTGGGAGGATCGCTGGAGCCCGG + Intergenic
1039984748 8:42437710-42437732 GAGGGAGAATCGCTTGAACCCGG - Intronic
1040050288 8:43007118-43007140 GAGGGAGAATCGCTTGAACCTGG - Intronic
1040480656 8:47823240-47823262 GTGGGAGGACCGCCGGAGCCTGG + Intronic
1040544868 8:48391179-48391201 GTGGGGTAATCGCTGGAGCCTGG + Intergenic
1040557642 8:48495424-48495446 GTGGGAGGACCACTGGAGCCTGG + Intergenic
1041141880 8:54828984-54829006 GCGGGAGAATCGCTTGAGCCTGG - Intergenic
1041598509 8:59686895-59686917 GCAGGAGAACCGCTTGAGCCTGG - Intergenic
1041670005 8:60482611-60482633 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1041724907 8:61009240-61009262 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1042222661 8:66488873-66488895 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1043852700 8:85232847-85232869 GTGGGTGAATCACTTGAGCCTGG - Intronic
1044717634 8:95114966-95114988 GCAGGTGAATCGCTGGAACCTGG + Intronic
1045208436 8:100068288-100068310 GCGGGAGAATCGCTTGAGCCAGG + Intronic
1045304073 8:100941689-100941711 GAGGGAGAATCGCTTGAACCCGG + Intronic
1045363692 8:101455820-101455842 GTGGGAGAATCGCTTGAGCCAGG + Intergenic
1045379391 8:101608227-101608249 GAGGTTGCACAGCTGGCGCCTGG + Intronic
1046543007 8:115611021-115611043 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1047192289 8:122689066-122689088 GTGGGAGGACCGCTTGAGCCAGG + Intergenic
1047738900 8:127791228-127791250 GCGGGTGAATCACTTGAGCCCGG + Intergenic
1048147725 8:131862123-131862145 GAGGGTGAAGGGCAGAAGCCGGG - Intergenic
1048272270 8:133038969-133038991 GAGGGAGAATCGCTTGAGCCTGG - Intronic
1048479600 8:134776395-134776417 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1049175196 8:141188130-141188152 GCGGGAGAATCGCTTGAGCCGGG + Intronic
1049721685 8:144119085-144119107 GTGGGAGAATCGCTGGAACCCGG + Intergenic
1049847326 8:144809282-144809304 GTGGGAGAAACGCTTGAGCCTGG - Intronic
1049995888 9:1033133-1033155 GAGGGAGGACCGCTTGAGCTGGG + Intergenic
1050383998 9:5064434-5064456 GTGGGTGGATCGCTTGAGCCTGG + Intronic
1050536400 9:6634433-6634455 GAGGGAGGATCGCTTGAGCCTGG + Intronic
1051392538 9:16581462-16581484 GAAGGAGAACCGCTTGAACCCGG + Intronic
1051499165 9:17758466-17758488 GAGGGAGAATCGCTTGAACCTGG + Intronic
1051627532 9:19112612-19112634 GAGGGAGAATCGATTGAGCCTGG + Intronic
1051879522 9:21825745-21825767 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1051893898 9:21969292-21969314 GTGGGAGAACCCCTTGAGCCAGG + Intronic
1052512705 9:29441739-29441761 GTGGGAGGATCGCTGGAGCCCGG + Intergenic
1052741625 9:32398685-32398707 GTGGGAGGATCGCTGGAGCCTGG - Intronic
1053004983 9:34598513-34598535 GCGGGTGAATCGCTTGAACCCGG + Intergenic
1053225148 9:36348377-36348399 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1053249662 9:36564049-36564071 GAGGGAGAACTGCTTGAACCCGG - Intergenic
1053654457 9:40201940-40201962 GTGGGAGGACCGCTTGAGCCTGG + Intergenic
1054366572 9:64348157-64348179 GTGGGAGGACCGCTTGAGCCTGG + Intergenic
1054530138 9:66174373-66174395 GTGGGAGGACCGCTTGAGCCTGG - Intergenic
1054623857 9:67377219-67377241 GTGGGAGGATCGCTGGAGCCTGG + Intergenic
1054674200 9:67837897-67837919 GTGGGAGGACCGCTTGAGCCTGG + Intergenic
1054755961 9:68957964-68957986 GTGGGAGAATCGCTTGAGCCAGG - Intronic
1054822826 9:69540690-69540712 GTGGGAGAACCGCTTGAGCCAGG - Intronic
1055526061 9:77135156-77135178 GTGGGTGGATCGCTTGAGCCCGG - Intergenic
1056241790 9:84655126-84655148 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1056731604 9:89170549-89170571 GAGGGAGGATCGCTTGAGCCTGG + Intronic
1056785232 9:89587736-89587758 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1057090377 9:92252668-92252690 GAGGGAGAACTGCTTGAACCTGG + Intronic
1058208932 9:102143077-102143099 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1058480121 9:105384275-105384297 GAGGGAGAACTGCTTGAACCTGG - Intronic
1058591969 9:106574920-106574942 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1058658626 9:107248444-107248466 GCAGGTGAACCGCTTGAGCCCGG - Intergenic
1058688428 9:107499176-107499198 GCGGGAGAACCGCTTGAACCTGG - Intergenic
1059062684 9:111050054-111050076 GAGGCAGCATCGCTGGAGCCCGG + Intergenic
1059095629 9:111410608-111410630 GTGGGAGAATCACTGGAGCCTGG - Intronic
1059213839 9:112540946-112540968 GTGGGCCAACCGCTTGAGCCAGG - Intronic
1059289306 9:113208241-113208263 GAGGAAGAATCGCTTGAGCCTGG + Intronic
1060428373 9:123525850-123525872 GTGGGAGAATCACTGGAGCCTGG - Intronic
1060592530 9:124827659-124827681 GAGGGAGGATCGCTTGAGCCTGG - Intergenic
1060628077 9:125131312-125131334 GAGGGAGAATCGCTGGAACCCGG + Intronic
1060674433 9:125499891-125499913 GTGGGAGAACTGCTTGAGCCAGG + Intronic
1060703076 9:125776627-125776649 GTGGGAGAACCACTTGAGCCCGG - Intronic
1061111124 9:128571948-128571970 GTGGGTGAACCACTTGAGCCTGG - Intronic
1061217333 9:129229374-129229396 GAGGGTGAATCACTCGAGCCCGG - Intergenic
1061303741 9:129721095-129721117 GTGCGTGAACACCTGGAGCCGGG + Intronic
1061457131 9:130706964-130706986 GTGGGTGGATCGCTTGAGCCTGG - Intergenic
1061503113 9:131014887-131014909 GTGGGAGGATCGCTGGAGCCTGG + Intronic
1061591562 9:131601076-131601098 GCGGGAGAATCGCTTGAGCCCGG + Intronic
1061938030 9:133869088-133869110 GCGGGAGAATCGCTTGAGCCCGG - Intronic
1062088824 9:134663355-134663377 GAGGGTGAAGGGCTGGGGCTGGG + Intronic
1062369114 9:136227883-136227905 GTGGGAGGACCGCTTGAGCCCGG + Intronic
1062469273 9:136695326-136695348 GCAGGAGAACCGCTTGAGCCTGG + Intergenic
1185482052 X:454044-454066 GTGGGAGGATCGCTGGAGCCAGG + Intergenic
1185597607 X:1317343-1317365 GCGGGAGAATCGCTGGAACCCGG - Intergenic
1185711412 X:2306553-2306575 GAGGCTGAATCGCTTGAACCTGG - Intronic
1185733929 X:2483177-2483199 GTGGGAGGATCGCTGGAGCCCGG - Intronic
1185896015 X:3859520-3859542 GTGGGTGGATCTCTGGAGCCTGG + Intergenic
1185901134 X:3897944-3897966 GTGGGTGGATCTCTGGAGCCTGG + Intergenic
1185906248 X:3936383-3936405 GTGGGTGGATCTCTGGAGCCTGG + Intergenic
1186114376 X:6289797-6289819 GAAGGAGAATCGCTTGAGCCTGG + Intergenic
1186340937 X:8645713-8645735 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1186377298 X:9017930-9017952 GTGGGAGAATCACTGGAGCCAGG + Intergenic
1186424428 X:9452651-9452673 GAAGGAGAATCGCTGGAACCCGG + Intergenic
1186462813 X:9761991-9762013 GTGGGAGAATCGCTTGAGCCCGG + Intronic
1187455193 X:19435317-19435339 GTGGGTGGATCGCTTGAGCCTGG - Intronic
1187497990 X:19812879-19812901 GAAGGAGAATCGCTTGAGCCCGG + Intronic
1187509348 X:19903607-19903629 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1187708640 X:22031797-22031819 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1187925942 X:24250131-24250153 GTGGGAGAATCGCTGGAACCCGG + Intergenic
1188591651 X:31843950-31843972 GCAGGAGAACCGCTTGAGCCAGG - Intronic
1188688081 X:33094712-33094734 GAGGGAGAATCGCTTGAACCTGG + Intronic
1189252912 X:39614799-39614821 GAGAGTGCACCCGTGGAGCCAGG + Intergenic
1189391994 X:40584168-40584190 GTGGGAGAATCGCTTGAGCCTGG - Intronic
1189458616 X:41217794-41217816 GTGGGAGGATCGCTGGAGCCTGG + Intronic
1189468917 X:41299260-41299282 CAGGGAGAATCGCTGGAACCGGG - Intergenic
1189932916 X:46033711-46033733 GTGGGAGAATCGCTTGAGCCTGG + Intergenic
1190012487 X:46797317-46797339 GTGGGAGAATCGCTTGAGCCCGG - Intergenic
1190060180 X:47205758-47205780 GTGGGAGGATCGCTGGAGCCTGG + Intronic
1190179993 X:48184043-48184065 GTGGGTGAATCCCTTGAGCCTGG + Intergenic
1190192704 X:48291009-48291031 GAAGGAGAATCGCTGGACCCTGG - Intergenic
1190222132 X:48518906-48518928 GTGGGTGGACTGCTCGAGCCTGG - Intronic
1190236391 X:48619407-48619429 GTGGGAGAATCGCTTGAGCCTGG - Intergenic
1190278182 X:48912551-48912573 GCAGGAGAACCGCTGGAACCCGG + Intergenic
1190327727 X:49217050-49217072 GAGGGAGAATCGCTTGAACCCGG - Intronic
1190677512 X:52794780-52794802 GAAGGAGAATCGCTGGACCCTGG + Intergenic
1190700226 X:52982358-52982380 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1190854267 X:54277862-54277884 GTGGGTGGACCGCTTGAGCCCGG + Intronic
1191860930 X:65666418-65666440 GAGGGAGAATCGCTTGAACCCGG - Intronic
1192371893 X:70521111-70521133 GAGGGTGAGCTGCTGAAGCAGGG - Intergenic
1192408327 X:70909519-70909541 GAGGGAGAATCGCTTGAACCCGG + Intergenic
1192478897 X:71468026-71468048 GTGGGTGAATCGCTTGAGCCTGG + Intronic
1192541572 X:71977639-71977661 GAGGGTGGATCGCTTGAGCTCGG - Intergenic
1192576197 X:72245260-72245282 GTTGGAGAATCGCTGGAGCCTGG - Intronic
1195269031 X:103212905-103212927 GAGGGAGAATTGCTTGAGCCCGG - Intergenic
1195372765 X:104196406-104196428 GTGGGAGGACCGCTTGAGCCTGG - Intergenic
1195381232 X:104272973-104272995 GAGGGAGAATCGCTTGAACCCGG - Intergenic
1196086896 X:111693346-111693368 GAGGGTGAATCACTTGAACCTGG - Intronic
1196480342 X:116140905-116140927 CAGGGAGAACTGCTAGAGCCTGG - Intergenic
1197756524 X:129999400-129999422 GTGGGAGAACTGCTTGAGCCCGG - Intronic
1198234553 X:134724906-134724928 GTGGGAGGATCGCTGGAGCCTGG + Intronic
1198472059 X:136956283-136956305 GTGGGAGGACCGCTTGAGCCAGG + Intergenic
1198718487 X:139588834-139588856 GTGGGAGAATCGCTTGAGCCTGG + Intronic
1198747615 X:139906321-139906343 GTGGGAGAATCGCTTGAGCCCGG + Intronic
1198934251 X:141889423-141889445 GAGGGAGAAACGCTGCCGCCAGG + Intronic
1200231256 X:154444880-154444902 GTGGGTGAACCGCTGGCACCCGG - Intronic
1201524848 Y:14920802-14920824 GAAGGAGAACCGCTTGAACCAGG - Intergenic
1201675568 Y:16580046-16580068 GTGGGTGAACTGCTTGAGCCTGG - Intergenic