ID: 1131261957

View in Genome Browser
Species Human (GRCh38)
Location 15:90892197-90892219
Sequence GTGGGGAATCAGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131261957_1131261975 25 Left 1131261957 15:90892197-90892219 CCCTGCCCCATCTGATTCCCCAC 0: 1
1: 0
2: 1
3: 38
4: 314
Right 1131261975 15:90892245-90892267 CCCACCACACACCATCCTCCAGG 0: 1
1: 0
2: 4
3: 41
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131261957 Original CRISPR GTGGGGAATCAGATGGGGCA GGG (reversed) Intronic
900034002 1:391965-391987 GTGGGGAGTGAGGTGAGGCAGGG - Intergenic
900054838 1:621855-621877 GTGGGGAGTGAGGTGAGGCAGGG - Intergenic
900560877 1:3305498-3305520 GTGGGCAAACAGATGGGAAATGG - Intronic
900714935 1:4138136-4138158 GTGGGGAATGAGCTGGGTCAAGG - Intergenic
900838612 1:5027970-5027992 GTGGGGCATCTGATGGGGACTGG - Intergenic
901091079 1:6641945-6641967 GGGGGGGATCACCTGGGGCAAGG + Intronic
901156984 1:7146678-7146700 GTGGGCAGTCAGAGGGGGTAGGG + Intronic
901208468 1:7510909-7510931 GTGGACAGGCAGATGGGGCAGGG - Intronic
901370032 1:8789200-8789222 TTGGGGAAGCCGATGGGGGAGGG + Intronic
902299725 1:15493443-15493465 GTGAGGAAACAGATAGGGAAGGG - Intronic
902729613 1:18360953-18360975 GTGGGGCATCGCAAGGGGCAGGG - Intronic
902939204 1:19787601-19787623 ATGGAGCATCAGATGGGGAAGGG + Intronic
903429204 1:23279360-23279382 GTGGGGGTTCAGATGAGGTAGGG - Intergenic
903499908 1:23795119-23795141 GGGCAGAATCAGTTGGGGCAGGG - Exonic
903499949 1:23795280-23795302 GTGGGGAAACAGCTGAGGGAAGG - Exonic
903870771 1:26432806-26432828 CTGGGGAATCAGATGGACTATGG - Intronic
904839617 1:33363995-33364017 GTGGGGGAGCAGGTGGGGGAGGG - Intronic
904978950 1:34480228-34480250 GAGAGGAATCAGAGGAGGCATGG + Intergenic
905307874 1:37031982-37032004 GCTGAGAATCAAATGGGGCAGGG + Intronic
905330967 1:37196963-37196985 TTTGGAAATGAGATGGGGCATGG - Intergenic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
906301432 1:44684900-44684922 GTTGGGAGTCAGGTGGGGGAAGG - Intronic
906790703 1:48656541-48656563 GTGGGGACTCAGCAGGGGCCTGG + Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907391944 1:54163891-54163913 GTGGGAAATATGAGGGGGCAGGG + Intronic
910517226 1:88075308-88075330 GTGTGGAATCAGCAGGGGTAGGG + Intergenic
910608227 1:89110715-89110737 GTGGGAAAGGAGAGGGGGCAAGG + Intronic
912557572 1:110527264-110527286 GTGGGGTATGGGATGGGGAAGGG + Intergenic
912921175 1:113868743-113868765 GTAGGGGACCTGATGGGGCATGG + Intronic
914902258 1:151717002-151717024 CTGGGGAGTAAGATGGGGGAAGG - Intronic
915562385 1:156694739-156694761 GATGGGAATGAGATGGAGCAAGG + Intergenic
915866061 1:159500565-159500587 GTGGGGCATCAGCTGGGCCTGGG + Intergenic
915929998 1:160054378-160054400 GTGAGGACCCAGATGGGGCCAGG - Intronic
915943908 1:160136220-160136242 GTGGGGTAGGAAATGGGGCAGGG - Intronic
916076095 1:161200722-161200744 GTGGGAGACCAGAAGGGGCAGGG + Intronic
916875023 1:168959883-168959905 GTGGGGAGAGAGATGGGGTAGGG - Intergenic
920075930 1:203336593-203336615 GTGGGGAATGATGAGGGGCAGGG - Intergenic
920136011 1:203769900-203769922 GTAGGGAACAAGAAGGGGCAAGG + Intronic
920724307 1:208419508-208419530 TTGGGGAAGCAGATGGGGGTGGG - Intergenic
922256357 1:223896129-223896151 GTGGGGAGTGAGGTGAGGCAGGG - Intergenic
924702825 1:246471422-246471444 ATGGGGAATCAGTTGAGGCCAGG - Intronic
1062958937 10:1558430-1558452 ATGTGGATTTAGATGGGGCATGG - Intronic
1062959001 10:1558666-1558688 ATGTGGATTTAGATGGGGCATGG - Intronic
1065631070 10:27681690-27681712 GTGGGGAATCACTTGAGGCCAGG + Intronic
1065773242 10:29096861-29096883 GATGGGGATCAGATGGGTCATGG - Intergenic
1066243644 10:33561504-33561526 GTGGGCACTCAGATGGGGGAAGG + Intergenic
1066253189 10:33653952-33653974 GTGGGGAATCATTTGAGGCCAGG + Intergenic
1066995655 10:42560416-42560438 GTTGGAAAGCAGATGGGGGAGGG - Intergenic
1067369651 10:45671681-45671703 GTGGGGAGTGAGATGGGGGGAGG + Intronic
1067616553 10:47762220-47762242 GTGGGGAGGAAGAGGGGGCAAGG + Intergenic
1069634670 10:69917978-69918000 GTGGGGCACTAGATGGGGCTGGG - Intronic
1069862552 10:71480688-71480710 GTGAGGAAACAGATGGGGTCAGG + Intronic
1069995955 10:72342327-72342349 GATGGGAATCAGATGTGGCTTGG - Intronic
1070311359 10:75276122-75276144 GTGGGGACGCAGGAGGGGCAGGG + Intergenic
1070328807 10:75403982-75404004 GAGGGGAGTCAGGTGGGGGAGGG - Intergenic
1072454309 10:95562455-95562477 GTGGGGAATCTGCTGGCCCAAGG + Intergenic
1072756183 10:98022668-98022690 GTGGGGCAGCAGCTGGGGCCTGG + Intronic
1073779099 10:106817412-106817434 GTGGGGAAGCAGGAGGGGCCTGG - Intronic
1074014931 10:109525063-109525085 GTGAGGAATTAGATGGGGATTGG + Intergenic
1075203339 10:120424756-120424778 GTGGGGCATCAGATTGAGCCAGG - Intergenic
1075811685 10:125228772-125228794 GTGGGGAGTCAGGGGAGGCATGG + Intergenic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1077320389 11:1938371-1938393 GTGGGGGACCAGGAGGGGCATGG + Intronic
1077498624 11:2898685-2898707 GTGTGGACTTGGATGGGGCATGG - Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078088146 11:8247040-8247062 TTGTGGAAGCAGATGGGCCAAGG - Intronic
1079709669 11:23666053-23666075 CTTGGGAAGTAGATGGGGCAGGG + Intergenic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1080717959 11:34822453-34822475 GTGGGCTATAAGATGGGGAATGG + Intergenic
1081046387 11:38278745-38278767 GTGGGGAAGCAGCTGAGGCCTGG + Intergenic
1081527150 11:43934994-43935016 CTGGGGAAGCAGATGGGGTGGGG - Intronic
1082784783 11:57311033-57311055 GATGGGGGTCAGATGGGGCATGG - Intronic
1083614412 11:64019197-64019219 GGGGGGAACCCGATGGGGCCGGG - Intronic
1083996205 11:66274128-66274150 ATGGGGATGCAGCTGGGGCATGG - Intronic
1084603329 11:70159238-70159260 GTGGGGGAAGAGATGGGCCAGGG + Intronic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1087158131 11:94924053-94924075 GTGGGGAATGAGAAAGGGCTGGG + Intergenic
1087159216 11:94932803-94932825 GTGGGGAGGGAGGTGGGGCAAGG + Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1088437373 11:109830150-109830172 GTGGGGACTCCAATGGGGGAAGG + Intergenic
1088702327 11:112424518-112424540 TGGAGGAATCAGATGGGGCATGG + Intergenic
1089385550 11:118065165-118065187 GTGGAGAAGCAGGTGGGGCAGGG - Intergenic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1091024681 11:132131591-132131613 GTGGGAAATGGGTTGGGGCATGG + Intronic
1091833413 12:3567100-3567122 GAGGGGAAGCAGATAGGGCCAGG - Intronic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1091936165 12:4435890-4435912 GTGGGGAAGCAGCTGGGTCGGGG + Intronic
1092261546 12:6955795-6955817 GAGGGGAGGCAGCTGGGGCAGGG - Intronic
1093443755 12:19230503-19230525 GTGGGGAAGCAGCTGAGGCCCGG + Intronic
1097482311 12:60144322-60144344 GTGGGAAGTCAGAGGTGGCAGGG + Intergenic
1099278085 12:80603813-80603835 GTGATGATACAGATGGGGCAGGG - Intronic
1102008914 12:109606320-109606342 CTGGGGAGTGAGCTGGGGCATGG + Intergenic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1108083001 13:46756818-46756840 GTGGGGGATCAGGGGGTGCAGGG - Intergenic
1108477138 13:50831466-50831488 GTGTGGAGTCAGAAGGGGCTGGG + Intronic
1110428060 13:75391736-75391758 GTAGGGCATCAGATGGTGCAGGG - Intronic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110802996 13:79722062-79722084 GTTGGGATGCAGATGAGGCAAGG + Intergenic
1111694064 13:91601416-91601438 GTCGTGAATGAGATAGGGCAGGG + Intronic
1111938221 13:94580471-94580493 GTGAGGATTCATATGGGGTAAGG + Intronic
1112609954 13:100946284-100946306 GTGGGGAACTGGATGGAGCAAGG - Intergenic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1114424652 14:22611808-22611830 GTTGGGAGGAAGATGGGGCAAGG - Exonic
1115533226 14:34345953-34345975 GTGGGGAAGCAGCTGAGGCCTGG + Intronic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116867380 14:50041801-50041823 GTGGGGAATCAGTTGAGGCCAGG + Intergenic
1117898418 14:60510137-60510159 GTGGGGAAGCAGAGCCGGCAAGG - Intronic
1119400592 14:74359725-74359747 GTGTGGGACCAGGTGGGGCAAGG + Exonic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121269218 14:92626748-92626770 GGGGGGAATTAAATGGGGAAAGG + Intronic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1124499710 15:30216643-30216665 GTGGGGAATGAAATGGGACCAGG + Intergenic
1124743869 15:32322024-32322046 GTGGGGAATGAAATGGGACCAGG - Intergenic
1128074961 15:64820168-64820190 ATGGGGAATAAGCAGGGGCAGGG + Intronic
1128293746 15:66499208-66499230 GTGTGGTATAAAATGGGGCATGG - Exonic
1128352630 15:66901240-66901262 CTGGGGAACCAGAAGAGGCAGGG + Intergenic
1129255015 15:74329592-74329614 GTGGGGTATGAGGTGGGGCTGGG - Intronic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1129892169 15:79078559-79078581 GTGGGGGATCTAGTGGGGCATGG - Intronic
1130064476 15:80592748-80592770 GTGGGGCCTCAGAATGGGCAAGG - Intronic
1130788799 15:87129525-87129547 GTGGGGAATCAAAAGGGTGAGGG + Intergenic
1130986204 15:88846205-88846227 TTGGGGTGTCTGATGGGGCAAGG - Intronic
1131016834 15:89064924-89064946 GAGGGCAATGAGATGGGGCAGGG - Intergenic
1131178927 15:90227442-90227464 GTGGGGAATCAGCTCAGGAAAGG + Intronic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1132727709 16:1345925-1345947 GTGGGAGAGGAGATGGGGCAGGG + Intronic
1133399873 16:5477966-5477988 GTGGGGAGTGAGGTGGGCCACGG - Intergenic
1133648888 16:7790858-7790880 GTTGGGAGTCAGACTGGGCAGGG - Intergenic
1138673507 16:58634244-58634266 GTGGGGAATCACTTGAGGCCAGG - Intergenic
1140092220 16:71847887-71847909 GTGGAGAAGAAGATGAGGCAAGG + Intronic
1140169852 16:72593314-72593336 GGGGGGAATGAAATGGGGTAAGG + Intergenic
1140747142 16:77990747-77990769 GTGGGGAAACATTTGAGGCAAGG - Intergenic
1142062516 16:88039887-88039909 GTGGGGACTCAGAGGGGCCACGG - Intronic
1143205882 17:5139053-5139075 ATGGGGAAGCCGTTGGGGCATGG - Intronic
1147755024 17:42761984-42762006 GTGGGGCATCAGCTGGGGTTGGG - Intronic
1148772678 17:50076263-50076285 GTGAGGATTCAGCTGGGGCAGGG + Intronic
1148918617 17:51007151-51007173 TTGGGGAACGAGATGGGACAGGG + Intronic
1149656985 17:58315330-58315352 GTAGAGAATTGGATGGGGCATGG - Intronic
1149678036 17:58484653-58484675 GTAGGGAATGATAGGGGGCAAGG - Intronic
1150197214 17:63312576-63312598 AGGGGGAAGAAGATGGGGCAAGG + Intronic
1151384210 17:73745276-73745298 GTGGGGAAGGAGATGGGGACAGG + Intergenic
1151849749 17:76683349-76683371 GTGGGGGATCAGATGTGGCCCGG + Intronic
1152432629 17:80257792-80257814 GCGGGGAAGCAGGTGGGACACGG + Intergenic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1157758009 18:50235784-50235806 GTTGGGAATTAAATTGGGCAGGG - Intronic
1158330611 18:56358313-56358335 ATGGGGAATTGCATGGGGCAAGG + Intergenic
1158396442 18:57081865-57081887 GTGGGGAGTGGGGTGGGGCATGG + Intergenic
1160461902 18:79045705-79045727 GTGTGGAATGAATTGGGGCAAGG + Intergenic
1161288369 19:3480070-3480092 GCGGGGACTCAGATGGGGAGGGG + Intronic
1161704896 19:5815047-5815069 GAGGGGAAGCAGATGGGGCCGGG - Intergenic
1161793209 19:6373085-6373107 GTGGAGCATCAGATGGGGCGGGG + Intronic
1162061244 19:8096810-8096832 ATGGGGACTTAGATGGGGTATGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162403166 19:10458107-10458129 GTGGGGGCTCAGTAGGGGCAGGG + Intronic
1162866950 19:13555147-13555169 GGGGGGAATCGGATGGGAAAGGG + Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163258543 19:16172631-16172653 GTTGGGACTCAAATGGGGAAGGG - Intronic
1163270045 19:16247678-16247700 GTGACAAATCAGATGGGGCGGGG - Intergenic
1163703857 19:18800992-18801014 GAGGGGACGCAGCTGGGGCACGG - Intergenic
1164650124 19:29885494-29885516 GTGGGGGATCACTTGGGGCCAGG - Intergenic
1164782168 19:30901546-30901568 GTGGGAAATCAGGTGGGGCCGGG + Intergenic
1166391033 19:42409027-42409049 GTGGGGAGTAGGATGGTGCAGGG + Intronic
1166709941 19:44930394-44930416 GTAGGGGAACAGATAGGGCAAGG + Intergenic
1167019354 19:46861992-46862014 CAGGGGAATGAGCTGGGGCACGG - Intergenic
1167043705 19:47038014-47038036 GTGGCAACCCAGATGGGGCAGGG + Intronic
1167385583 19:49161099-49161121 GTGGGGACTGAGATTGGGAAAGG + Intronic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
925023683 2:590904-590926 GTGGGGAAGGAGACGGGGCGAGG + Intergenic
925321822 2:2976227-2976249 GTGGGAAAAGAGATGGGGAAAGG + Intergenic
925347931 2:3183508-3183530 GTGGGGGATCAGAGGAGGGAAGG - Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927186250 2:20484654-20484676 TGCGGGAATCAGATGGGGCAAGG - Intergenic
927846841 2:26476501-26476523 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846853 2:26476525-26476547 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846865 2:26476549-26476571 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846889 2:26476597-26476619 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846908 2:26476633-26476655 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846934 2:26476681-26476703 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846953 2:26476717-26476739 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
928447787 2:31348290-31348312 GGGGGGACTGAGATGGGCCAAGG - Exonic
928562415 2:32504125-32504147 GTGGGGGATCACTTGGGGCCAGG - Intronic
928776540 2:34771311-34771333 GATGGCCATCAGATGGGGCAAGG - Intergenic
929453283 2:42050100-42050122 TTGGGGAATACGATGGGGGAGGG - Intronic
930395216 2:50814375-50814397 TTGGGGAATGAGAAGGGGTAAGG - Intronic
931472544 2:62553452-62553474 GTAGGGAATCAGCTGGGGGGGGG + Intergenic
931927918 2:67095412-67095434 GAGGCGAATCAGAGTGGGCACGG + Intergenic
931937118 2:67211353-67211375 GTGGGGAATCATTTGAGGCCAGG + Intergenic
932276493 2:70455746-70455768 GTGGGCAAGCAAATGGGGCCAGG + Intronic
934662808 2:96152328-96152350 GAGGGGCATGAGATGGAGCAGGG + Intergenic
934731614 2:96662054-96662076 GTGTGGAAGAAGAAGGGGCATGG + Intergenic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937610196 2:123851967-123851989 CTGGGAACTCAGATGGGGAAAGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
939762472 2:146199682-146199704 GTGGGTAATGAGATGGGGTTTGG - Intergenic
943247081 2:185469070-185469092 GTGGGGGATCAGAGGGGGTAAGG - Intergenic
943262329 2:185682099-185682121 GTGTGGAATGAGATAGTGCAGGG - Intergenic
944706363 2:202292865-202292887 TTGGGGAATTAGTTGGAGCACGG + Exonic
945720454 2:213412057-213412079 GTAGGTAATCAGATGAGTCAGGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
1169612105 20:7392986-7393008 ATGGGGAGCCAGATAGGGCAAGG - Intergenic
1169638242 20:7719462-7719484 GTGAGTAATGACATGGGGCAAGG + Intergenic
1169895405 20:10500453-10500475 GTGTGGAAAAAGATGGGGCCAGG + Intronic
1170594082 20:17792475-17792497 GTGGGGCCTGAGAGGGGGCAGGG - Intergenic
1170800697 20:19587663-19587685 CTGGGGAATCAGACGGGTCTGGG + Intronic
1172272933 20:33664501-33664523 GTGGGGAAGGAGATGGGACAGGG - Intronic
1172509758 20:35492310-35492332 GTGGGGAATGGGGTGGGGAATGG + Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1174046112 20:47735060-47735082 ATGGGAATTCAGAGGGGGCATGG - Intronic
1174340375 20:49891542-49891564 GAGGGGGATGGGATGGGGCAGGG - Exonic
1175241167 20:57550446-57550468 CTGGGGAATGAGGTGGGGTACGG + Intergenic
1175544633 20:59770459-59770481 GTGGAGACTCAGTTGGGCCAGGG - Intronic
1176724275 21:10417090-10417112 ATGGGGAGTCAGATTGTGCAGGG + Intergenic
1178395014 21:32235405-32235427 GAGGGCAACCAGATAGGGCAGGG - Intergenic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1180057075 21:45364586-45364608 GAGGGGCCTGAGATGGGGCAGGG + Intergenic
1181845308 22:25702970-25702992 GTGGAGAATCTGCTGGTGCACGG + Intronic
1182787084 22:32917038-32917060 GTGGGGTATGAGATGAAGCAGGG + Intronic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1183481338 22:38067181-38067203 CTGGGGAATCAGTGGGGACAGGG - Intronic
1184369291 22:44072357-44072379 GTTGGGCATCAGATAGGACAAGG + Intronic
1184411699 22:44329905-44329927 GCTGGGAATCAGATGGTCCAGGG - Intergenic
1185244918 22:49768374-49768396 GTGGGGAGTCAGAGGAGGCAGGG + Intergenic
951280415 3:20742122-20742144 GTGGGAAAGCAGAGGGGGTAGGG - Intergenic
951953712 3:28230311-28230333 GTGGGCAGTCAGATGAGGAATGG - Intergenic
953174262 3:40535219-40535241 GTGAAGAATCAGATACGGCAAGG - Exonic
953658065 3:44870008-44870030 GTGGTGAATCAGATAGGTTAGGG + Intronic
953679787 3:45030582-45030604 GCTGGGGATCAGATGGGGCTGGG - Intronic
953734058 3:45476311-45476333 GTGGGGATTGAGATGGTGCCTGG - Intronic
955402623 3:58604032-58604054 GAGGGGCATCTGGTGGGGCAGGG - Intronic
955716150 3:61832432-61832454 GTGGGTAAGCATCTGGGGCAGGG + Intronic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
959585475 3:108021443-108021465 CTGGGAAATAAGGTGGGGCATGG + Intergenic
960057414 3:113285248-113285270 GTGAGAGCTCAGATGGGGCAAGG - Intronic
960533292 3:118789248-118789270 GGGTGGAATGGGATGGGGCAGGG - Intergenic
961626053 3:128264560-128264582 GAGAGGAGCCAGATGGGGCAGGG - Intronic
962845925 3:139273711-139273733 GTGTGGAATGGGATGGGTCATGG + Intronic
962938070 3:140099951-140099973 GTGGGTAATCAGGTGTTGCAGGG + Intronic
963340570 3:144027525-144027547 GTGGGGGATCAATTGGGGCTAGG - Intronic
964325485 3:155541529-155541551 ATGGGGAATCAGGTGGTTCATGG + Intronic
967280219 3:187815187-187815209 GTGGGGCATCAGCTTGGGCTAGG - Intergenic
968270333 3:197398693-197398715 GTGGGGAGTGATGTGGGGCAGGG - Intergenic
968890854 4:3367699-3367721 GTGAGGAAAGGGATGGGGCAGGG - Intronic
968960883 4:3743080-3743102 GTGGGGAGTTGGATGGGGGAAGG - Intergenic
971578467 4:28305518-28305540 GTGGGGAACCATACGGGGGATGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
978197554 4:105988934-105988956 TTGGGGAATCCGATGTGGCAAGG - Intronic
979239568 4:118436315-118436337 GTGGGGAGTGAGGTGAGGCAGGG + Intergenic
979670692 4:123357424-123357446 GTGGGGAATAGGCTGGGGCTGGG - Intergenic
979681627 4:123466444-123466466 GAAGGACATCAGATGGGGCAGGG + Intergenic
980062479 4:128146637-128146659 GAGGGGAATGGGATTGGGCAGGG + Intronic
980669162 4:135981397-135981419 GTTTGGAACCAGGTGGGGCACGG - Intergenic
982603460 4:157483070-157483092 GTGTGGGATCAGATAGGGAAAGG + Intergenic
982765462 4:159342813-159342835 CTGGGGAATGAGATGGCACAGGG - Intronic
983358062 4:166690487-166690509 GTGGGGAAACAGATGTGGATGGG + Intergenic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
986033655 5:3917585-3917607 GTGGGGAATCTCATGGGGCTGGG + Intergenic
986572732 5:9181866-9181888 GCTGGGAGTGAGATGGGGCAGGG - Intronic
991511052 5:67376515-67376537 GAAGGGAACCAGATGAGGCAGGG - Intergenic
992676819 5:79112952-79112974 GTAGGGAGGCAGATGGGGCCAGG + Intronic
993783804 5:92103158-92103180 GGGGGGAATCAACTGGGACAAGG - Intergenic
995046331 5:107652974-107652996 CTGGGGCATCAGATGGGTGAGGG - Intronic
996009177 5:118461840-118461862 GTTGGGAACAAGAAGGGGCACGG - Intergenic
997829746 5:137139777-137139799 GAAGGGAGTCAGATGGGGCAGGG - Intronic
1000072811 5:157756689-157756711 GTGGGGAAAAAGCTGAGGCACGG - Exonic
1000948763 5:167454636-167454658 GATGGGAAAGAGATGGGGCAGGG - Intronic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002471613 5:179439087-179439109 GTGGGGAACCATGTGGGGCCTGG - Intergenic
1002739818 5:181426903-181426925 GTGGGGAGTGAGGTGAGGCAGGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004997798 6:21210943-21210965 ATGAGGAAGCAGATGGGGCATGG - Intronic
1006006882 6:31009872-31009894 GTAGGGAAGAGGATGGGGCACGG - Intergenic
1006327415 6:33364974-33364996 GTGGGGAAACAGCTGAGGGAAGG + Intergenic
1006327457 6:33365138-33365160 GGGCAGAATCAGTTGGGGCAGGG + Intergenic
1006508075 6:34503555-34503577 GAGGGGAATTAAATAGGGCAAGG - Intronic
1007026131 6:38576631-38576653 GTGGGAGATCAGATGGGTCATGG + Intronic
1009981773 6:70734594-70734616 GTGGGGACTCTGATGAGGCTGGG + Intronic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010754669 6:79653679-79653701 GTGAGGAAAGAGATGGGGTATGG + Intronic
1011411856 6:87074462-87074484 GTGGGGACCCAGCTGGGGCCTGG + Intergenic
1012971389 6:105735517-105735539 GTTTGGAATGAGAAGGGGCATGG + Intergenic
1015825760 6:137309806-137309828 GTAGGGTTTCAGATGGGGAATGG - Intergenic
1017967016 6:159275792-159275814 GTGGGGAATCAGAGAAGGGATGG - Intergenic
1019244931 6:170702489-170702511 GTGGGGAGTGAGGTGAGGCAGGG + Intergenic
1020256157 7:6504025-6504047 GCGGGGAATCTGAAGGGGCAGGG + Intronic
1023103233 7:36739866-36739888 GGTGGGAATCAGATCAGGCAAGG - Intergenic
1023287739 7:38636790-38636812 GTGGGGGATCCCATGGTGCAAGG - Intergenic
1024554079 7:50588302-50588324 CTGGGAAATGGGATGGGGCAGGG + Intergenic
1026096828 7:67353120-67353142 GTTGGGAAAAAAATGGGGCAGGG + Intergenic
1026255648 7:68708970-68708992 CTCAGGAATCGGATGGGGCAGGG + Intergenic
1026837697 7:73649401-73649423 GGGGGGACTCAGAGGGAGCATGG - Intergenic
1029449385 7:100632410-100632432 GGGGGAAATCAGATGGGGAAGGG - Intronic
1032996793 7:137455777-137455799 CTGGGGAGTCATATCGGGCATGG - Intronic
1034613535 7:152394327-152394349 GTGGGGAGTCAGATTGTGCAGGG - Intronic
1035503192 8:105698-105720 GTGGGGAGTGAGGTGAGGCAGGG - Intergenic
1035781832 8:2233733-2233755 GCGGGGACTGAGGTGGGGCAGGG + Intergenic
1035810286 8:2485673-2485695 GAGGGGACTGAGGTGGGGCAGGG - Intergenic
1036047284 8:5158011-5158033 GTGGGGAATCTGATGAAGCAGGG - Intergenic
1036142594 8:6222317-6222339 GTTGGGAGTGGGATGGGGCAGGG - Intergenic
1036535669 8:9649340-9649362 ATGGCGAATAAGATGAGGCAAGG + Intronic
1039768502 8:40658464-40658486 GTGGGAATTGGGATGGGGCATGG + Intronic
1039971469 8:42324776-42324798 GTGGGGCAGGAGCTGGGGCAGGG + Intronic
1040070287 8:43181664-43181686 GTTGGGTAGCAGATAGGGCAGGG + Intronic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1042578226 8:70246353-70246375 GTGGGGAAAAAGATGGTGTAAGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043522578 8:81062442-81062464 ATGGGGCATCAGATGGGTAATGG + Intronic
1043865048 8:85365033-85365055 GTGGGTGGTCAGATGGGGCAGGG + Intronic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1046621930 8:116537394-116537416 GTGGAGAATCCACTGGGGCATGG - Intergenic
1047030097 8:120867398-120867420 GTGGGTAAGAAGCTGGGGCAGGG - Intergenic
1048635485 8:136290943-136290965 GTGGGAAATAAGAGGTGGCAAGG + Intergenic
1050834344 9:10057073-10057095 TTGGGGAATAAGATGGGACTAGG - Intronic
1050975504 9:11932667-11932689 GTGGGGCACATGATGGGGCAGGG + Intergenic
1051585523 9:18722897-18722919 ATGTGGAACCAGGTGGGGCAGGG - Intronic
1052260136 9:26505514-26505536 GTGGGGAATCAGATTTTGGAAGG - Intergenic
1053245614 9:36532403-36532425 ATTGGGAAACAGATGTGGCAAGG - Intergenic
1055508507 9:76971424-76971446 GGGCAGAATCAGTTGGGGCAGGG - Intergenic
1056572548 9:87828473-87828495 GTGGGGCATTAGTGGGGGCAAGG - Intergenic
1056681511 9:88723081-88723103 GTGGGGAATGAGCAAGGGCAGGG - Intergenic
1057802824 9:98200386-98200408 GTGGGGGCTCAGGTAGGGCATGG + Intronic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059447242 9:114346024-114346046 GTGGGGCATCAGAGGGGGCAAGG + Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1061545877 9:131304018-131304040 ATGGGGAAGCACAGGGGGCAGGG + Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062287629 9:135780136-135780158 GTGGGGAATGCGGTGGGGCTGGG - Intronic
1062342097 9:136098298-136098320 GTGGGGAAGGATGTGGGGCATGG - Intergenic
1062571420 9:137187431-137187453 GCGGGGAACCAGAAGGAGCAAGG + Intronic
1203605124 Un_KI270748v1:51710-51732 GTGGGGAGTGAGGTGAGGCAGGG + Intergenic
1186966617 X:14793837-14793859 GTCAGGAGTCAGAAGGGGCATGG + Intergenic
1187246596 X:17558283-17558305 GTGGAGAATGAGATGGGGGCAGG - Intronic
1188417722 X:29956408-29956430 GTGGGGAATGAGGTGGGACAAGG - Exonic
1188770554 X:34148063-34148085 GAGGGGAATGAGATTGGGCAGGG + Intergenic
1189010504 X:37042467-37042489 GAAGGGAATGAGATTGGGCAGGG - Intergenic
1190261886 X:48802535-48802557 GTGGAGAATCAGATCGCGTAAGG + Intronic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1190650382 X:52563340-52563362 GTGGGGGATGAGGTGAGGCAAGG - Intergenic
1193401917 X:81055299-81055321 GGGGGGCACCAGTTGGGGCAAGG - Intergenic
1195363544 X:104107008-104107030 GTGGGGATATGGATGGGGCAGGG - Intronic
1197130040 X:122994828-122994850 CTGGTAAATCAGATGGGTCAGGG - Intergenic
1197820660 X:130537946-130537968 GTTGGGAATTAAATTGGGCAGGG - Intergenic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1198637710 X:138717718-138717740 TTGGGGACTGAGATGGGACATGG - Intronic
1199600675 X:149539752-149539774 GTGTGGGAGCAGATGGGGCGGGG - Intergenic
1199850284 X:151721286-151721308 ATGGGGAATCACATGGTGCCTGG - Intronic
1201455089 Y:14160747-14160769 GTGGGGATCCATATGGGGGAAGG - Intergenic
1201604693 Y:15771965-15771987 GTGGGGAACCATATTGGGGATGG - Intergenic
1202387310 Y:24338111-24338133 GTGGGGAGTGAGGTGAGGCAGGG + Intergenic
1202483476 Y:25332017-25332039 GTGGGGAGTGAGGTGAGGCAGGG - Intergenic