ID: 1131265104

View in Genome Browser
Species Human (GRCh38)
Location 15:90911052-90911074
Sequence AGAACTCATCCGGATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 107}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131265104_1131265115 14 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265115 15:90911089-90911111 CGCTGGTCCACACCTGGGACAGG 0: 1
1: 0
2: 3
3: 6
4: 113
1131265104_1131265113 9 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265113 15:90911084-90911106 GCAGCCGCTGGTCCACACCTGGG 0: 1
1: 0
2: 1
3: 9
4: 133
1131265104_1131265109 -3 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265109 15:90911072-90911094 TCTGTGCCCAGTGCAGCCGCTGG 0: 1
1: 0
2: 1
3: 27
4: 309
1131265104_1131265118 19 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265118 15:90911094-90911116 GTCCACACCTGGGACAGGTGGGG 0: 1
1: 0
2: 1
3: 35
4: 270
1131265104_1131265124 29 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265124 15:90911104-90911126 GGGACAGGTGGGGTGGGAGGAGG 0: 1
1: 1
2: 49
3: 264
4: 2139
1131265104_1131265121 23 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265121 15:90911098-90911120 ACACCTGGGACAGGTGGGGTGGG 0: 1
1: 0
2: 7
3: 51
4: 414
1131265104_1131265116 17 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265116 15:90911092-90911114 TGGTCCACACCTGGGACAGGTGG 0: 1
1: 0
2: 0
3: 23
4: 197
1131265104_1131265120 22 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265120 15:90911097-90911119 CACACCTGGGACAGGTGGGGTGG 0: 1
1: 0
2: 7
3: 59
4: 578
1131265104_1131265112 8 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265112 15:90911083-90911105 TGCAGCCGCTGGTCCACACCTGG 0: 1
1: 0
2: 0
3: 20
4: 148
1131265104_1131265117 18 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265117 15:90911093-90911115 GGTCCACACCTGGGACAGGTGGG 0: 1
1: 0
2: 1
3: 23
4: 163
1131265104_1131265123 26 Left 1131265104 15:90911052-90911074 CCTTCCCCATCCGGATGAGTTCT 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1131265123 15:90911101-90911123 CCTGGGACAGGTGGGGTGGGAGG 0: 2
1: 0
2: 20
3: 134
4: 999

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131265104 Original CRISPR AGAACTCATCCGGATGGGGA AGG (reversed) Intronic
900583206 1:3419366-3419388 ACAGCTCATCGGGATGGGGGAGG + Intronic
901412506 1:9094324-9094346 AAAACTCCTCCAGATGGGCACGG + Intergenic
901460083 1:9386155-9386177 AGACTCCATCCGAATGGGGAAGG - Intergenic
903182076 1:21609850-21609872 AGGAATCATCGGGATGGTGAAGG + Intronic
905145968 1:35887065-35887087 AGAACTCAGCTACATGGGGAAGG - Intronic
905430420 1:37918505-37918527 AGAACTTATGTGGCTGGGGAGGG - Intronic
905889829 1:41512060-41512082 AGAACACAGGCAGATGGGGATGG + Intronic
907159394 1:52359704-52359726 AGAGCTCATGAGGATTGGGAAGG - Exonic
910467098 1:87511416-87511438 GGAACTCATAGGGATAGGGAGGG + Intergenic
911671433 1:100613109-100613131 AGAACTCATCCCCATGGGGAGGG - Intergenic
921036673 1:211385485-211385507 AGAACTAAGCCAGATGTGGAAGG + Intergenic
922860556 1:228812208-228812230 AGAACCCATCCTGCTGGGGACGG + Intergenic
923417073 1:233773372-233773394 AGAACTCATTACCATGGGGAGGG + Intergenic
1068944804 10:62719035-62719057 AGAAGTCAGACGGTTGGGGAAGG - Intergenic
1072491525 10:95910524-95910546 AGAACTCATCATGAAGGGGATGG + Intronic
1073257066 10:102159482-102159504 AGAACTCTTCCGGGTAGGGGTGG - Exonic
1073650667 10:105354649-105354671 AGAACCCATCCGGAGAGGGTAGG + Intergenic
1074536570 10:114332293-114332315 AGAGCTCATCCAGATGAGGTTGG - Intronic
1074974621 10:118569963-118569985 TGACCTCACCCTGATGGGGAAGG - Intergenic
1074975004 10:118572854-118572876 TGACCTCACCCTGATGGGGAAGG - Intergenic
1080390504 11:31841722-31841744 AGAATTCTTCCTGGTGGGGATGG - Intronic
1081673581 11:44955364-44955386 AGAACTGATCAGGATGGGGGTGG + Intergenic
1081709586 11:45208244-45208266 AGAACTGACCGGGACGGGGAAGG + Intronic
1084945094 11:72634109-72634131 AGACCTCACGGGGATGGGGAGGG + Intronic
1085192146 11:74636245-74636267 AAAACTTACCTGGATGGGGAAGG + Exonic
1086584693 11:88437249-88437271 AGAACTCATCACCAAGGGGATGG + Intergenic
1087922055 11:103877622-103877644 AGAATTCAGCCTGGTGGGGAGGG - Intergenic
1090188427 11:124752767-124752789 AGATCTCTTCCAGATGGGCAAGG + Intronic
1092060867 12:5549135-5549157 AGAGCTCAGCCGAGTGGGGATGG + Intronic
1094121159 12:26975829-26975851 AGAACTCATATGGATGTTGAAGG - Intronic
1095595952 12:43958665-43958687 AGAACTCATCTGGCTGGGTGTGG + Intronic
1095710343 12:45281594-45281616 AGAACTCATAAGCATGGGGATGG + Intronic
1096235467 12:49923301-49923323 AGGACTCAGCAGGATGGGCAGGG + Intergenic
1096242811 12:49968311-49968333 AGAACACAAACTGATGGGGAGGG - Intronic
1096743343 12:53710297-53710319 AGAAGTCATCCAGGTGGGGCTGG + Intronic
1097556430 12:61144737-61144759 AGAACTCATCAGTATTGTGAGGG + Intergenic
1103972917 12:124683267-124683289 AGAGCTCAGCCTGATGGGGATGG - Intergenic
1110078596 13:71282356-71282378 AGAAGTCATCCAAATTGGGAAGG - Intergenic
1116602027 14:46938246-46938268 AGATATCATCCGGCTGGGCATGG + Intronic
1116849675 14:49894803-49894825 AGAACTCATAAGGAAGGGGGGGG - Exonic
1116975358 14:51109861-51109883 AGAACTCATTACCATGGGGAGGG + Intergenic
1120402263 14:84047087-84047109 AGAACTCATGAGGCTGGGCACGG + Intergenic
1124243150 15:28047791-28047813 AAAAGACATCCAGATGGGGAAGG + Intronic
1124553471 15:30705179-30705201 AGAACTCATTGAGATGGAGAGGG + Intronic
1124677774 15:31700489-31700511 AGAACTCATTGAGATGGAGAGGG - Intronic
1126621609 15:50645620-50645642 AGAACAAATCCGGCTGGGCACGG - Intronic
1126644454 15:50861085-50861107 AGAAGTCATTCAGATAGGGAAGG - Intergenic
1130081706 15:80739520-80739542 AGAACTCATTACCATGGGGAGGG - Intronic
1130850143 15:87784734-87784756 AGAACTCATCCCCGTGGGGTAGG - Intergenic
1131265104 15:90911052-90911074 AGAACTCATCCGGATGGGGAAGG - Intronic
1135551072 16:23398734-23398756 AGAACTCAGAGGGATGGGGATGG + Intronic
1138658387 16:58503570-58503592 TGAACTGATCTGCATGGGGAAGG - Intronic
1138873698 16:60924204-60924226 AGAAATCATTTGGCTGGGGATGG + Intergenic
1138895927 16:61204560-61204582 ATAATTAATCTGGATGGGGAGGG - Intergenic
1143976634 17:10835214-10835236 AGAAGCCATGCGGCTGGGGAGGG + Intronic
1144183958 17:12778515-12778537 ATAAATAATCCGGATGGGTATGG - Intergenic
1148603397 17:48910240-48910262 AGATCTCTTCAGGCTGGGGAGGG - Intronic
1148666506 17:49378937-49378959 AGAGCTTATCTGGATGGGGAAGG + Intronic
1149524855 17:57347474-57347496 TGAACACATGCGGATGGGGCTGG - Intronic
1149790007 17:59468533-59468555 AGCACTGATCCGGCTGGGCATGG - Intergenic
1158211342 18:55053929-55053951 AGAACTGATCCAGTTGGGGAAGG + Intergenic
925390873 2:3493054-3493076 ACATCTCATCCGGATGGGCATGG - Intergenic
928538078 2:32259050-32259072 GGAACTCATGTGGATGGGGTTGG + Intronic
934040827 2:88126316-88126338 AGAGCTCATCCAGAAGGGGAAGG - Exonic
945989127 2:216378842-216378864 AGAGCTCATGGGGGTGGGGAGGG + Intergenic
947962650 2:234252664-234252686 AGCACCCATCTGGATGGGGAAGG + Intergenic
948472583 2:238193769-238193791 AGAGCTCCTCTGGTTGGGGAAGG - Intronic
948935477 2:241161563-241161585 AGATCTAATCCTGCTGGGGACGG - Intronic
1173134779 20:40429838-40429860 GGAACTCATTAGCATGGGGAGGG + Intergenic
1175535371 20:59707373-59707395 GGAACTCATCACCATGGGGAGGG - Intronic
1182390789 22:29993790-29993812 AGATATCATCAGGAAGGGGAAGG - Intronic
1182528463 22:30936994-30937016 AGAACTCAGCTGGAAGGGGAGGG + Exonic
1183362613 22:37390539-37390561 AGAGCTCACCCCCATGGGGAGGG - Intronic
1183934717 22:41255558-41255580 AGATCTCATCCTGATGTGGTGGG - Intronic
1184718418 22:46295350-46295372 AGAACTCATCACCAAGGGGATGG + Intergenic
956124921 3:66002234-66002256 AAAACACGTCTGGATGGGGAGGG + Intronic
967914883 3:194571401-194571423 AAAACTAATTCGGCTGGGGAAGG + Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969615054 4:8247381-8247403 GGGACTCATCCGCATGGGGAGGG + Intergenic
969674600 4:8607872-8607894 TGGGCTCCTCCGGATGGGGAAGG + Intronic
971424987 4:26507298-26507320 AGACCCCATTCCGATGGGGAAGG - Intergenic
981791055 4:148536790-148536812 AGAGCTCATGCTGTTGGGGAAGG - Intergenic
982189186 4:152835976-152835998 AGAACTCATCACCAAGGGGATGG + Intronic
985168583 4:187124267-187124289 AGATCCCATCAGTATGGGGAAGG + Intergenic
985955047 5:3258552-3258574 ATAGCTCATCAGGATGGTGACGG + Intergenic
987165880 5:15197281-15197303 AGAAAGCATCAGTATGGGGAGGG + Intergenic
987440924 5:17955599-17955621 AGAACTCATTATTATGGGGAAGG - Intergenic
988108878 5:26788234-26788256 AGAACTGATTAGTATGGGGAAGG + Intergenic
988981648 5:36575485-36575507 AGAATACAACTGGATGGGGAAGG + Intergenic
990491859 5:56310478-56310500 AGAACTCCTGTGGATGGGGGTGG + Intergenic
990988746 5:61664633-61664655 AGAAGTCTTCCAAATGGGGAAGG + Intronic
997807063 5:136928447-136928469 AGAACACATGCACATGGGGAGGG - Intergenic
998079926 5:139266333-139266355 AGATCTCCTACGGATGGGGTGGG + Intronic
1003136440 6:3438252-3438274 AGGACCCATCCTGCTGGGGAAGG + Intronic
1005889717 6:30127239-30127261 TGAAGTCCTCAGGATGGGGAGGG + Intergenic
1008712801 6:54249054-54249076 AGAAGTTATGCTGATGGGGATGG - Intronic
1010266405 6:73873047-73873069 AGAACTCATTACCATGGGGAGGG - Intergenic
1013324995 6:109036139-109036161 AGGAGTCATCAGAATGGGGAGGG + Intronic
1013676473 6:112468891-112468913 AGAACTCAACAGCCTGGGGAAGG - Intergenic
1016691936 6:146948147-146948169 AGAACTCACCCCCAAGGGGAAGG - Intergenic
1017932132 6:158965726-158965748 AAAAGTCATCCGGATTGGAAAGG - Intergenic
1021661312 7:22920869-22920891 AGAACTCATCACCATGGGGATGG - Intergenic
1022118455 7:27283431-27283453 AGACCTCATCTGGAAGAGGAAGG - Intergenic
1024147106 7:46528877-46528899 AGAAAGCATCCAGATGGTGAGGG - Intergenic
1041491627 8:58438948-58438970 AGAACTCATTACCATGGGGATGG - Intronic
1042208500 8:66352987-66353009 AGAACTGGTATGGATGGGGAGGG + Intergenic
1044194718 8:89361095-89361117 AGAACTCATTACCATGGGGAGGG - Intergenic
1044549054 8:93492040-93492062 CGAACTCAAAAGGATGGGGAGGG + Intergenic
1051127692 9:13822434-13822456 TGAACTCATCACTATGGGGAAGG - Intergenic
1052819834 9:33129756-33129778 AGAACTAATGAGGTTGGGGAGGG + Intronic
1053321980 9:37106837-37106859 AGAACCCATCAGGCTGGGCATGG - Intergenic
1053477288 9:38391664-38391686 AGTACTCTGCCGGATGTGGAAGG - Intergenic
1055468292 9:76587015-76587037 AGAAATCAAGCAGATGGGGACGG + Intergenic
1056935700 9:90913656-90913678 AGAAGTCACCTGGATGGGGGTGG + Intergenic
1058910702 9:109517734-109517756 AGAGCACATCTGGATGGGCAAGG - Intergenic
1059442200 9:114314726-114314748 AGAAGTGAGCCAGATGGGGAAGG + Intergenic
1059557117 9:115292729-115292751 AGGCCTCAACCAGATGGGGATGG - Intronic
1060348402 9:122836824-122836846 AGAACTCATCACCAAGGGGATGG + Intergenic
1060448136 9:123710961-123710983 AGATCTCTTCCGGCTGGGCATGG - Intronic
1187978179 X:24725486-24725508 AGAAGTCATTCGGCTGGGCACGG - Intronic
1190920348 X:54845517-54845539 AGAACGCATCAGTATGGTGAGGG + Intergenic
1194838997 X:98715452-98715474 AAAAGTCATCAGGCTGGGGAAGG - Intergenic
1196643632 X:118092659-118092681 AGAACTCAAGAGGAGGGGGAAGG - Intronic