ID: 1131266792

View in Genome Browser
Species Human (GRCh38)
Location 15:90920238-90920260
Sequence CTGATCCTGCTCATCACACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131266792_1131266801 4 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266801 15:90920265-90920287 ACTCTGGGAGGACAGGGGTGGGG 0: 1
1: 0
2: 9
3: 105
4: 1256
1131266792_1131266803 23 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266803 15:90920284-90920306 GGGGACCCAGAGTTAGCAGTGGG 0: 1
1: 0
2: 2
3: 16
4: 205
1131266792_1131266796 -3 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266796 15:90920258-90920280 CAGAGTGACTCTGGGAGGACAGG 0: 1
1: 0
2: 2
3: 19
4: 238
1131266792_1131266798 -1 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266798 15:90920260-90920282 GAGTGACTCTGGGAGGACAGGGG 0: 1
1: 1
2: 3
3: 33
4: 393
1131266792_1131266797 -2 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266797 15:90920259-90920281 AGAGTGACTCTGGGAGGACAGGG 0: 1
1: 0
2: 0
3: 34
4: 402
1131266792_1131266802 22 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266802 15:90920283-90920305 TGGGGACCCAGAGTTAGCAGTGG 0: 1
1: 0
2: 1
3: 25
4: 257
1131266792_1131266800 3 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266800 15:90920264-90920286 GACTCTGGGAGGACAGGGGTGGG 0: 1
1: 0
2: 5
3: 60
4: 620
1131266792_1131266804 24 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266804 15:90920285-90920307 GGGACCCAGAGTTAGCAGTGGGG 0: 1
1: 0
2: 0
3: 45
4: 790
1131266792_1131266795 -8 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266795 15:90920253-90920275 AGGATCAGAGTGACTCTGGGAGG 0: 1
1: 0
2: 3
3: 18
4: 210
1131266792_1131266806 28 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266806 15:90920289-90920311 CCCAGAGTTAGCAGTGGGGATGG 0: 1
1: 0
2: 1
3: 26
4: 280
1131266792_1131266799 2 Left 1131266792 15:90920238-90920260 CCTGGTGTGATGAGCAGGATCAG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1131266799 15:90920263-90920285 TGACTCTGGGAGGACAGGGGTGG 0: 1
1: 0
2: 3
3: 51
4: 818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131266792 Original CRISPR CTGATCCTGCTCATCACACC AGG (reversed) Exonic
901551831 1:10001206-10001228 CTGATCCTGCAGCTCCCACCCGG + Intronic
905518827 1:38581924-38581946 CTGTCACTGCTAATCACACCAGG - Intergenic
906691177 1:47793574-47793596 CTGGACATGCTCACCACACCTGG - Intronic
906757964 1:48338979-48339001 CTGATACTGCTCAACATAACTGG + Intronic
909549783 1:76884930-76884952 CTGATCTTGCTCATCATAGAGGG - Intronic
911173596 1:94796178-94796200 CTGATCCTGACCATCACAGCTGG + Intergenic
915185986 1:154105603-154105625 CTGCTCATGGTCATCACAGCTGG - Intronic
920839108 1:209538974-209538996 CTGCTCCACCTCATCACCCCAGG + Intergenic
922720265 1:227896692-227896714 CTGTCCCTGCTCATCTCTCCTGG - Intergenic
922791005 1:228311066-228311088 CTGCCCCTGCTCAGGACACCTGG - Intronic
1065621108 10:27582728-27582750 CTGATCCTCCCTATCACCCCAGG + Intergenic
1069085875 10:64138972-64138994 CTGACCCTGCTCCTGACAACAGG + Intergenic
1071255403 10:83867806-83867828 CTGATCCTGATCATTGCACTTGG - Intergenic
1071432350 10:85616328-85616350 GTGATGCTGCTCATCAGAGCTGG + Intronic
1071730971 10:88248175-88248197 CTGAACTTGCTCATCACAAAAGG - Intergenic
1077463293 11:2721679-2721701 CTGATGCTGCAGATCACGCCAGG + Intronic
1084120911 11:67068429-67068451 CTGAGCCTGCACTTCACCCCAGG - Intronic
1086265939 11:84998235-84998257 CTGGTCCTGCCCTTGACACCTGG - Intronic
1089324339 11:117647126-117647148 CTGAGCCTGCTCACCAGAGCTGG + Intronic
1090376429 11:126292836-126292858 CGGGTGCTGCTCATCACGCCGGG + Exonic
1091251247 11:134146016-134146038 CATCTCCTGCTCCTCACACCTGG - Exonic
1091782509 12:3222849-3222871 CTGACCCTGATCCTCACAGCAGG + Intronic
1092223274 12:6729896-6729918 CCCATCTTGCTCATCACTCCAGG + Intronic
1096543972 12:52324249-52324271 CTGTGCCTGCCCTTCACACCTGG + Intergenic
1097773633 12:63620361-63620383 CCAATCCTGCTCTTCACAGCAGG - Intronic
1100334546 12:93617176-93617198 CTGTTCCTGCTTATTGCACCTGG - Intergenic
1101161430 12:101980337-101980359 CTTATCATTCTTATCACACCAGG - Intronic
1102988009 12:117294273-117294295 CTGCTCCTCCTCCTCACGCCTGG - Intronic
1104798994 12:131540558-131540580 GTGACCCTGCTAATCACAGCTGG + Intergenic
1111336414 13:86830519-86830541 CTCATCCTTCTCATCAAACAAGG + Intergenic
1111358646 13:87145173-87145195 CTGGTCCTGCTCTTGACACATGG - Intergenic
1113601234 13:111569639-111569661 AAGATTCTGCTCATCACACTGGG - Intergenic
1117064372 14:51995438-51995460 CTGATCCTCCTGAGCCCACCTGG + Intronic
1118236613 14:64011053-64011075 CTGATGCTGCTCTTGACAACTGG - Intronic
1119400737 14:74360506-74360528 CTGCTGCTGCTCATTACAGCAGG - Intergenic
1120413925 14:84194743-84194765 CTGATCCTGCCCTTGACACATGG - Intergenic
1121682889 14:95808896-95808918 CAGATCCTACTCTTCAGACCAGG + Intergenic
1121695380 14:95908139-95908161 CTGATGCTGTTCATGGCACCTGG + Intergenic
1124230531 15:27941970-27941992 TTGATTATGCTCATCATACCAGG - Intronic
1125057145 15:35374795-35374817 CTGCTGCTCCTCATCATACCTGG - Intronic
1125525311 15:40370484-40370506 CTGCTCCTACTCCTCACATCTGG + Exonic
1125725116 15:41864202-41864224 CTGATCTTGCTCACTTCACCTGG - Intronic
1128055126 15:64693788-64693810 CTGATGCTGCTCCTCACCCATGG - Intronic
1128093198 15:64933009-64933031 CTGGAGCTGCTCATCACGCCAGG + Intronic
1128935220 15:71740528-71740550 CTCATCCTGCTCACAACACAAGG - Intronic
1131266792 15:90920238-90920260 CTGATCCTGCTCATCACACCAGG - Exonic
1132088564 15:98928271-98928293 CTGATCCTTGTCTTTACACCAGG - Intronic
1134254395 16:12599765-12599787 TTGATCCTGCTCATCTTCCCTGG + Intergenic
1138346673 16:56324515-56324537 GCGATCCTGCTCCTCACGCCTGG - Intronic
1140100251 16:71910202-71910224 GCCATCCTGCTCATCCCACCTGG + Intronic
1142619799 17:1157739-1157761 ATGGTCCTGCTGATCCCACCAGG - Intronic
1144752334 17:17657808-17657830 CTGAGCCTGCTCACCCCTCCTGG + Intergenic
1145017773 17:19410340-19410362 CTGCTCCTTCTCATCCCTCCTGG - Intergenic
1145063220 17:19745116-19745138 CTGATCTTGCTCATGGCGCCTGG + Exonic
1146371561 17:32267764-32267786 CTGAGCCTGGTCATGACTCCTGG + Intronic
1151109422 17:71657587-71657609 CTGCTCCTGCTCATGTCCCCAGG - Intergenic
1152225200 17:79089761-79089783 CTGCTCCTGCTCCTCCCACCGGG + Intronic
1152561549 17:81081321-81081343 CTGATCCTGCTCCTCAGCACAGG + Intronic
1152829996 17:82491208-82491230 CTCCTCCTCCTCCTCACACCAGG - Intergenic
1153816663 18:8796317-8796339 CAGATTCTTCTCATCACTCCAGG - Exonic
1159790515 18:72773534-72773556 CTGTTCCTGCGCTTGACACCTGG - Intronic
1160171950 18:76562554-76562576 CTGCTCCTGCTGAGGACACCCGG + Intergenic
1160717429 19:582646-582668 CAGATCCCGCCCACCACACCTGG - Intronic
1161360900 19:3849150-3849172 CTGGTGCTGCTCAGCACGCCTGG - Intronic
1162438639 19:10679330-10679352 CTGCTCCTGCTTGCCACACCTGG + Intronic
1162835391 19:13313626-13313648 CCGATCCTTCTCATCGAACCAGG - Intronic
1166389346 19:42400419-42400441 CTGCTCCTGCTGACCACTCCAGG + Intergenic
1167940899 19:52945123-52945145 CTAATCCTCCTCAGCACACACGG + Intronic
925647960 2:6056392-6056414 CTGATCCTCTCCATCTCACCAGG - Intergenic
925919412 2:8628729-8628751 CTGAACCTGCTTACCCCACCTGG + Intergenic
926332076 2:11833905-11833927 CAGACCCTGCTCCTCTCACCAGG + Intergenic
926825241 2:16899906-16899928 TTGTTGCTGCTCATCAGACCTGG + Intergenic
929344983 2:40871005-40871027 CTGATGCTGCTCTTGACCCCAGG + Intergenic
930875277 2:56208540-56208562 AAGATCCTGCTCACCAAACCAGG - Intronic
931433371 2:62227665-62227687 CTCTTCCTGCTCATCACCCCAGG + Intergenic
933505144 2:83167574-83167596 TTGGTCCTACTCTTCACACCAGG - Intergenic
936396175 2:112132862-112132884 CTCTGCCTGCTCATCTCACCTGG + Intergenic
937176061 2:119936399-119936421 CTGGTCCTGCCCTTGACACCTGG - Intronic
938540072 2:132278505-132278527 CAGATCCGGCTCATCCCAACAGG + Intergenic
942381992 2:175401226-175401248 CTGATCCTGCCCTTGACACTTGG + Intergenic
943364355 2:186955180-186955202 CTGATCCTCAACAACACACCTGG + Intergenic
944187789 2:196968528-196968550 CTGATCCTCCTCCTCCCACTAGG - Intronic
945495153 2:210500176-210500198 CTGATCCCGCCCTTGACACCTGG + Intronic
946364972 2:219243453-219243475 CTGATCCCGCTCACCGCACCCGG + Intronic
1169429832 20:5526395-5526417 CTGTTCCTGCTCATCACATCTGG + Intergenic
1171014147 20:21524349-21524371 CTGTTCCTGCTCAGCACTTCAGG - Intergenic
1171419983 20:25011587-25011609 CTGACCCTCCTGATCACATCTGG + Intronic
1171869007 20:30511526-30511548 CGGATCCAGCTCATCCCAACGGG + Intergenic
1173476684 20:43364721-43364743 CTGTCCCTCCTCATCCCACCAGG + Intergenic
1176368575 21:6048919-6048941 ATGATCCAGCTCCTCCCACCAGG - Intergenic
1178680045 21:34666714-34666736 CTGATCCTGTGGATCACACAAGG - Intergenic
1178698507 21:34814713-34814735 CTGGTCCTGCTCAGCACAAACGG - Intronic
1178746411 21:35254985-35255007 CTGATCCTGCTGATCACTTAGGG - Intronic
1179716360 21:43290763-43290785 CTGACAGTCCTCATCACACCCGG + Intergenic
1179754944 21:43489623-43489645 ATGATCCAGCTCCTCCCACCAGG + Intergenic
1181582042 22:23833950-23833972 CAGGCCCTGCTCATCACTCCAGG - Intronic
1185186626 22:49404796-49404818 ATGGTGCTGCTCATCACAGCGGG + Intergenic
1185211544 22:49573366-49573388 CTGCCCCTGCTCCTCCCACCGGG - Intronic
951058841 3:18180368-18180390 CTGCTTCTGCTCATCCCACATGG - Intronic
953611229 3:44449207-44449229 CTGATGCTCCTCCTCACTCCTGG - Intronic
954436178 3:50497543-50497565 CTGGTCCCGCTCCTCTCACCTGG - Intronic
954814540 3:53270323-53270345 CAGCTCCTGCTCCTCACACTAGG - Intergenic
963299710 3:143584911-143584933 ATGCTCCTCCTCCTCACACCTGG + Intronic
965410074 3:168319389-168319411 CTGATCCTGCCCTTGACACATGG + Intergenic
967304707 3:188049356-188049378 CTGAACTTGATCTTCACACCTGG - Intergenic
967837680 3:193978318-193978340 CTGATCCATCCCATCACACAAGG + Intergenic
969282414 4:6179580-6179602 GTGACCCTGCTCATTGCACCAGG + Intronic
970898312 4:21129038-21129060 CTGACCCTGCCCTTGACACCTGG - Intronic
977579221 4:98705978-98706000 CAGGTCCTTCTCATGACACCTGG + Intergenic
984891688 4:184499559-184499581 CTCATTCTGCTCATCAAACAAGG + Intergenic
985489173 5:169227-169249 GTGACCCTGCTCATCCCTCCGGG + Intronic
985497565 5:218290-218312 CTGCGCCTGCGCACCACACCGGG - Exonic
985613119 5:901575-901597 CAGATCCAGCTCATGACACTTGG + Intronic
985638785 5:1053381-1053403 CTGGTCCTGCTCAACATGCCAGG - Exonic
986043140 5:4012297-4012319 CTGCTCCTCCTCACCATACCTGG - Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
999061359 5:148639102-148639124 CTGACCCTTCTCATCACCTCTGG + Intronic
999346952 5:150831826-150831848 CTGAACCAGCACATTACACCAGG + Intergenic
1002805120 6:566556-566578 CTGATTCTGGTCTTCACACTGGG - Intronic
1009550931 6:65090171-65090193 CTGGTCCTGCCCTTGACACCTGG - Intronic
1010124636 6:72417916-72417938 CTGAACGTGCTCAGCACACTCGG + Intergenic
1012012552 6:93807444-93807466 GTGATCCTCCTCATCATATCTGG + Intergenic
1012307990 6:97683115-97683137 CTGGTCCTACTCAACACAACTGG - Intergenic
1015044070 6:128758255-128758277 CAGTTCCTGCTCATGGCACCTGG + Intergenic
1016149371 6:140720470-140720492 CTGCTCCAGCTCATCAGAACAGG + Intergenic
1019643985 7:2119406-2119428 CAGCTCCTGCTCATCGCATCTGG - Intronic
1020057892 7:5130837-5130859 CTCCTCCTGCTCTTCACCCCGGG - Intergenic
1022420975 7:30223046-30223068 CAGATCCTGCTCAGGAAACCGGG - Intergenic
1022820454 7:33954805-33954827 CTGATCCATGTGATCACACCGGG - Intronic
1024208735 7:47185914-47185936 CTGATTCTCCTCATGACTCCGGG + Intergenic
1024620851 7:51156587-51156609 CTGATCCTTCTCACCCCACATGG + Intronic
1029657167 7:101934929-101934951 CTCCTCCTGCTCCTCACCCCGGG - Intronic
1029941290 7:104483215-104483237 CTGATCCTGCAAAACAAACCAGG - Intronic
1033284093 7:140026087-140026109 CTGAACCTGCTCATCAGCTCAGG + Intronic
1033565102 7:142570483-142570505 CTGATCCTGTTCATCCCAACTGG + Intergenic
1034387593 7:150753354-150753376 CTGATCCCTCTCAGCACACAGGG - Intergenic
1035053228 7:156016398-156016420 TAGATCCTGCTCGTCACATCAGG - Intergenic
1035447070 7:158950372-158950394 CTGGTCCTGGTGCTCACACCTGG - Intronic
1038313593 8:26464578-26464600 ATGCTCCTGCTCATGACACCTGG - Intronic
1038523421 8:28252880-28252902 CTGATCCTGCTGATAACACTTGG + Intergenic
1039071494 8:33652892-33652914 CTGATCCTGCCCTTGACACATGG - Intergenic
1039086555 8:33786018-33786040 CTGATCCTGCTGTTCACATCTGG + Intergenic
1044889613 8:96819531-96819553 CTCATTCTGCTCATCAAACAAGG - Intronic
1046444985 8:114306684-114306706 CTCATCCTGCCCCTGACACCAGG + Intergenic
1047024902 8:120813676-120813698 CTGATTCTGCACATCACAAAGGG - Intergenic
1047990985 8:130286685-130286707 ATCTTCATGCTCATCACACCAGG + Intronic
1048607802 8:135987926-135987948 CTCCTCCTCCTCATCACAGCTGG + Intergenic
1049570881 8:143369772-143369794 CTGCTCCTGCTCCTCGCCCCGGG + Intronic
1049806669 8:144544102-144544124 CTGGTCCTCCTCTGCACACCTGG + Intronic
1051672987 9:19531006-19531028 ATGATCATGATCATCATACCAGG + Intronic
1052731778 9:32294432-32294454 CTCATCCTTCTCATCAAACAAGG + Intergenic
1059227734 9:112688328-112688350 CTGATCTTGGTCAACAAACCAGG + Intronic
1059448886 9:114357656-114357678 CTGAGCCTGCCCATCACAGCTGG - Intronic
1059643794 9:116243914-116243936 CTGATGCTGCTCATCTCTTCTGG - Intronic
1187050158 X:15687786-15687808 TTGGTTCTGCTCATCACACATGG + Intergenic
1187058434 X:15762860-15762882 TTGGTTCTGCTCATCACACTTGG + Intronic
1190974919 X:55389641-55389663 CTGTCCCTGCTCACCACAGCTGG + Intergenic
1191823571 X:65339628-65339650 GTGATCTTGCTCATCAGACAAGG + Intergenic
1191925341 X:66303124-66303146 ATGATCCTGCTGATCAAAACAGG - Intergenic
1192203683 X:69082621-69082643 CAGGTCCTGCTCCTCAGACCCGG + Intergenic
1192844399 X:74890809-74890831 TTGACCCTGCTCACCAGACCAGG + Intronic
1194338331 X:92677381-92677403 CTGATCCTGCCCTTCACACTTGG + Intergenic
1200646733 Y:5794164-5794186 CTGATCCTGCCCTTCACACTTGG + Intergenic