ID: 1131268384

View in Genome Browser
Species Human (GRCh38)
Location 15:90932181-90932203
Sequence GAGCCAGATGTGGCCCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131268381_1131268384 4 Left 1131268381 15:90932154-90932176 CCAAGGCGGTGTGTTGTGGGTTT 0: 1
1: 0
2: 0
3: 1
4: 98
Right 1131268384 15:90932181-90932203 GAGCCAGATGTGGCCCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 153
1131268380_1131268384 5 Left 1131268380 15:90932153-90932175 CCCAAGGCGGTGTGTTGTGGGTT 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1131268384 15:90932181-90932203 GAGCCAGATGTGGCCCCTTGTGG 0: 1
1: 0
2: 0
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131268384 Original CRISPR GAGCCAGATGTGGCCCCTTG TGG Intronic
900404445 1:2486295-2486317 GAGCCAGTTGTGGGCCCCTGGGG - Intronic
900488020 1:2932714-2932736 CAGGCAGCTGTGTCCCCTTGGGG + Intergenic
901424599 1:9173903-9173925 GAGCGGGATGTCACCCCTTGAGG - Intergenic
901490697 1:9594992-9595014 GAGCTGGAGGTGGCCCCTGGGGG + Intronic
902333889 1:15744036-15744058 GAAGCCGATGTGGCCCCTTCGGG + Intronic
902382094 1:16057582-16057604 GACCCAAGTGTGGCTCCTTGGGG + Intergenic
905143684 1:35869762-35869784 GAGCCAAATGTGGACCTGTGAGG + Intergenic
908599355 1:65722588-65722610 AAGCCATATGGGGCCTCTTGGGG - Intergenic
910521464 1:88126704-88126726 GAGCTAGATTTGGCCCCTGAGGG + Intergenic
915188170 1:154125157-154125179 TAGCCAGGTGTGGCCGGTTGTGG + Intronic
915565327 1:156709769-156709791 GAGGCAGATGTGGCCCAGTAGGG + Intergenic
915841767 1:159218772-159218794 CATCTGGATGTGGCCCCTTGTGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
922499490 1:226085966-226085988 GAGCCCACTGTGGCTCCTTGGGG - Intergenic
924142414 1:241039346-241039368 GAACGAGATATGGCGCCTTGTGG - Intronic
924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG + Intergenic
1065167388 10:22994143-22994165 GATCCAGAAGTGCCTCCTTGAGG + Intronic
1065879367 10:30026254-30026276 GAGCCCGGCCTGGCCCCTTGTGG + Exonic
1066414029 10:35202942-35202964 GTGCCAAATTTGGTCCCTTGAGG + Intronic
1067008686 10:42690520-42690542 CAGCCAGCTGTGGCCACCTGTGG - Intergenic
1070611612 10:77937235-77937257 GAGGCAGAAGTGGGCCCTGGGGG - Intergenic
1072715607 10:97750492-97750514 GAGCCTGCTGTGGCCGCTTGTGG + Intronic
1073425283 10:103452159-103452181 GGGCCAGCTGTGGGCACTTGTGG + Exonic
1073633875 10:105177482-105177504 GAGGAAGGTCTGGCCCCTTGTGG - Intronic
1075754170 10:124797920-124797942 GAGCCAGATGTGGTGGCATGTGG - Intergenic
1077429919 11:2511292-2511314 GAGCCAGAGGTTGCCACTGGAGG + Intronic
1078648073 11:13160691-13160713 GAGCCAGATGTGGCCAATGTGGG + Intergenic
1079127191 11:17725497-17725519 CAGCCAGTTGTCCCCCCTTGAGG - Intergenic
1081530317 11:43954076-43954098 GAGCCACATGTGGCTCCTCATGG - Intergenic
1081662154 11:44894733-44894755 GAGCCAGCTGGAGGCCCTTGGGG - Intronic
1082230493 11:49759791-49759813 CAGCCAGAAGTGTCCCCTGGAGG + Intergenic
1083305934 11:61762039-61762061 GAGTCAGAGATGGCCTCTTGGGG + Intronic
1083996834 11:66277052-66277074 GAGCCAGATGTGCTACCTTGGGG - Exonic
1086619557 11:88869176-88869198 TAGCCAGAAGTGTCCCCTGGAGG - Intronic
1089666342 11:120022611-120022633 GTTCCAAATGTGGCCCCTTATGG + Intergenic
1091624694 12:2113115-2113137 GAGACAGGTGTGGCCTCTTGGGG - Intronic
1092705610 12:11281159-11281181 CAGGCAGATGTGCCTCCTTGTGG + Intergenic
1092714473 12:11374634-11374656 CAGGCAGATGTGACTCCTTGTGG + Intronic
1092718185 12:11413668-11413690 CAGGCAGATGTGACTCCTTGTGG + Intronic
1093064567 12:14643444-14643466 GAGCCAGCTGTTGTCTCTTGTGG + Intronic
1093396458 12:18689361-18689383 GGGCCACATGTGGCCCATGGTGG + Intronic
1096193306 12:49633754-49633776 GAGCCAGCTCTGTCTCCTTGTGG + Intronic
1096521989 12:52189667-52189689 GGGTCAGCTGGGGCCCCTTGGGG + Intronic
1097414223 12:59294783-59294805 GTCCCAGATGTGGCTACTTGTGG + Intergenic
1102071484 12:110023607-110023629 GAGTGAGATGTGGCTACTTGTGG + Intronic
1103030619 12:117609149-117609171 GAGCCAGGTGTGGCCCATTCTGG - Intronic
1103953786 12:124566009-124566031 CAGCCAGATCTGGGTCCTTGCGG - Intronic
1104246145 12:127043360-127043382 ATGCCAGGTGTGGACCCTTGAGG + Intergenic
1104856015 12:131902847-131902869 GAGGCAGTTGTGGCCCTTTCTGG + Intronic
1105016867 12:132791496-132791518 GCTGCAGATGTGGCCCCTTCTGG - Intronic
1105016874 12:132791537-132791559 GCTGCAGATGTGGCCCCTTCTGG - Intronic
1105016912 12:132791786-132791808 GCTGCAGATGTGGCCCCTTCTGG - Intronic
1106458736 13:29949559-29949581 AACCCAGATCTGGCCCCTTTAGG - Intergenic
1111729298 13:92052828-92052850 GAGCCATCTGTGTCCCTTTGGGG - Intronic
1117540773 14:56744545-56744567 GGGCCAGATGTGGCCCAGAGAGG - Intergenic
1119525648 14:75320465-75320487 GAGCCAGCTGTGTCACCGTGGGG + Intergenic
1120002261 14:79315906-79315928 GAGCGAGATATGGCCCTTTGGGG + Intronic
1129869926 15:78933606-78933628 GAGGCAGACGTGGCCACTTCGGG + Intronic
1130134230 15:81168564-81168586 GAGTCAGATGTGGCTCCTCATGG - Intronic
1131268384 15:90932181-90932203 GAGCCAGATGTGGCCCCTTGTGG + Intronic
1132558284 16:582303-582325 GATGCAGGTGAGGCCCCTTGTGG + Intronic
1134530723 16:14980976-14980998 GAGTAAGATGTGGCCCCTGCAGG + Intronic
1137872462 16:51963583-51963605 AAGCCAAATGTGGCTCCATGAGG + Intergenic
1139512979 16:67437802-67437824 GAGCTAGATGTTGGCCCTGGAGG - Intergenic
1139865623 16:70060039-70060061 GAGTAAGATGTGGCCCCTGCAGG - Intergenic
1139957061 16:70698162-70698184 GAGCCAGATGTGCCCAGCTGTGG + Intronic
1141997751 16:87645989-87646011 GGGCCAGACGAGGGCCCTTGGGG + Intronic
1142267283 16:89070530-89070552 GAGCCACATGTGGCCCCTGATGG + Intergenic
1142395543 16:89829180-89829202 GAGACAGAAGCGTCCCCTTGGGG + Intronic
1144244950 17:13353530-13353552 CAGCCAGATGTGGCCTGATGTGG + Intergenic
1144828234 17:18118428-18118450 GAGCCAGCTGTGGCCCAGGGAGG + Intronic
1145122943 17:20277113-20277135 GGGACAGATGTGGCCCATTCAGG + Intronic
1147181838 17:38691371-38691393 GATCCAGAAGTGGGCCCCTGTGG + Intergenic
1148653800 17:49268429-49268451 CAGAAAGATGTGGCCTCTTGAGG + Intergenic
1149540998 17:57467946-57467968 GAGCCAGATGTGTCCTCTCTGGG + Intronic
1151820646 17:76494969-76494991 GAGTCAGAAGTGGCCCCTGGGGG + Intronic
1154027921 18:10725271-10725293 GTGCCAGATATGGTCCATTGTGG + Intronic
1157143248 18:45134050-45134072 GAGCCATATCTGTCACCTTGTGG + Intergenic
1160176851 18:76601819-76601841 GAGCCGTGTGTGGCACCTTGTGG + Intergenic
1160969937 19:1763071-1763093 TAGCCAGATGTGGCCGGGTGCGG + Intronic
1163300536 19:16442905-16442927 GATCCAGGTGTGGCCTCTGGTGG - Intronic
925014798 2:514579-514601 GAACCTGGTGTGGCTCCTTGAGG + Intergenic
925955366 2:8958863-8958885 GAGACAGGTGTGGCCACGTGGGG + Intronic
928405547 2:31011719-31011741 GAGCCAGCTTTGGCCCCCTGAGG - Intronic
934620227 2:95799103-95799125 GAACCAGATCTGGGCCTTTGAGG + Intergenic
934640661 2:96025454-96025476 GAACCAGATCTGGGCCTTTGCGG - Intronic
934647330 2:96066572-96066594 GAGGCAGCTGAGGCCCCGTGAGG - Intergenic
934840702 2:97622392-97622414 GAGGCAGCTGAGGCCCCGTGAGG - Intergenic
936514656 2:113174117-113174139 GAGTCACATGTGGGTCCTTGTGG + Intronic
939883588 2:147657247-147657269 GAGCCAGATGTGGCTGCTCTTGG - Intergenic
942532468 2:176926432-176926454 GAGCCAGTCATGGCCCCTTTTGG - Intergenic
943540586 2:189208968-189208990 GGGCCAGATGAGGCCAGTTGTGG - Intergenic
943904067 2:193475441-193475463 GAGCTAGGTGTTGCCCCTGGGGG + Intergenic
944719228 2:202406275-202406297 GAGTAAGTTGTAGCCCCTTGGGG + Intronic
946176417 2:217924574-217924596 GAGGCACCTGTGGCCACTTGTGG + Intronic
946943155 2:224791376-224791398 AAGCCAGATGTGGCACCCTATGG - Intronic
947311085 2:228803159-228803181 GAGTCAGAGCTGGCCCCTTTAGG - Intergenic
1168909778 20:1438525-1438547 CAGCCAAATGTGGACCCATGAGG - Intergenic
1169493247 20:6089286-6089308 GAGCCAGGTGTGGCCCCAGGTGG - Intronic
1171423447 20:25034228-25034250 GACAGAGATGTGGCCCCATGAGG - Intronic
1173404392 20:42752376-42752398 GAGCCAGCTGAGGCCCCAAGAGG + Intronic
1173941541 20:46915094-46915116 GAGGCTGATGTGGCTCCTTTGGG - Intronic
1174335107 20:49854240-49854262 GTGGCACATGAGGCCCCTTGAGG + Intronic
1175026424 20:55907354-55907376 GAGTCAGAAGGGGCTCCTTGTGG - Intergenic
1175879255 20:62247326-62247348 GTGCTGGATGTGGCCTCTTGTGG + Intronic
1176112363 20:63416416-63416438 CAGGCAGATGTGGCCTCCTGAGG + Intronic
1177120487 21:17132235-17132257 GATCCAGATGGGGAGCCTTGGGG - Intergenic
1177852292 21:26363004-26363026 GAGCCAGCACCGGCCCCTTGAGG - Intergenic
1180918967 22:19508715-19508737 GAACCAGTGGTGGCCCCATGAGG - Intronic
1180932191 22:19599844-19599866 GATCCAGAGGTGGCCCCATGAGG + Intergenic
1182072886 22:27475898-27475920 GAGGCAGATGAAGCCCTTTGAGG - Intergenic
1182073224 22:27477654-27477676 GAGGCAGATGAAGCCCTTTGAGG - Intergenic
1183678442 22:39312822-39312844 GAGGCAGATGGGGGCCCTTGAGG - Intergenic
1184732815 22:46380295-46380317 CGGCCAGGTGTGGCCTCTTGGGG + Intronic
1185285336 22:49997434-49997456 GACCCGGAGGTGGCCCTTTGTGG + Intronic
949976388 3:9464544-9464566 GAGCCAGGTGTGGCCAGCTGGGG - Exonic
950104848 3:10381665-10381687 CAGCCAGCTTTGGCCCCATGTGG + Intronic
950436214 3:12981900-12981922 CAGGCAGCAGTGGCCCCTTGTGG - Intronic
956072753 3:65471821-65471843 AAGCCAGAGGTGGTCGCTTGAGG + Intronic
956630330 3:71310887-71310909 GAGCCAGATGTGGCCATGAGAGG - Intronic
957632589 3:82736939-82736961 GAGCCAGAGGAGGCCCCATGGGG + Intergenic
958019978 3:87982908-87982930 GAAACAGATGAGGCTCCTTGAGG - Intergenic
960175691 3:114515162-114515184 GAGCCATATGTGTCCCCGTAAGG - Intronic
967997931 3:195180591-195180613 GAGCGTGATGTGGCCCCGTCTGG + Intronic
968229455 3:196996708-196996730 GAGCCCGAGATGGGCCCTTGGGG - Intronic
969878922 4:10157075-10157097 GAGCTACATGTGGCCCCAGGAGG + Intergenic
971264458 4:25085681-25085703 GAGGCAGATGCAGCACCTTGGGG + Intergenic
971377892 4:26069751-26069773 AAGCCAGACGTGGGCCCTGGGGG - Intergenic
972736073 4:41842708-41842730 AAGCCAAATGAGGCCTCTTGGGG + Intergenic
973339024 4:48985883-48985905 GACCCAGATGGGGACCCTGGAGG - Intergenic
981434799 4:144707887-144707909 GAGCCAGATGTGGTGGCATGCGG - Intronic
983999417 4:174222670-174222692 GAGCCAGCTGTGTTCCCTAGTGG + Intergenic
988835447 5:35027983-35028005 GATGAAGATGTGGCCTCTTGGGG + Intronic
996312842 5:122126280-122126302 AATCCAGATCTGACCCCTTGTGG - Intergenic
998397632 5:141829138-141829160 TAGCCAGAGGTGGCCACGTGTGG + Intergenic
999147746 5:149407042-149407064 GGTCCAGGTGTGGCTCCTTGGGG - Intergenic
1005026491 6:21467266-21467288 GGGCCAGGTGTGTCACCTTGAGG - Intergenic
1006022215 6:31123964-31123986 CAGCCAGACGTGGGGCCTTGTGG + Intronic
1007260975 6:40562879-40562901 GTCCCAAATCTGGCCCCTTGGGG - Intronic
1010634303 6:78238757-78238779 GGGCCAGAAGTTGCCCCTTGGGG - Intergenic
1011094058 6:83638113-83638135 GAGCAAGATGGAGCGCCTTGGGG + Intronic
1011124600 6:83993534-83993556 CAGCCAGATGTGACCCAGTGTGG - Intergenic
1013118602 6:107122027-107122049 GGGACACATGTGGCCTCTTGAGG - Intergenic
1014773831 6:125486398-125486420 AAGCCAGATGAGCCCCCTTAGGG - Intergenic
1015654441 6:135500744-135500766 GACCCAGATGTGGCCAGTGGTGG - Intergenic
1016939059 6:149469747-149469769 GAGGCACATGTGGCACCCTGAGG + Intronic
1017250043 6:152270699-152270721 AAGCCAGATGAGGGCCCTGGTGG + Intronic
1018583382 6:165328515-165328537 GGGCCAGGTGTGGCCCTGTGAGG - Intronic
1018902327 6:168057869-168057891 GAGGCAGATGAGGCCCCTGGTGG + Intronic
1019708329 7:2507033-2507055 CAGCCAGACCTGGTCCCTTGGGG - Intergenic
1022114214 7:27248443-27248465 GAGCCAAATGTGGCTGGTTGTGG + Intergenic
1027231400 7:76274726-76274748 GAGTCAGAGGTGGACCCTAGGGG + Intronic
1028378841 7:90176133-90176155 GAGACAGCTGTGGCCCTTTGGGG - Intronic
1029195931 7:98805463-98805485 GAACCAATTTTGGCCCCTTGGGG + Intergenic
1029380717 7:100212689-100212711 GAGCCAGGTGGAGCCACTTGAGG - Intronic
1030189143 7:106793408-106793430 GAGCCAGATGGGGCCTTCTGAGG - Intergenic
1032590217 7:133185258-133185280 GATCCAGATGTGGTCGCATGGGG - Intergenic
1036252174 8:7171810-7171832 CAGCCAATTGTTGCCCCTTGGGG + Intergenic
1036365319 8:8115650-8115672 CAGCCAATTGTTGCCCCTTGGGG - Intergenic
1036644910 8:10607025-10607047 GAGCAAGAAGAGGCCCCTTTGGG - Exonic
1040120261 8:43676433-43676455 GAGCCAATTGTGGCCTATTGTGG + Intergenic
1040328588 8:46374659-46374681 GTGCCAGATGTGGGCCTGTGTGG - Intergenic
1049839822 8:144763769-144763791 GAGCCAGAGGTGACCCTGTGTGG + Intergenic
1053280997 9:36819758-36819780 GAGCAAGATCTGGCCCTTTCTGG + Intergenic
1060414729 9:123422114-123422136 GAGCCAGATGTGAACCCTCAAGG - Intronic
1062253238 9:135608692-135608714 CAGCCTGGTGTGGCCCCTTTTGG - Intergenic
1062400047 9:136368391-136368413 GATCCAGCTGTGCCCCCATGGGG - Intronic
1187274371 X:17805350-17805372 GGGACAGACGAGGCCCCTTGTGG - Intronic
1193063595 X:77233436-77233458 GAGCAAGAAGTGGGCTCTTGGGG + Intergenic
1200631283 Y:5590724-5590746 GAGCACGAAGTGGACCCTTGAGG - Intronic