ID: 1131268961

View in Genome Browser
Species Human (GRCh38)
Location 15:90935170-90935192
Sequence GAGGGAGCGCGCCCGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 455}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131268961_1131268982 27 Left 1131268961 15:90935170-90935192 CCCCTGCCCGGGCGCGCTCCCTC 0: 1
1: 0
2: 4
3: 39
4: 455
Right 1131268982 15:90935220-90935242 CTCCGACGCAAGAGTGGGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 66
1131268961_1131268979 23 Left 1131268961 15:90935170-90935192 CCCCTGCCCGGGCGCGCTCCCTC 0: 1
1: 0
2: 4
3: 39
4: 455
Right 1131268979 15:90935216-90935238 CCACCTCCGACGCAAGAGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 51
1131268961_1131268977 22 Left 1131268961 15:90935170-90935192 CCCCTGCCCGGGCGCGCTCCCTC 0: 1
1: 0
2: 4
3: 39
4: 455
Right 1131268977 15:90935215-90935237 CCCACCTCCGACGCAAGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 94
1131268961_1131268983 28 Left 1131268961 15:90935170-90935192 CCCCTGCCCGGGCGCGCTCCCTC 0: 1
1: 0
2: 4
3: 39
4: 455
Right 1131268983 15:90935221-90935243 TCCGACGCAAGAGTGGGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 45
1131268961_1131268981 26 Left 1131268961 15:90935170-90935192 CCCCTGCCCGGGCGCGCTCCCTC 0: 1
1: 0
2: 4
3: 39
4: 455
Right 1131268981 15:90935219-90935241 CCTCCGACGCAAGAGTGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 53
1131268961_1131268975 21 Left 1131268961 15:90935170-90935192 CCCCTGCCCGGGCGCGCTCCCTC 0: 1
1: 0
2: 4
3: 39
4: 455
Right 1131268975 15:90935214-90935236 CCCCACCTCCGACGCAAGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131268961 Original CRISPR GAGGGAGCGCGCCCGGGCAG GGG (reversed) Intronic