ID: 1131272828

View in Genome Browser
Species Human (GRCh38)
Location 15:90957281-90957303
Sequence GGCCTCGGGCACCACATTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131272828_1131272841 15 Left 1131272828 15:90957281-90957303 CCCAGAATGTGGTGCCCGAGGCC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1131272841 15:90957319-90957341 CCGGCCGGTGAGGCCCAGGCTGG 0: 1
1: 0
2: 7
3: 33
4: 325
1131272828_1131272835 -4 Left 1131272828 15:90957281-90957303 CCCAGAATGTGGTGCCCGAGGCC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1131272835 15:90957300-90957322 GGCCGAAGGGGAAGACGATCCGG 0: 1
1: 0
2: 0
3: 4
4: 116
1131272828_1131272837 0 Left 1131272828 15:90957281-90957303 CCCAGAATGTGGTGCCCGAGGCC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1131272837 15:90957304-90957326 GAAGGGGAAGACGATCCGGCCGG 0: 1
1: 0
2: 0
3: 0
4: 87
1131272828_1131272844 19 Left 1131272828 15:90957281-90957303 CCCAGAATGTGGTGCCCGAGGCC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1131272844 15:90957323-90957345 CCGGTGAGGCCCAGGCTGGGAGG 0: 1
1: 0
2: 8
3: 53
4: 492
1131272828_1131272838 5 Left 1131272828 15:90957281-90957303 CCCAGAATGTGGTGCCCGAGGCC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1131272838 15:90957309-90957331 GGAAGACGATCCGGCCGGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1131272828_1131272842 16 Left 1131272828 15:90957281-90957303 CCCAGAATGTGGTGCCCGAGGCC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1131272842 15:90957320-90957342 CGGCCGGTGAGGCCCAGGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 252
1131272828_1131272839 11 Left 1131272828 15:90957281-90957303 CCCAGAATGTGGTGCCCGAGGCC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1131272839 15:90957315-90957337 CGATCCGGCCGGTGAGGCCCAGG 0: 1
1: 0
2: 1
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131272828 Original CRISPR GGCCTCGGGCACCACATTCT GGG (reversed) Exonic
900237521 1:1599881-1599903 GCCCTCGGGCAGCACCTTGTAGG + Exonic
900633283 1:3649890-3649912 GGCCACGGGCAGGACATCCTCGG - Intronic
906495860 1:46303305-46303327 GGCCTCGGGCGCCGCCATCTTGG + Exonic
906691941 1:47798531-47798553 GGCCAGGGGCACCTCATCCTTGG - Intronic
911234735 1:95399993-95400015 GGACTCTGACACCACACTCTAGG - Intergenic
918041747 1:180917876-180917898 GGCCTCGGGCACCTCCTTGCAGG + Exonic
919464570 1:197913353-197913375 GGCCTCGGGTACCCCTTTCCAGG + Intronic
919731616 1:200916565-200916587 GGTCTGGGGCACTCCATTCTTGG + Intergenic
923490270 1:234478372-234478394 GGGCTCGGGCAACAGCTTCTCGG + Exonic
1064380501 10:14837930-14837952 GGGCTCGCGCACCACATGCTGGG + Exonic
1067792662 10:49299643-49299665 GGCCTCGGGGACCACGTACCCGG + Intronic
1073305665 10:102501968-102501990 GGTTTCTGGCACCAGATTCTCGG + Intronic
1078923255 11:15851032-15851054 GGTCTTGGGCCCCACATTGTGGG - Intergenic
1080297780 11:30750369-30750391 AGCATCGGGCACCAGAGTCTGGG + Intergenic
1081573341 11:44304564-44304586 GGCCTCAGGCACCCCAGTCCAGG + Intronic
1085280711 11:75328601-75328623 GGCATCTGTTACCACATTCTGGG + Intronic
1087077276 11:94136929-94136951 GGCCTCGGGAAACACAGTCATGG + Intronic
1088006703 11:104949708-104949730 GTCCTCTGACAGCACATTCTTGG - Exonic
1088895052 11:114072214-114072236 TGCCTCGGGCACCTCATGTTTGG + Intronic
1104976846 12:132555960-132555982 GGCCTCGGGCACAGCATCCCTGG + Intronic
1107812084 13:44210236-44210258 GGCCTCAGGTAACACCTTCTTGG - Intergenic
1109278557 13:60329716-60329738 AGCACCAGGCACCACATTCTCGG + Intergenic
1114484903 14:23056723-23056745 GGCCTCGGGAACTTAATTCTGGG + Intronic
1114693320 14:24605641-24605663 GGTCTCAGGCATCACCTTCTGGG - Intergenic
1115517103 14:34196460-34196482 GACCAAGGGCACCTCATTCTGGG - Intronic
1122744590 14:103890297-103890319 GGCCTCTGACAGCCCATTCTAGG + Intergenic
1122774199 14:104110077-104110099 GGCCTCGGGCAGCCCAGGCTGGG - Intronic
1122992953 14:105247361-105247383 GGGCTCGGGCACCCCATTCCTGG + Intronic
1124237277 15:28001765-28001787 GTCCTCCAGCACCACATTCTGGG - Intronic
1124661050 15:31551249-31551271 TATCTCGGGCACCACATTCTAGG - Intronic
1125505317 15:40264701-40264723 GGCCTGGGGCACCAGGTTCAGGG - Intronic
1125533440 15:40428766-40428788 GGCAACAGGCTCCACATTCTGGG - Intronic
1128682131 15:69659926-69659948 GGCCCCAGGCATCACATTCCTGG - Intergenic
1130654513 15:85782688-85782710 CGCATGGGGCACCACATTGTAGG - Intronic
1131272742 15:90956997-90957019 GGCCGCCAGCCCCACATTCTGGG + Intronic
1131272828 15:90957281-90957303 GGCCTCGGGCACCACATTCTGGG - Exonic
1133550872 16:6853477-6853499 GTCCTCGAGCACCACACTGTAGG - Intronic
1134539450 16:15053236-15053258 GGCCCCAGGCCCCACATCCTGGG - Intronic
1135661029 16:24296785-24296807 GGCCCAGGGCATCACCTTCTTGG - Intronic
1137774738 16:51045448-51045470 GGCCTCGGGCTCCTCAGGCTAGG - Intergenic
1140363982 16:74367750-74367772 GACCTCGGGCTCCCCAGTCTTGG - Intergenic
1146973984 17:37095537-37095559 GGCTTCAGGCAACACTTTCTAGG + Intronic
1147648730 17:42050226-42050248 AGGCTCGGGACCCACATTCTGGG - Intronic
1151888090 17:76935047-76935069 AGCCTCAGGCTCCACTTTCTGGG - Intronic
1152848875 17:82619617-82619639 GGTCTTGGGCACCTCTTTCTTGG - Intronic
1156399567 18:36728258-36728280 GGCCTCCAGCACCACAGTATTGG + Intronic
1157498620 18:48173612-48173634 GCCCTAGGGCACCACATTTAAGG + Intronic
1161082026 19:2316105-2316127 GGCCTCGGGCCCGTCATTCCTGG + Intronic
1165056123 19:33177289-33177311 GGCTTCGGACTCCACCTTCTCGG + Intergenic
1166043216 19:40215322-40215344 GGCCTGGGGCGCTACATTCATGG - Exonic
1166546515 19:43637314-43637336 GGCCTTGGCTACCACATTTTAGG - Intronic
926771063 2:16375621-16375643 GGCCTCAGGCTCTACCTTCTAGG + Intergenic
927177149 2:20418548-20418570 AGCCTGGGACTCCACATTCTGGG - Intergenic
929446045 2:42002217-42002239 GGCCTCTGGCTGCTCATTCTGGG - Intergenic
929501581 2:42494617-42494639 GGCCCCGGCCCCCACGTTCTGGG + Exonic
938255367 2:129855228-129855250 GGATTAGGGCACCACATTTTTGG + Intergenic
1168846097 20:945599-945621 GGCCTTGGGAGCCACAATCTGGG + Intergenic
1170160656 20:13306925-13306947 GGCCTTGGGCTCCACTCTCTAGG - Intergenic
1175717247 20:61263384-61263406 GGCCTCGGGGAGCACATACTGGG - Intronic
1175939392 20:62531128-62531150 TGCCTCGGGGACGGCATTCTGGG + Intergenic
1176013091 20:62910998-62911020 GGCCTCGGAGCCCACAGTCTCGG + Exonic
1180106552 21:45622650-45622672 GCCCTGGGGAACCACATCCTGGG + Intergenic
1182904387 22:33922334-33922356 CGCCTCGGTAACCACACTCTCGG + Intronic
1183367568 22:37415284-37415306 GGCCTAGGGCACCGCATGCCAGG - Intronic
1183829513 22:40410387-40410409 GGCCACTGGCTTCACATTCTGGG - Exonic
950542238 3:13619509-13619531 GGCGTCGGGGACGACGTTCTGGG - Intronic
954138187 3:48591932-48591954 GGCCTCAGGCACCAAGTTCCAGG + Exonic
956638947 3:71396279-71396301 ATCATCGGGCACCACATTCCTGG - Intronic
968513176 4:1004136-1004158 GGACTCGGCCACCCCATTCTTGG + Intronic
968947697 4:3674300-3674322 GGCCGCCGACTCCACATTCTAGG - Intergenic
970296062 4:14631866-14631888 GGACTAGCACACCACATTCTAGG + Intergenic
991562830 5:67972597-67972619 GGCCTCAGGAAACACAATCTTGG + Intergenic
993148923 5:84135114-84135136 GCCCTAGAGCTCCACATTCTAGG + Intronic
995474527 5:112534347-112534369 GGGCTCTGACACCCCATTCTGGG + Intergenic
997232070 5:132252731-132252753 GGCCACGGCCAAGACATTCTAGG + Intronic
999295551 5:150457608-150457630 GGCCCCGTGCTCCCCATTCTCGG + Intergenic
999504528 5:152181126-152181148 GGCCTCAGGAAACACATTCATGG + Intergenic
1005442925 6:25890633-25890655 GGCCTTTGGCTCCACCTTCTGGG + Intergenic
1005642297 6:27807841-27807863 GGCCTTGGTCACCGCCTTCTTGG + Exonic
1014285824 6:119496148-119496170 GGCCTTGAGAACCACATTCATGG + Intergenic
1015034446 6:128636348-128636370 GGCCTCTGGTCCCACCTTCTCGG + Intergenic
1015705878 6:136086938-136086960 GGCATCGTGCGCCAGATTCTGGG + Intronic
1023861451 7:44219771-44219793 GGCCCCGGGCAGCACAGTCCTGG - Intronic
1032201965 7:129828597-129828619 GGCATCCGGCACCCCCTTCTAGG + Intergenic
1033174247 7:139110017-139110039 GGCCTGGGGTACCACGATCTGGG - Intergenic
1036057277 8:5270234-5270256 GGCCTCAGGAAACACATTCATGG - Intergenic
1051237411 9:15016268-15016290 GGACTCGAGCATCAGATTCTGGG - Intergenic
1051591253 9:18778018-18778040 GGCCTCGGGGACCCCATCATGGG + Intronic
1053025215 9:34723745-34723767 AGCCTGGGGCAACACAGTCTGGG + Exonic
1058961825 9:109998982-109999004 GGCCTCAGTCAGCACAGTCTGGG - Intronic
1060532633 9:124356883-124356905 GGCTTCGCTCACCAGATTCTTGG + Exonic
1061403613 9:130381958-130381980 GGCCCTGGGCTGCACATTCTCGG - Intronic
1062192897 9:135256841-135256863 GACCTCGGACATCCCATTCTCGG + Intergenic
1185763655 X:2707471-2707493 GGCCTCGGGGACTTCACTCTGGG + Intronic
1195013128 X:100752654-100752676 GGACTCTGTCACCCCATTCTAGG - Intergenic
1196068468 X:111492140-111492162 GGCCTCAGGAAGCACACTCTAGG - Intergenic
1199407452 X:147479175-147479197 GGCCCCTGGCTACACATTCTGGG - Intergenic