ID: 1131275706

View in Genome Browser
Species Human (GRCh38)
Location 15:90978824-90978846
Sequence TGAGGTCCACCCTTAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131275697_1131275706 19 Left 1131275697 15:90978782-90978804 CCATCAGGGTGGGAGCTCTAGCA 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1131275706 15:90978824-90978846 TGAGGTCCACCCTTAGTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1131275699_1131275706 -5 Left 1131275699 15:90978806-90978828 CCATCCTGGCCCTGAAGATGAGG 0: 1
1: 0
2: 1
3: 40
4: 286
Right 1131275706 15:90978824-90978846 TGAGGTCCACCCTTAGTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1131275701_1131275706 -9 Left 1131275701 15:90978810-90978832 CCTGGCCCTGAAGATGAGGTCCA 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1131275706 15:90978824-90978846 TGAGGTCCACCCTTAGTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131275706 Original CRISPR TGAGGTCCACCCTTAGTGGT GGG Intronic
911313016 1:96319595-96319617 AGAGATCCACCCTTATGGGTAGG + Intergenic
913434083 1:118828993-118829015 TGAGCTCCACTCTCACTGGTTGG - Intergenic
914355617 1:146881893-146881915 TGTGGTCCTCCCTCTGTGGTTGG - Intergenic
1067243930 10:44520065-44520087 TAAGGTCTACCTTTTGTGGTTGG + Intergenic
1067539938 10:47143963-47143985 TGAGCTCCACCCTGAGCGGGTGG - Intergenic
1074169337 10:110918421-110918443 TGAGGTCCTGCCCTGGTGGTAGG + Intronic
1076652891 10:132002191-132002213 TAAGGTGCAGCCTTGGTGGTAGG - Intergenic
1077399119 11:2344592-2344614 TGAAATACACCTTTAGTGGTGGG - Intergenic
1079050112 11:17147501-17147523 TGAGGTACACACTTACTGTTCGG + Exonic
1084958144 11:72702335-72702357 TGAGCTCCACCCTCAGTCCTGGG + Intronic
1086322485 11:85664904-85664926 TGAGGCCCACTCTTAGCGGCCGG - Exonic
1094685027 12:32703254-32703276 TGATGTCTCCTCTTAGTGGTTGG + Intronic
1098497694 12:71155550-71155572 TAAGGTCCACACTGTGTGGTTGG - Intronic
1102589859 12:113948976-113948998 TTTGGTGCACCCTTGGTGGTGGG + Exonic
1103706580 12:122877739-122877761 AGAGCTAGACCCTTAGTGGTGGG + Intronic
1104276519 12:127333587-127333609 TGAGGTCCACACTTGCTGGGAGG - Intergenic
1113642388 13:111967145-111967167 TCTGGTCGACCCTGAGTGGTGGG + Intergenic
1113644710 13:111985716-111985738 TGATGTTCACTCTCAGTGGTCGG + Intergenic
1120714326 14:87823827-87823849 TGAGGGCCACCCTCAGTGGATGG + Intergenic
1122673382 14:103389619-103389641 TAATGTCCACCCTTAGTGAATGG + Intronic
1131275706 15:90978824-90978846 TGAGGTCCACCCTTAGTGGTGGG + Intronic
1139978402 16:70833550-70833572 TGTGGTCCTCCCTCTGTGGTTGG + Intronic
1144998334 17:19286115-19286137 TCAGGCCCACCCATGGTGGTGGG + Intronic
1146964507 17:37013608-37013630 TGAAGTCCTCCCTTGGTTGTGGG - Intronic
1151575725 17:74951806-74951828 TGAAGTCCACCATAGGTGGTGGG + Intronic
1155715509 18:28937979-28938001 TGAGTTCCACCCTTAGCTTTAGG + Intergenic
1159046431 18:63373196-63373218 TGAGGTCCACCCACAGTAGGAGG - Intergenic
1161253531 19:3293912-3293934 TGGGGTCCAACCTTAGGGTTTGG - Intronic
1165217651 19:34287941-34287963 ACAGGTGCACCCTTAGTTGTGGG + Intronic
1165239609 19:34455364-34455386 AGAGTTCCTACCTTAGTGGTGGG + Intronic
927575614 2:24199891-24199913 TCAGTTCTACCCTTAATGGTTGG + Intronic
935187688 2:100748592-100748614 TGAGGTCCAGCCTGAGGGGCTGG - Intergenic
1171329716 20:24326703-24326725 TGAGGCCCACCCTCACTGGGAGG + Intergenic
1181595000 22:23908391-23908413 TGAGGACCACCCTGTGAGGTAGG + Intergenic
953013816 3:39053158-39053180 TGGGGGCCACCCTAAGTGCTAGG - Intronic
954224947 3:49175325-49175347 TGAGGAACACCCTGAGTGCTGGG - Intronic
954998228 3:54901570-54901592 TTTGGTCCACCCTGAGTGGGTGG + Intronic
959568424 3:107856541-107856563 TGAGGTCAGCCCTTAGTGTCCGG + Intergenic
962874601 3:139526277-139526299 TTAGGGCCACCCTAAGTGCTAGG - Intronic
970558418 4:17259003-17259025 TGAGGCCCTCCCTGTGTGGTGGG + Intergenic
976929776 4:90551577-90551599 TGAGGTCCACCCATTGTATTTGG - Intronic
977080388 4:92519897-92519919 TAAGGTCCACCCATATTGGGGGG + Intronic
977706015 4:100070953-100070975 AGAGCTCCACCCTCATTGGTGGG + Intergenic
978118674 4:105051604-105051626 TGAGGTCCAATGTTAGTGTTAGG - Intergenic
986746934 5:10753290-10753312 TGGGTTCCACCCTTAATCGTAGG + Intronic
988867056 5:35346977-35346999 TGAGGTACACTCTAAGTTGTGGG - Intergenic
991050805 5:62271208-62271230 TTAGGTCCACCCTTCGTGTAAGG - Intergenic
994595852 5:101833810-101833832 TGAGGTGCAACCTTAGGGGAAGG + Intergenic
995741840 5:115364000-115364022 TGTGTTCCACCCTTCGTGGGAGG + Intergenic
995832165 5:116365127-116365149 TGAGGTCTTCCCTCAGTGGGTGG + Intronic
995851570 5:116551711-116551733 TCAGGTCAAAACTTAGTGGTGGG - Intronic
1000934794 5:167294594-167294616 GGAGGTCAACTCTGAGTGGTGGG - Intronic
1001315430 5:170638196-170638218 GGAGATCCACCCTTAGTAGGAGG + Intronic
1012843230 6:104356391-104356413 TGCGTTCCACCCTTTGTGGGAGG - Intergenic
1015009630 6:128329704-128329726 TGAGGCCCACCCACAGTGGGAGG + Intronic
1016329571 6:142943602-142943624 TGAGGTCCAGCTTTAGGGTTGGG + Intronic
1028913862 7:96237459-96237481 TAAGGTCCACCCTAGGTGGCTGG - Intronic
1034133787 7:148746098-148746120 TGAGGTCCTCTCTGAGGGGTGGG + Intronic
1034418361 7:150976794-150976816 TGAGGGCCTCCCTGAGAGGTGGG - Intronic
1034495885 7:151421869-151421891 TGAGGTCCATCCCAAGGGGTGGG + Intergenic
1038388626 8:27173967-27173989 TGATGTCCACCCACATTGGTGGG - Intergenic
1041898974 8:62959750-62959772 GGGGCTCCACCCTTAGTAGTGGG - Intronic
1043368707 8:79565678-79565700 TGAGGTGAACCCCTTGTGGTTGG + Intergenic
1050724431 9:8631368-8631390 TGATTTCCACCCTTGATGGTTGG + Intronic
1056655931 9:88509031-88509053 CAAGGTCCACCCTTTGTGTTTGG - Intergenic
1058672224 9:107369241-107369263 GGAGATCCACTCTTGGTGGTTGG + Intergenic
1061960899 9:133988575-133988597 TCATCTCCACCCTTGGTGGTTGG - Intronic
1185475576 X:413552-413574 CGAGGGCCACGCTTAGTGGCAGG + Intergenic
1189342310 X:40213375-40213397 TGAGGTCCACCCACATTGGGGGG - Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1199866365 X:151853425-151853447 TGGGGTCCACAGTTAGTGGATGG - Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic