ID: 1131277473

View in Genome Browser
Species Human (GRCh38)
Location 15:90994270-90994292
Sequence CAGTCGGCGCCGAGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131277473_1131277483 10 Left 1131277473 15:90994270-90994292 CCGGCCTCCCTCGGCGCCGACTG 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1131277483 15:90994303-90994325 CTAGGCCCGGGACCCCGCACGGG 0: 1
1: 0
2: 0
3: 15
4: 93
1131277473_1131277477 -8 Left 1131277473 15:90994270-90994292 CCGGCCTCCCTCGGCGCCGACTG 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1131277477 15:90994285-90994307 GCCGACTGCCGTGACGATCTAGG 0: 1
1: 0
2: 0
3: 0
4: 20
1131277473_1131277482 9 Left 1131277473 15:90994270-90994292 CCGGCCTCCCTCGGCGCCGACTG 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1131277482 15:90994302-90994324 TCTAGGCCCGGGACCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 71
1131277473_1131277480 -2 Left 1131277473 15:90994270-90994292 CCGGCCTCCCTCGGCGCCGACTG 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1131277480 15:90994291-90994313 TGCCGTGACGATCTAGGCCCGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1131277473_1131277479 -3 Left 1131277473 15:90994270-90994292 CCGGCCTCCCTCGGCGCCGACTG 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1131277479 15:90994290-90994312 CTGCCGTGACGATCTAGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
1131277473_1131277489 29 Left 1131277473 15:90994270-90994292 CCGGCCTCCCTCGGCGCCGACTG 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1131277489 15:90994322-90994344 CGGGTCCCGCACCCCTGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131277473 Original CRISPR CAGTCGGCGCCGAGGGAGGC CGG (reversed) Intronic
900123756 1:1060427-1060449 CAGGGAGCGCCGAGGGGGGCCGG + Intergenic
900345950 1:2210394-2210416 CTGTGGGCGCCGTGGGGGGCTGG - Intronic
901221857 1:7587935-7587957 CCATCTGGGCCGAGGGAGGCGGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
904528725 1:31154817-31154839 AGGCCGGCGCCGGGGGAGGCGGG - Intergenic
904613335 1:31736917-31736939 CACTCGGCATCCAGGGAGGCGGG + Intronic
905862625 1:41361440-41361462 CAGCCGGCGCTGAGCGCGGCAGG + Intergenic
906741200 1:48187155-48187177 CAGTCAGGGCCAAGGGAGACAGG + Intergenic
907409271 1:54273411-54273433 CAGCCGCCGCCGAGGCAGCCTGG + Intronic
910237189 1:85048246-85048268 CAGTCGGCGCCATGGAGGGCAGG - Intronic
911078950 1:93909314-93909336 CGCTCGGGCCCGAGGGAGGCCGG + Exonic
915064985 1:153217521-153217543 CAGTCAGTCCCGCGGGAGGCTGG + Intergenic
1067792693 10:49299798-49299820 CATTCAGGGCTGAGGGAGGCTGG + Intronic
1070539196 10:77403928-77403950 CAGTGGCCGCCGAGGTCGGCTGG - Exonic
1072641008 10:97211351-97211373 CAGTGGGCGCCGAGGCGGGCAGG - Intronic
1072789642 10:98308925-98308947 CCGGCGGCGCAGGGGGAGGCAGG + Intergenic
1073058259 10:100715701-100715723 CAGACGGCGCCGGCGGCGGCTGG - Intergenic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1075040587 10:119104278-119104300 CGGTCGGCGCCGGGGGCCGCGGG - Intronic
1075402512 10:122171328-122171350 CAGTGGGGGCCGAGGTAGGGGGG + Intronic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076649084 10:131975214-131975236 CAGCCAGCGCAGAGTGAGGCGGG - Intronic
1077137175 11:1006270-1006292 CAGGAGGGGCCGAGGGAGGAGGG + Intronic
1077309472 11:1882014-1882036 CAGCCAGCCCCGAGGGAGGAAGG - Intronic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1078760649 11:14248720-14248742 CACTGGGCGGCGAGGGAGGCTGG - Intronic
1079135641 11:17774782-17774804 CAGTTGGTGACGGGGGAGGCAGG - Intronic
1085289857 11:75390156-75390178 CACCCGGCGGCGAGGGACGCTGG - Intergenic
1089180994 11:116582778-116582800 CAGGCGGATCCCAGGGAGGCAGG + Intergenic
1093932820 12:24971288-24971310 CAGTCAGCCTCTAGGGAGGCAGG - Intergenic
1096217302 12:49805005-49805027 CAGTGGGTGCCTAGTGAGGCTGG - Intronic
1100301900 12:93315308-93315330 CATTGGGTGCTGAGGGAGGCGGG - Intergenic
1103325528 12:120117300-120117322 GAGTGGACGCCGAGGGCGGCGGG + Intronic
1103915222 12:124372499-124372521 CCGTCGGCGCCCAGGGTGGCTGG + Exonic
1105583770 13:21724941-21724963 CAATTGGCGTTGAGGGAGGCAGG - Intergenic
1112402169 13:99086646-99086668 GAGTGGTCGCCGAGGGAGGCTGG - Intergenic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1115555177 14:34539763-34539785 CCGACAGCACCGAGGGAGGCAGG + Intergenic
1118693763 14:68364213-68364235 GAGTGGGCGCAGAGGGAGGGAGG - Intronic
1123787934 15:23690923-23690945 CAGTGGCCCCCTAGGGAGGCTGG - Intergenic
1124629229 15:31327525-31327547 CCTTCGGCGCCGGGGGAGGTGGG - Exonic
1127260534 15:57323615-57323637 CAATGGGCTCCCAGGGAGGCGGG + Intergenic
1128317684 15:66671348-66671370 CAGGCGGTGCGGTGGGAGGCGGG - Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1131195097 15:90349234-90349256 CGGTCAGCGGCGAAGGAGGCAGG - Intergenic
1131277473 15:90994270-90994292 CAGTCGGCGCCGAGGGAGGCCGG - Intronic
1132393749 15:101457448-101457470 CAGCCTGCGCCCTGGGAGGCTGG - Intronic
1132900424 16:2251288-2251310 CGGGCGGCGCCGAGGGAGGGCGG - Intronic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134444632 16:14321549-14321571 CAGAAGGCCCTGAGGGAGGCAGG + Intergenic
1139281983 16:65779057-65779079 CAGCCGGCCCTGAGGAAGGCAGG - Intergenic
1141959103 16:87392596-87392618 CCGGCGGGGCCGAGGGATGCGGG + Intronic
1143478405 17:7215861-7215883 AAGTGGGGGCCGGGGGAGGCGGG - Intronic
1144727135 17:17507565-17507587 CTGTGGGCGCCGAGGGGGACAGG + Intronic
1150060499 17:62065103-62065125 CGGCGGGCGCCGAGGGAGGGGGG - Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152252186 17:79218013-79218035 AAGTCGGGGTAGAGGGAGGCAGG + Intronic
1153006225 18:500643-500665 CCGGCGGCGGCGAGGGAGGACGG - Exonic
1154194769 18:12257555-12257577 TATTCTGCCCCGAGGGAGGCAGG - Intronic
1154303949 18:13217635-13217657 CAGACGGCGGCGACGGCGGCGGG + Intronic
1155053118 18:22165194-22165216 CAGGCCGCGGGGAGGGAGGCCGG + Intergenic
1157095166 18:44680436-44680458 CCCGCGGCGCGGAGGGAGGCTGG - Intronic
1157493541 18:48139711-48139733 CAGCTGGCACCGAGGGAGGCTGG - Intronic
1160247591 18:77171280-77171302 CAGTCGGCACCAAGGCAGGCAGG + Intergenic
1160845308 19:1163695-1163717 CAGGCGGCGCCGGGGAAGCCTGG + Intronic
1163248357 19:16111277-16111299 CAGTGGGGGCCTAGGGAGGAAGG - Intergenic
1166121634 19:40690500-40690522 CAGCCAGGGCCGCGGGAGGCGGG - Exonic
1167756202 19:51415218-51415240 CAGTGGGTGCCGAGCGTGGCAGG + Exonic
929151223 2:38750907-38750929 CAGCCGCCGCCGAGGGCGGGGGG + Intronic
937305359 2:120867445-120867467 AAGTGGCCGCCGAGGGAGGCGGG - Intronic
938319801 2:130355536-130355558 CAGCCGGGCCCAAGGGAGGCCGG - Intergenic
938919827 2:135985335-135985357 CGGGCTGCGCCGAGGGAGGGAGG - Intronic
941646931 2:168050611-168050633 CAGAAGGAGCCGAGGGATGCAGG + Intronic
942447121 2:176085512-176085534 CAGGCGGAGGCGAGGGAGGACGG + Intergenic
944495941 2:200307084-200307106 CGCTCGGCGCCGAGGCGGGCTGG + Intronic
947549772 2:231037812-231037834 CAGAGGGCGGCGAGGGCGGCTGG + Exonic
948186786 2:236027515-236027537 CAGTCTGCCCTGGGGGAGGCAGG - Intronic
948309011 2:236971276-236971298 CAGTCGGAGCCCAGGCAGCCAGG - Intergenic
948739262 2:240032261-240032283 CGGACGCTGCCGAGGGAGGCTGG + Intergenic
948942238 2:241202362-241202384 CTGTTGGCCCCCAGGGAGGCGGG + Intronic
949014526 2:241702009-241702031 CGGGCGGTGCCGCGGGAGGCGGG - Intergenic
1169426944 20:5504180-5504202 CAGCCAGCTCCGAAGGAGGCCGG + Intergenic
1171351080 20:24503832-24503854 CAGTAGGCGCTGGGGGTGGCAGG - Intronic
1172514485 20:35523484-35523506 CAGTAGGTGGCCAGGGAGGCAGG - Intronic
1174177995 20:48657060-48657082 CAGGAGGCGCAGAGGGCGGCGGG + Exonic
1175419597 20:58822989-58823011 CAGTAGGCGCCAGGGGTGGCGGG - Intergenic
1175873776 20:62220141-62220163 CAGGCGGTGCCGAGGGGGCCGGG + Exonic
1175887938 20:62302926-62302948 CAATCGGCGGCGAGAGCGGCAGG + Exonic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1181807592 22:25384395-25384417 CAGCCAGCGCCGTGGGAGTCGGG + Intronic
1184276525 22:43412092-43412114 CAGCGCGCACCGAGGGAGGCAGG - Intronic
1184534625 22:45078000-45078022 CAGGTGGTGCCGAGGGAAGCTGG + Intergenic
950769368 3:15299102-15299124 CAGTCAGCACCCAGGGAGCCAGG + Intronic
954265892 3:49470160-49470182 CAGTCGGCGCCGCGCGGAGCTGG + Exonic
954656666 3:52198216-52198238 GAGGCGGCGGCGAAGGAGGCGGG - Exonic
964087380 3:152834885-152834907 GAGTCGGCGGCGAGGGAGAGGGG - Exonic
966883685 3:184363008-184363030 CAGTCCGCGCCGAGGGCAGGTGG - Intronic
968883105 4:3311251-3311273 CAGCAGGCCCCGAGCGAGGCAGG - Intronic
976002071 4:80386105-80386127 CAGTCTGCCCCCAGGGAGCCTGG + Intronic
978318525 4:107466974-107466996 CTGTGGGGGCCGAGGGAGGCTGG - Intergenic
981550492 4:145937380-145937402 CAGTCGGAGCAGACGGAGCCGGG - Intronic
986503913 5:8429896-8429918 GAGTGGGGGCTGAGGGAGGCTGG - Intergenic
991676607 5:69094461-69094483 CAGCCTGCGCGCAGGGAGGCAGG - Intronic
992228376 5:74640584-74640606 CAGGCGCCGCGGAAGGAGGCGGG + Exonic
998374521 5:141682073-141682095 CCGCCGGCGCCGAGGGGGCCTGG + Intronic
999127648 5:149258277-149258299 CAGGTGGCGCTGAAGGAGGCAGG - Exonic
1003869342 6:10389952-10389974 CCGCCAGGGCCGAGGGAGGCGGG + Intergenic
1006402292 6:33824939-33824961 CAGTGTGCGCCAAGGGTGGCAGG + Intergenic
1007424112 6:41735660-41735682 CAGTGGGCGCCGAGGCAGAGCGG - Intronic
1015096248 6:129417638-129417660 CAGTGGGCGCCGTGGATGGCAGG - Intronic
1016934078 6:149436107-149436129 CAGTAGGGGCTGGGGGAGGCCGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018720011 6:166565362-166565384 CAGTCAGTCCCGAGGGAAGCTGG - Intronic
1019505032 7:1386421-1386443 CCGTCGGTGCCCAGGGAGGTGGG - Intergenic
1024270385 7:47637094-47637116 CAGGCGCGGCCCAGGGAGGCTGG - Intergenic
1026923729 7:74174525-74174547 CAGCCGGGGCGGCGGGAGGCGGG + Intronic
1027215074 7:76178446-76178468 CAGACGGCGAGAAGGGAGGCCGG + Intergenic
1034418741 7:150978240-150978262 CTGTCGGCGCGGTGGCAGGCGGG - Exonic
1035027187 7:155833796-155833818 CACTCAGCGCAGAGGCAGGCAGG - Intergenic
1035283808 7:157793899-157793921 GAGAGGGGGCCGAGGGAGGCAGG - Intronic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1036665203 8:10733127-10733149 CAGGCGACGCCAAGGGACGCGGG + Intronic
1038497240 8:28012181-28012203 CAGTCGGTGCCCAGGCAGGGTGG - Intergenic
1038828628 8:31033384-31033406 CAGGCTGTGCCGGGGGAGGCGGG - Exonic
1044569552 8:93701077-93701099 CAGTCCGCGCCGGGAGACGCTGG + Intronic
1049851859 8:144836848-144836870 CAGTCTGCAGCGAGGGAGGCAGG + Intronic
1052037314 9:23697017-23697039 CAGTCTTCCCCCAGGGAGGCAGG - Intronic
1056487960 9:87077686-87077708 CACTGGGCTCCTAGGGAGGCTGG + Intergenic
1057773217 9:97984640-97984662 CAGCCAGCGCCGAGGGCGGGCGG - Intronic
1059176798 9:112175339-112175361 CCGGCGCCGCCGAGGGAAGCGGG + Intronic
1061211813 9:129198084-129198106 CAGACGACCCTGAGGGAGGCAGG + Intergenic
1061420993 9:130472761-130472783 CAGTCAGCTCCAAGGGAGGCAGG + Intronic
1061681787 9:132246067-132246089 CTGTGGGCGCCAAAGGAGGCAGG - Intergenic
1061714113 9:132508203-132508225 CAGTCGGCGGCGCGGGGGGCGGG - Intronic
1061843878 9:133376070-133376092 CAGCCGACGCGGAGCGAGGCCGG - Exonic
1061950017 9:133931036-133931058 CATTCCGCCCCGAGTGAGGCTGG + Intronic
1062451749 9:136618653-136618675 CAGTGGGCGCCCACGGAGACTGG - Intergenic
1062583994 9:137240851-137240873 CTGGGGGCGCCGAGGGAGGGCGG - Intergenic
1185446691 X:261548-261570 CAGCCGGCTGCGTGGGAGGCCGG + Intergenic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1190862541 X:54358195-54358217 CCCGCGGCGCCGAGGGGGGCGGG - Intronic
1198674875 X:139120819-139120841 CAGTCTGCGGCTAAGGAGGCAGG - Intronic
1200239992 X:154488390-154488412 AGGTCGGCGCTGAGGGTGGCAGG + Exonic