ID: 1131277475

View in Genome Browser
Species Human (GRCh38)
Location 15:90994277-90994299
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131277475_1131277489 22 Left 1131277475 15:90994277-90994299 CCCTCGGCGCCGACTGCCGTGAC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1131277489 15:90994322-90994344 CGGGTCCCGCACCCCTGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 103
1131277475_1131277479 -10 Left 1131277475 15:90994277-90994299 CCCTCGGCGCCGACTGCCGTGAC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1131277479 15:90994290-90994312 CTGCCGTGACGATCTAGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
1131277475_1131277480 -9 Left 1131277475 15:90994277-90994299 CCCTCGGCGCCGACTGCCGTGAC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1131277480 15:90994291-90994313 TGCCGTGACGATCTAGGCCCGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1131277475_1131277483 3 Left 1131277475 15:90994277-90994299 CCCTCGGCGCCGACTGCCGTGAC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1131277483 15:90994303-90994325 CTAGGCCCGGGACCCCGCACGGG 0: 1
1: 0
2: 0
3: 15
4: 93
1131277475_1131277482 2 Left 1131277475 15:90994277-90994299 CCCTCGGCGCCGACTGCCGTGAC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1131277482 15:90994302-90994324 TCTAGGCCCGGGACCCCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131277475 Original CRISPR GTCACGGCAGTCGGCGCCGA GGG (reversed) Intronic