ID: 1131278064

View in Genome Browser
Species Human (GRCh38)
Location 15:90998986-90999008
Sequence CCTTATGGAGGCCATGAGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1131278064_1131278068 7 Left 1131278064 15:90998986-90999008 CCTCACTCATGGCCTCCATAAGG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1131278068 15:90999016-90999038 TGTTTGTGACTGCTGTCGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 102
1131278064_1131278069 29 Left 1131278064 15:90998986-90999008 CCTCACTCATGGCCTCCATAAGG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1131278069 15:90999038-90999060 GAAAATGAACCTGTAGCCTAAGG 0: 1
1: 0
2: 2
3: 10
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1131278064 Original CRISPR CCTTATGGAGGCCATGAGTG AGG (reversed) Exonic
901771412 1:11532089-11532111 CCTTAGGGTGGCCAGGAGTCCGG + Intronic
903238778 1:21968595-21968617 CCTTTTGGAGGACAGGAGGGAGG - Intergenic
906801827 1:48744752-48744774 CCTTATGGAGGCCATGGTGTGGG - Intronic
906902060 1:49845743-49845765 CCCTATGGATGCAACGAGTGTGG + Intronic
907487787 1:54789225-54789247 CCTGATAGAGGCCATGAGAGTGG + Intronic
907705468 1:56828656-56828678 CCTTATGCCTGCCATGAGAGAGG - Intergenic
911064991 1:93780057-93780079 CCTTAAGCAGGCCCTGAGGGTGG - Intronic
913106290 1:115616879-115616901 TTTTATGGAGCCCATGAGAGAGG + Intergenic
915699505 1:157777696-157777718 CCTTTTAGGGGTCATGAGTGTGG - Intergenic
916313774 1:163425471-163425493 CCTTATCGAGGCAATCAATGGGG + Intergenic
916364415 1:164008313-164008335 ACTTAAGGAGGCCCTGAGGGTGG + Intergenic
916658302 1:166897561-166897583 CCTTAGGGAGGGGAGGAGTGGGG + Intergenic
923206039 1:231759837-231759859 TCTTATTGAGGCCATGACTAAGG - Intronic
1063945468 10:11171888-11171910 CTTTATGGAGGACTGGAGTGGGG + Intronic
1065522815 10:26588700-26588722 CCTTGTGCCGGCCATGATTGGGG - Intergenic
1066676798 10:37896489-37896511 CCCTATGGATGTAATGAGTGTGG + Intergenic
1066700050 10:38117959-38117981 CCTTATGAATGTCATGAATGTGG + Exonic
1066700071 10:38118127-38118149 CCTTATGGATGTCATGAATGTGG + Exonic
1066794979 10:39110154-39110176 CAGTATGGAGGCTATGATTGCGG + Intergenic
1066991683 10:42520534-42520556 CCTTATGAATGTCATGAATGTGG - Intergenic
1067910563 10:50342688-50342710 CCTTATGGTTTCCATGAATGAGG - Intronic
1069988379 10:72299058-72299080 GCTTCTGGAGGCCACGAGCGTGG - Intergenic
1070369686 10:75770657-75770679 CCTTGTGGAGGCCGAGGGTGGGG + Intronic
1071985493 10:91046164-91046186 CCTTATTGAGGAAATGAATGTGG + Intergenic
1076982714 11:213341-213363 CCCTATGGAGGGCATGACAGAGG + Exonic
1081374981 11:42347680-42347702 CCTTTTGGAGGCAAGGAGTGTGG + Intergenic
1082769163 11:57192557-57192579 CCATTTAGAGGCTATGAGTGCGG - Intergenic
1083199148 11:61109343-61109365 CCTTACGGTCGCCATGTGTGTGG - Intronic
1085944696 11:81254193-81254215 CCTTATGGAGAAAATGTGTGTGG + Intergenic
1089058171 11:115604443-115604465 TCTTCTGGAGGACAGGAGTGGGG + Intergenic
1090877986 11:130807966-130807988 CCTTTAGGAGGTCATGAGGGTGG - Intergenic
1091111827 11:132976490-132976512 CCTTGTGGAGGCCAAGGATGAGG + Intronic
1093657689 12:21715624-21715646 TCTGGTGAAGGCCATGAGTGAGG - Intronic
1095261928 12:40106865-40106887 CCTCATGGAGGGCAACAGTGGGG - Intergenic
1100079097 12:90825881-90825903 GCTTATGGAGGCCATCATTCTGG - Intergenic
1102879010 12:116470031-116470053 CCTTCTGGAGGCACTGAGGGAGG - Intergenic
1105036365 12:132925935-132925957 CCTTATGAATGCAGTGAGTGTGG - Exonic
1105051607 12:133057667-133057689 CCCTATGGATGCAATGAATGTGG + Exonic
1105056564 12:133105755-133105777 CCCTATGGATGCCATGAATGTGG + Exonic
1105066398 12:133203181-133203203 CCTTATGTATGCAATGAATGTGG + Intergenic
1105066412 12:133203349-133203371 CCCTATGAATGCCATGAATGTGG + Intergenic
1105066449 12:133203769-133203791 CCATATGGATGCAGTGAGTGTGG + Intergenic
1107519771 13:41167985-41168007 CCTTTGGGAGGTCATGAGGGTGG + Intergenic
1107555457 13:41513624-41513646 CCTGTTTGAGGTCATGAGTGAGG + Intergenic
1112023800 13:95394373-95394395 ACTTATGGAGGCCATTACAGTGG + Intergenic
1113188542 13:107717695-107717717 CCTTCTGAAAGCCAGGAGTGGGG + Intronic
1120143971 14:80959155-80959177 CCTTCTGGAGGGGAGGAGTGAGG - Intronic
1121974310 14:98388708-98388730 CCTTATGGGGGCCATGAAGCTGG - Intergenic
1122623166 14:103071109-103071131 CCTGATGGAGGCCGGGAGGGAGG + Intergenic
1123115038 14:105890727-105890749 CCTGCAGGAGGCCCTGAGTGAGG + Intergenic
1202888679 14_KI270722v1_random:134234-134256 CCCTATGGATGCAATGAATGTGG + Intergenic
1129604010 15:77016019-77016041 CCTTATGGAGGCCCCCAGAGTGG - Intronic
1129613745 15:77082037-77082059 CCGGATGGAGGCCATGGGTGAGG + Intronic
1131278064 15:90998986-90999008 CCTTATGGAGGCCATGAGTGAGG - Exonic
1132888622 16:2193761-2193783 CCTTGAGGAGACCATAAGTGGGG - Intronic
1133131378 16:3677998-3678020 CCATAGGAAGGCCAGGAGTGAGG + Intronic
1138696053 16:58814559-58814581 CTTTATGAAGGACTTGAGTGAGG + Intergenic
1141638972 16:85330066-85330088 CCTGGTGGCGGCCAGGAGTGGGG + Intergenic
1142639493 17:1277614-1277636 CCTCAGGGAGGCCAGGTGTGGGG - Intergenic
1142698534 17:1646338-1646360 CCTGATGCAGGCCAGGATTGGGG + Exonic
1142964451 17:3572035-3572057 CCTCATGGAGGCCCTGAGGCAGG + Intronic
1143718991 17:8797374-8797396 GCTTGTGAAGGCCATGAGGGAGG - Exonic
1144491560 17:15716697-15716719 CCTTATGAATGCAATGAATGTGG + Exonic
1144682224 17:17203730-17203752 CCTTAAGCAGGTCGTGAGTGAGG - Intronic
1144908923 17:18662508-18662530 CCTTATGAATGCAATGAATGTGG - Exonic
1147658598 17:42105098-42105120 CCTTCTGGTGGCCACGAGTGTGG - Exonic
1151355412 17:73555252-73555274 CCTCATGGAGGGCTTGAGTCTGG + Intronic
1151543900 17:74780279-74780301 CCCCATGCAGGTCATGAGTGAGG + Intronic
1152800444 17:82328368-82328390 CTGTATGCAGGGCATGAGTGGGG - Intronic
1153322773 18:3789753-3789775 CATTTGGGAGGACATGAGTGAGG + Intronic
1156047609 18:32895027-32895049 CCTTATGGAAGCTATGAAAGAGG - Intergenic
1156249389 18:35337485-35337507 CCTTATGGATGTGTTGAGTGTGG - Exonic
1157991696 18:52504283-52504305 CATCATGGAGGCCTTGAGTCTGG + Intronic
1159424869 18:68272216-68272238 CCTTCTGGAGGCTCTGAGGGAGG - Intergenic
1160096888 18:75881752-75881774 CCAGATGGGGGCCACGAGTGTGG + Intergenic
1161105734 19:2443185-2443207 CCTGATGGTGGCCATGAGCCGGG - Intronic
1162329197 19:10017051-10017073 CCTCATGGTGGCCACGACTGCGG - Exonic
1162657909 19:12145658-12145680 CCTTATGAATGCAGTGAGTGTGG - Exonic
1163678567 19:18667862-18667884 CCTGAAGGCGGCCATGAGCGTGG + Exonic
1165299311 19:34958404-34958426 CCTTATGAATGCAATGAATGTGG - Exonic
1165556677 19:36639089-36639111 CCTTATGAATGTCATGAATGTGG - Exonic
1165567959 19:36748248-36748270 CCTTATCGATGTCATGAATGTGG - Exonic
1165643679 19:37413747-37413769 CCTTATGAATGTAATGAGTGTGG - Exonic
1166633472 19:44428796-44428818 CCTTACAGATGCCAAGAGTGCGG - Exonic
1166638909 19:44477153-44477175 CCTTATGAATGCAATCAGTGTGG - Exonic
1167816924 19:51891081-51891103 CCTTATGGATGCATTGACTGTGG - Exonic
1167819601 19:51914980-51915002 CCTTACGAATGCCTTGAGTGCGG - Intronic
1167825113 19:51965650-51965672 CCTTATGAATGCCCTGAATGTGG - Exonic
1167828163 19:51993775-51993797 CCTTATAAATGCAATGAGTGTGG - Exonic
1167832221 19:52033871-52033893 CCTTATGGATGTAATGAATGTGG - Exonic
1167876309 19:52416074-52416096 CCTTATGGATGCAGTCAGTGTGG + Exonic
1167956423 19:53068402-53068424 CCTTACCGATGCAATGAGTGTGG - Exonic
1168560486 19:57378027-57378049 CCTTATGAATGCAGTGAGTGTGG + Exonic
1168565696 19:57420477-57420499 CCTTATGGATGCAATGAATGTGG + Exonic
1168591684 19:57641336-57641358 CCTTATGAATGCAATGAATGTGG + Exonic
1168608533 19:57779368-57779390 CCTTATGAATGCGTTGAGTGTGG + Exonic
1168620239 19:57873141-57873163 CCTTATGAATGCAATGATTGTGG - Exonic
1168647271 19:58067793-58067815 CCCTATGGATGCAACGAGTGTGG + Exonic
1168647334 19:58068213-58068235 CCGTATGGGTGCAATGAGTGTGG + Exonic
1168656024 19:58128626-58128648 CCTTATGAATGCCTAGAGTGTGG - Exonic
1202664081 1_KI270708v1_random:101028-101050 CCCTATGGATGCAATGAATGTGG + Intergenic
925062665 2:905188-905210 CCTTATGGATGCCATCAGGTTGG - Intergenic
925526234 2:4805373-4805395 CTTTCTGGAGGTCTTGAGTGTGG - Intergenic
926117764 2:10224231-10224253 GGTGATGGAGGCCCTGAGTGAGG + Intergenic
927873616 2:26640049-26640071 CCTCGTGGAGGCCCTGAGGGTGG - Intronic
929374406 2:41268113-41268135 CCTTATGGTGGGCGTGAATGTGG - Intergenic
934541830 2:95181678-95181700 CCTTATGAATGTCATCAGTGTGG + Exonic
934545794 2:95214860-95214882 CCCTATGAATGTCATGAGTGTGG + Exonic
936818058 2:116484636-116484658 GGTTATGGAGGTCATGGGTGTGG - Intergenic
939047892 2:137270712-137270734 TCTGATGGAGGACAGGAGTGAGG + Intronic
939167505 2:138655230-138655252 CCTTGTGGAGAACCTGAGTGTGG + Intergenic
939659861 2:144875488-144875510 CCTTATTTTGGCCTTGAGTGTGG + Intergenic
943580154 2:189674698-189674720 CCTTGCGGAGGCCCTGAGGGCGG + Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
946988317 2:225300062-225300084 CCTAATGGAAGGCATGAGTCTGG - Intergenic
948477904 2:238232319-238232341 CCGTACGGAGGACATGACTGAGG + Intergenic
948634054 2:239322801-239322823 GCTTATCGAAGCCAGGAGTGGGG - Intronic
1171510079 20:25675132-25675154 CCTTATGAATGCCAAGAGTGTGG - Exonic
1171510163 20:25675807-25675829 CCTTATGGATGTCGGGAGTGTGG - Exonic
1171510210 20:25676227-25676249 CCTTACAGATGCCAGGAGTGTGG - Exonic
1171510227 20:25676395-25676417 CCTTATGAATGCCAGGAGTGTGG - Exonic
1172576141 20:36010306-36010328 CGTTATGGAGGCCAGGAGCTTGG - Intronic
1173485387 20:43437337-43437359 CCCAAAGGAGGCCATGAATGAGG + Intergenic
1174560809 20:51429367-51429389 CCTTTTGGAGGCCACGTGGGTGG + Intronic
1175371842 20:58497432-58497454 CCTGCTGGAGGCCATGAGTCTGG + Intronic
1175711176 20:61222232-61222254 CTTTCTGGAGGCCCTAAGTGAGG - Intergenic
1178598610 21:33976677-33976699 CTTTGGGGAGGCCAAGAGTGGGG - Intergenic
1180330808 22:11477912-11477934 CCCTATGGATGCAATGAATGTGG + Intergenic
1180787865 22:18557053-18557075 CCTTCTGGAGGCCATGACTCTGG + Intergenic
1181233871 22:21438253-21438275 CCTTCTGGAGGCCATGACTCTGG - Intronic
1181244776 22:21496578-21496600 CCTTCTGGAGGCCATGACTCTGG + Intergenic
1183494592 22:38135368-38135390 GCTTCTGGAGGCCACCAGTGAGG - Intronic
1184473769 22:44710099-44710121 CCAAAGGGAGGCCATGGGTGCGG + Intronic
952160029 3:30684101-30684123 CCTAATGGAGGCCCTGAGAATGG + Intronic
953625883 3:44570590-44570612 CCTTATGAATGCAATGAGTGTGG + Exonic
953628932 3:44594842-44594864 CCTTATGAATGTGATGAGTGTGG + Exonic
955095197 3:55790253-55790275 CCCAATGAAGGCCATGAGGGAGG - Intronic
957091742 3:75737332-75737354 CCTTATGAATGTAATGAGTGTGG - Intronic
957091872 3:75738589-75738611 CCCTATGGATGCAATGAATGTGG - Intronic
960149536 3:114236827-114236849 CCTTATGAATGCCAGGAGTGTGG - Exonic
960951054 3:122998681-122998703 CCTAAAGGAGGCCAGGAGTCAGG - Intronic
961198209 3:125021709-125021731 GCTTATGGTGGCCATGAGGTAGG - Intronic
963811321 3:149779413-149779435 ACTTTTGGAGGCCAAGAGAGGGG - Intronic
966102546 3:176289444-176289466 TCTCATGGATGCCATGAGGGAGG + Intergenic
968327392 3:197830795-197830817 CCTTATGGAGCCCTTGATTCAGG + Exonic
968972799 4:3804644-3804666 ACTTTTGGAGGCCAAGGGTGGGG + Intergenic
969092453 4:4705175-4705197 CCTTCTGGAGGCTGTGAGGGAGG - Intergenic
974194222 4:58550775-58550797 CCTTCAGGAGGTCATGAGGGTGG + Intergenic
975230261 4:71924349-71924371 CCTAATGGGGGCTCTGAGTGAGG - Intergenic
975411747 4:74060684-74060706 CATTATGGAGGCTATGAGGAAGG + Intergenic
975838333 4:78448207-78448229 CCACGTGGAGGCCATCAGTGAGG - Intronic
981691810 4:147517267-147517289 CCTCATGGAGGCAAACAGTGGGG - Intronic
982099110 4:151951213-151951235 CCTTAAGGAGGCCAGAAGTTTGG - Intergenic
982308846 4:153962841-153962863 CCTTCTGGAGGCTCTGAGGGAGG - Intergenic
984200190 4:176710198-176710220 CATTTTGGAAGCCATGAGTATGG + Intronic
985248426 4:187999222-187999244 CCCAAGGGAGGCCGTGAGTGGGG - Exonic
989527240 5:42467701-42467723 CCTTTTGAATGTCATGAGTGTGG - Intronic
993330244 5:86590850-86590872 CCTTGAGGAGGCTATTAGTGAGG - Intergenic
997161028 5:131609442-131609464 CCTTTTGGTGGGCATTAGTGTGG - Intronic
997286339 5:132681389-132681411 GCTGATGGAGGCCATGGGTGAGG + Intronic
997758664 5:136423825-136423847 CCTGGTGGAGGCGATGAGTCAGG + Intergenic
999357605 5:150951150-150951172 CCCTATGAATGCAATGAGTGTGG - Intergenic
1001554943 5:172630817-172630839 CCTTCTGCAGGCGAGGAGTGAGG + Intergenic
1002022315 5:176371724-176371746 CCTGAGCGAGGCCATGAGTATGG + Exonic
1005593915 6:27359386-27359408 CCTTATGAATGCAATGAATGTGG - Intergenic
1005598338 6:27400860-27400882 CCTTATGAATGCAATGAATGTGG + Exonic
1005704124 6:28434787-28434809 CCTTATGAATGTGATGAGTGTGG - Exonic
1010478235 6:76316480-76316502 CCTTTGGGAGGTCATGAGGGTGG - Intergenic
1011284782 6:85711380-85711402 CTTTAAGGAGGTCATAAGTGTGG + Intergenic
1013417328 6:109936691-109936713 ACTTTTGGAGGCCAGGAGGGTGG - Intergenic
1015138564 6:129902842-129902864 CTTTCTGGAGGCAATGAGGGAGG + Intergenic
1017017921 6:150116468-150116490 CCTTATTGACACCATGAATGGGG - Intergenic
1017132533 6:151120079-151120101 TCTTGAGGAGGCCATGAGGGTGG + Intergenic
1023309678 7:38871946-38871968 CATTTTGGTGGCCAGGAGTGTGG - Intronic
1029294180 7:99526325-99526347 CCCTATGGCTGCAATGAGTGTGG + Exonic
1029353675 7:100033883-100033905 CCTTATGAATGTAATGAGTGCGG + Exonic
1033207658 7:139436662-139436684 CCTTAGAGAGGCCAAGAGTAGGG - Intergenic
1037232970 8:16681863-16681885 CCTTCTGGAGGCTCTGAGGGAGG + Intergenic
1037497295 8:19452175-19452197 CCTTTTGGAGGCGGTCAGTGGGG - Intronic
1039408991 8:37336192-37336214 CCTGTTGCAGGCCAGGAGTGTGG - Intergenic
1040466775 8:47702787-47702809 CCTCAAGGAGGCAATGTGTGGGG - Intronic
1045520089 8:102895949-102895971 ACTTTGGGAGGCCATGAGGGTGG - Intronic
1045550527 8:103167707-103167729 CATCATGCAAGCCATGAGTGAGG + Intronic
1047319452 8:123765906-123765928 CATTCTGGAGTCTATGAGTGGGG + Intergenic
1048855886 8:138686319-138686341 CCTTGTGGCGGCCCTGACTGTGG + Intronic
1049630315 8:143650908-143650930 CCTTACGTATGCAATGAGTGTGG + Exonic
1050099153 9:2099922-2099944 CCTAATGGAGACCATGGGTTTGG + Intronic
1052021533 9:23531129-23531151 CCTTATAGAAACCATCAGTGAGG + Intergenic
1052210864 9:25901754-25901776 CATAATGGTGGCCATCAGTGAGG + Intergenic
1052283703 9:26760912-26760934 TCTTCTGGAGGCCTTGAGGGGGG - Intergenic
1052819984 9:33130813-33130835 CCTGATGCGGGCCCTGAGTGGGG + Intronic
1057705638 9:97393058-97393080 ACATAGGAAGGCCATGAGTGAGG + Intergenic
1203792937 EBV:161240-161262 CCTTGTGGATGCCATGGGCGAGG - Intergenic
1203485880 Un_GL000224v1:54157-54179 CCCTATGGATGCAATGAATGTGG + Intergenic
1186035907 X:5423461-5423483 CCTTTGGGAGGTCATGAGGGTGG + Intergenic
1190178015 X:48167492-48167514 CATTAAGGAGGACAGGAGTGTGG + Intergenic
1193463995 X:81824981-81825003 CCTTAAAGATGCCATGAGTCAGG - Intergenic
1200791661 Y:7304864-7304886 CCTTTGGGAGGTCATGAGGGTGG - Intergenic